Highly active recombinant heat-sensitive udg mutant and its prokaryotic expression vector

Abstract

The application provides a high-activity recombinant heat-sensitive UDG mutant, which is characterized by that the amino acid sequence is shown in any one of SEQ ID NO: 1, 2 or 5. Its prokaryotic expression vector is also disclosed. The application carries out point mutation on the basis of wild-type heat-sensitive UDG (psychrophilic marine bacterium), the mutant can significantly improve the heat sensitivity of UDG, and improve the digestion capacity of the enzyme on the U-containing template in vitro. By fusing SUMO protein at the N terminal of the vector, the recombinant protein can be obtained in large quantities through supernatant expression in the prokaryotic expression system of Escherichia coli and affinity purification. The recombinant protein can have higher compatibility for reaction systems such as qPCR. The best effect is obtained by UDGm-1, UDGm-2 and UDGm-5.

Description

Technical Field

[0001] This invention patent relates to a highly active recombinant thermosensitive UDG mutant and its prokaryotic expression vector, belonging to the field of biotechnology. Background Technology

[0002] Uracil DNA glycosylase (UDG) cleaves the N-glycosidic bond between a misplaced uracil (U) base and a sugar moiety in DNA, removing the uracil and leaving a base-free site. This site can be recognized and repaired by other enzymes, such as DNA polymerase and DNA ligase. Uracil-DNA glycosylase (UDG) initiates the repair of uracil in DNA, reducing the transversion rate from cytosine (C) and guanine (G) base pairs to adenine (A) and thymine (T) base pairs, preventing and repairing mismatches in DNA, and is one of the self-protective mechanisms of organisms to reduce mutations.

[0003] In addition, UDG is also a tool enzyme to prevent false positives in PCR reactions. In vitro, UDG catalyzes the hydrolysis of uracil glycosidic bonds (base removal) in DNA strands containing U-DNA sites, releasing uracil and generating base-sensitive uracil-free sites (AP-DNA). This prevents dUTP-containing nucleic acids from being amplified as templates, thus preventing false positives in PCR reactions caused by aerosols and other factors. This enzyme can act on both single-stranded and double-stranded DNA containing uracil, but its activity on double-stranded DNA is lower than that on single-stranded DNA. Thermosensitive UDG is usually inactivated at low temperatures; for example, after breaking the dUTP nucleotide bonds on the nucleic acid strand, incubation at 50°C will inactivate it. It can be used in conjunction with detections requiring subsequent reverse transcription, qPCR, and isothermal amplification reactions to improve detection accuracy and simplify procedures. This eliminates false positives caused by U-containing template contamination.

[0004] Currently, commonly used heat-sensitive UDGs are mainly derived from psychrophilic marine bacteria (UDGs). However, they are difficult to express in supernatant using E. coli prokaryotic expression systems, and their various properties cannot meet the requirements for multiple detection scenarios involving subsequent qPCR, etc. The main drawbacks are as follows:

[0005] 1. Wild-type UDG derived from psychrophilic marine bacteria has a heat inactivation temperature above 50℃. When used in detection methods such as LAMP, RT-LAMP, and qPCR, it cannot be completely inactivated before subsequent reactions after digesting the background U-containing template. This leads to continuous digestion of U-containing target products after reverse transcription and qPCR amplification, reducing the sensitivity of the detection system and causing false negatives. It also makes subsequent reactions more susceptible to inhibition.

[0006] 2. The specific activity of the current thermosensitive UDG is relatively low. Under the same digestion capacity, the required enzyme molecular weight is relatively high, which can easily affect the subsequent system, such as affecting the amplification effect of Taq enzyme or the yield of reverse transcriptase.

[0007] 3. Currently, thermosensitive UDG cannot be expressed in supernatant using a prokaryotic expression system. After refolding, purification is difficult, and the refolded protein cannot maintain its original protein structure, which affects the stability of the subsequent protein and further affects the stability and accuracy of the detection system.

[0008] These three defects affect the sensitivity, accuracy, and stability of anti-contamination qPCR LAMP and RT-LAMP detection, thus hindering the popularization and development of related technologies. Summary of the Invention

[0009] The purpose of this invention is to provide a highly active recombinant thermosensitive UDG mutant, which has a significantly lower thermal inactivation temperature compared to wild-type UDG.

[0010] This invention involves single-site mutations of His72Asn, Ser77Ala, Ala134Ser, Lys171His, and Asn143Ser in wild-type thermosensitive UDG (psychrophilic marine bacterium) [Molecular cloning, sequencing, and expressing of the heat-labile uracile-DNA Glycosylase from a marine psychrophilic bacterium, strain BMTU 3346] to obtain mUDG1–5, whose amino acid sequences are shown in SEQ ID NO: 1–5. A SUMO tag is then fused to the N-terminus of the mutated protein sequence, and the supernatant is expressed using an E. coli prokaryotic expression system. The constructed prokaryotic expression vector structure is: pET28a-N6H-SUMO-UDGm, where N6H is the N-terminal His tag and SUMO is the SUMO tag.

[0011] N6H-SUMO and UDGm are linked by an rTEV restriction site, the amino acid sequence of which is Glu-Asn-Leu-Tyr-Phe-Gln-Gly (the cleavage site is between Gln and Gly), and the specific nucleic acid sequence is GAAAACCTGTATTTCCAGGGT.

[0012] This invention involves point mutation of wild-type thermosensitive UDG (psychrophilic marine bacterium). The mutant significantly enhances the thermosensitivity of UDG, thereby improving the enzyme's ability to digest U-containing templates in vitro. By fusing SUMO protein to the N-terminus of a vector, this recombinant protein can be expressed in large quantities in an E. coli prokaryotic expression system via supernatant expression followed by affinity purification. It exhibits higher compatibility with qPCR and other reaction systems. The most effective mutants are mUDG1, mUDG2, and mUDG5. Attached Figure Description

[0013] Figure 1 Schematic diagram of the construction of the recombinant UDG vector.

[0014] Figure 2 Detection of the full U template digestibility and thermal stability of mUDGs mutants.

[0015] Figure 3 Image showing the purification effect of mUDGs mutants.

[0016] Figure 4 Comparison of the digestion capacity of UDG mutant and wild-type UDG for the whole U template.

[0017] Figure 5 Thermal stability tests of UDG mutant and wild-type UDG.

[0018] Figure 6 Compatibility testing of UDG with existing UDG products in qPCR systems and comparison with non-UDG systems.

[0019] Figure 2 , 3 In m1 and m2, m3 represents mUDG1, m4 represents mUDG4, and m5 represents mUDG5. Detailed Implementation

[0020] The specific embodiments of the present invention will be further described below with reference to the accompanying drawings. The primer sequences used in this embodiment are shown in Table 1.

[0021] Table 1: Primer sequences

[0022] SEQ ID No. sequence name 5’-3’ 1 mUDG1-F TCCGACGCCGGGTAATCC 2 mUDG1-R CAGGCCAATCGGATTACCCG 3 mUDG2-F TCATCCGATTGGCCTGGCCTTTG 4 mUDG2-R TCCACGGCAAAGGCCAGGC 5 mUDG3-F TGCGTGCAGGTGCATCGGC 6 mUDG3-R GCGATGGCTGGCCGATGCAC 7 mUDG4-F GGCAATGATGCACGTTCTATGGCAC 8 mUDG4-R GAACTGGTGCCATAGAACGTGCATC 9 mUDG5-F TATTGAAAGCCCGCATAACAGCC 10 mUDG5-R CGCTCAGTGGGCTGTTATGC 11 UDGsub-F TCTCGTTTCATCGGTATCAT 12 UDGsub-R TCATCAGCGTGGTCGTG 13 hGAPDH-F GAAGGTGAAGGTCGGAGT 14 hGAPDH-R GAAGATGGTGATGGGATTTC 15 hGAPDH-P CAAGCTTCCCGTTCTCAGCC 5'6-FAM, 3'BHQ1 16 hGAPDH-P CAAGCTTCCCGTTCTCAGCC 5'VIC, 3'BHQ1

[0023] Example 1: Detection of the crude enzyme of recombinant thermosensitive UDG mutant against a full-U template and its thermal stability.

[0024] In this embodiment, based on the active site and DNA binding site of the thermosensitive UDG, some conserved active amino acid sites were selected for mutation, and then the performance of the thermosensitive UDG mutant enzyme stock solution was tested. The specific implementation method is as follows:

[0025] 1) Preparation of thermosensitive UDG mutant prokaryotic expression strain

[0026] First, an N6H-SUMO sequence was ligated to the N-terminus of the wild-type UDG sequence, and then ligated to the UDG sequence using an rTEV recognition sequence. The amino acid sequence of N6H-SUMO is shown in SEQ ID NO: 6. The vector structure is pET28a-N6H-SUMO-UDG. The DNA sequence of wild-type N6H-SUMO-rTEV-UDG is shown in SEQ ID NO: 7. Point mutation primers were designed using wild-type UDG as the mutation site, and amplification and digestion were performed according to the point mutation kit instructions (Yeasen, 11003ES10). The resulting cells were transformed into DH5α E. coli competent cells, plated on LB agar plates containing kanamycin, and incubated overnight at 37°C inverted.

[0027] Select healthy single colonies and place them in LB liquid medium containing kanamycin. Incubate at 37°C with shaking at 200 rpm / min. Then, perform first-generation Sanger sequencing to verify the bacterial culture.

[0028] Plasmids were extracted from the successfully sequenced strains to obtain the pET-28a-UDG mutant expression plasmid, which was then transformed into BL21(DE3) E. coli competent cells and plated onto LB agar plates containing kanamycin. The plates were incubated overnight at 37°C with the plates inverted. Healthy single colonies were then removed and placed on plates containing kanamycin. In LB broth containing kanamycin, the culture was carried out at 37°C with shaking at 200 rpm until the OD600 reached 0.6. IPTG was then added to a final concentration of 0.1 mM, and the mixture was incubated overnight at 16°C with shaking for induction.

[0029] 2) Purification of thermosensitive UDG mutant enzyme stock solution

[0030] BL21(DE3) Escherichia coli containing the pET-28a-UDG mutant expression plasmid were inoculated into fresh LB medium containing kanamycin at an inoculation density of 1:100 and cultured at 37°C with shaking for 3 hours until the OD600 value reached 0.5. IPTG was then added to a final concentration of 0.1 mM, and the culture was incubated at 18°C ​​with shaking for 18 hours. The bacterial cells were collected by centrifugation at 4000g and 4°C, weighed, and stored at -80°C. The cells were resuspended at a ratio of bacterial weight to lysate of 1:10, and sonicated on ice (2 seconds sonication followed by 4 seconds of rest). The supernatant was collected by centrifugation at 12000g and 4°C, and purified by Ni to obtain the heat-sensitive crude UDG enzyme solution.

[0031] 3) Thermal UDG performance testing

[0032] The thermosensitive UDG enzyme stock solution was tested for its ability to digest U-containing products, its thermosensitivity, and its compatibility with the qPCR system.

[0033] Full U substrate amplification was performed. The PCR amplification reaction system is shown in Table 2, and the reaction procedure is shown in Table 3. First, 2 μl of the product was taken for electrophoresis quality control. The product size was 200 bp. For single bands, direct purification was performed using a gel extraction kit. The purified product was then used to test the digestibility and thermosensitivity of U-containing substrates.

[0034] Table 2. PCR amplification reaction system for all-U substrate amplification

[0035] Total system (50 μl) <![CDATA[10×Taq buffer(Mg 2+ Free)]]> 5μl <![CDATA[MgCl2(25mM)]]> 3μl pET28a 5ng UDGsub-F (10μM) 2μl UDGsub-R (10μM) 2μl Taq DNA polymerase (5 U / ul) 0.4μl dNTPs (10mM) 0.25μl dUTP(10mM) 2.75μl Add ddH2O to To 50μl

[0036] Table 3. PCR reaction procedure for full-U substrate amplification

[0037]

[0038] Table 4. Test system for digestibility of U-containing products in thermosensitive UDG:

[0039] Mix volume <![CDATA[10×Taq buffer(Mg 2+ Free)]]> 1μl BSA (1 mg / ml) 0.1μl PCR purified product (100 ng / μl) 300ng sample 0.5μl <![CDATA[Add ddH2O to]]> 10μl

[0040] The test system was prepared according to the component allocation shown in Table 4, and the test samples were added separately. After vortexing and mixing, the mixture was incubated at 37°C for 12 min using a PCR instrument, followed by heat inactivation at 94°C for 10 min. The reaction system was then analyzed by 1% agarose gel electrophoresis to detect its digestion effect on U-containing templates. The results are as follows: Figure 2 As shown, mUDG1, mUDG2, and mUDG5 can significantly improve the thermosensitivity of UDG. This indicates that the three point mutations His72Asn, Ser77Ala, and Asn143Ser can significantly improve the thermosensitivity of UDG while ensuring its enzyme activity, thus better meeting the needs of downstream applications.

[0041] Example 2: Purification of thermosensitive UDG enzyme mutant

[0042] This embodiment discloses a specific purification scheme for mUDG.

[0043] mUDG-induced expression

[0044] BL21(DE3) Escherichia coli containing the pet28a-mUDG expression plasmid were inoculated into fresh LB medium containing kanamycin at an inoculation density of 1:100. The medium was incubated at 37°C with shaking for 4 hours until the OD reached 0.6. IPTG was then added to a final concentration of 0.1 mM, and the medium was incubated at 18°C ​​with shaking for 16 hours. The cells were collected by centrifugation at 5000 x g at 4°C. 30 g of the cells were weighed and resuspended in 180 ml of pre-chilled lysis buffer (20 mM Tris-HCl, 200 mM NaCl, 10% Glycerol, 0.2 mM PMSF). The cells were sonicated for 30 min (2 s sonication followed by 4 s pause), centrifuged at 12000 g for 30 min, and then filtered through a 0.45 μm filter. The filtered supernatant was purified by Ni-NTA to obtain a crude enzyme solution. The crude enzyme solution was then digested with rTEV and purified by Ni-NTA. The eluent was further purified by phenyl column chromatography to obtain an enzyme solution with a purity >95%. This solution was stored at -20°C in a storage buffer (20 mM Tris, 100 mM KCl, 0.1 mM EDTA, 1 mM MTT, 60% Glycerol, 0.1% NP-40, 0.1% Tween 20). The yield was approximately 180,000 U. The purification results are as follows: Figure 3 The results show that it can meet the needs of large-scale production.

[0045] Example 3: Comparison of the digestion performance of UDG mutant and wild-type UDG on the whole U template.

[0046] In this embodiment, the digestion ability of mUDG and wild-type thermosensitive UDG on whole U template was compared. Specifically, the digestion ability of three UDG mutants (mUDG1, mUDG2, and mUDG5) with good thermosensitivity in Example 1 was tested under the same enzyme input. The reaction system was prepared according to Table 3, vortexed, and incubated at 37°C for 12 min using a PCR instrument, followed by heat inactivation at 94°C for 10 min. The digestion effect on U-containing template was then detected by 1% agarose gel electrophoresis. The results are as follows: Figure 4 The specific activity (U / μg) of the mutated UDG was increased to varying degrees compared with that of wild-type UDG.

[0047] Example 4: Comparison of thermosensitivity between UDG mutant and wild-type UDG.

[0048] In this embodiment, the thermosensitivity changes between the UDG mutant and wild-type UDG were verified. Specific implementation details are provided in Example 1. The results are as follows: Figure 5 As shown, mUDG1, mUDG2, and mUDG5 all exhibit higher heat sensitivity than wild-type UDG.

[0049] Example 5: Comparison of the compatibility of mUDG and wild-type UDG with qPCR reaction system.

[0050] In this embodiment, the compatibility of UDG mutants and wild-type mutants with qRT reactions in the FAM and VIC channels was tested. Human hGAPDH was used as the detection gene, and qPCR primers and probes were designed as shown in Table 1 (SEQ ID No. 13-16). qRT detection was performed, and the reaction system was prepared as shown in Table 5. The qRT reaction program was set as shown in Table 6. Previous experiments showed that wild-type UDG caused a certain delay in CT values ​​in the qRT reaction. The mutated UDG mutants were able to reduce the CT value delay caused by the introduction of UDG to a certain extent, and their CT values ​​were closer to those of the non-UDG system. The results are as follows: Figure 6 As shown.

[0051] Table 5 Compatibility test system between UDG and qPCR reaction system

[0052] 25ul Mix System volume 2X buffer (Yeasen, 13108) 12 enzyme mix 4 Primers ( 1 template 5 10mM dUTP 0.75 UDG ase 1U / ul 0.5 <![CDATA[H2O up to]]> 25ul

[0053] Table 6. Compatibility Test Procedures for UDG and qPCR Reaction Systems

[0054] temperature time Cycle number 37℃ 10min 1 50℃ 10min 1 95℃ 5min 1 95℃ 10s 45 55℃ 40s (fluorescence acquisition) 45

Claims

1. A highly active recombinant heat-sensitive UDG mutant characterized by: The amino acid sequence is shown as SEQ ID NO:

1.

2. The prokaryotic expression vector of the high-activity recombinant heat-sensitive UDG mutant according to claim 1.

3. The prokaryotic expression vector according to claim 2, characterized in that: The vector adopts a pET28a plasmid, and the vector structure is pET28a-N6H-SUMO-UDGm, wherein N6H is an N-terminal His tag, SUMO is a SUMO tag, and UDGm is coding DNA of the high-activity recombinant heat-sensitive UDG mutant.

Images