Dengue tetravalent mRNA vaccine, liposome nanoparticle and preparation method and application thereof

CN115779076BActive Publication Date: 2026-06-26ARMY MEDICAL UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ARMY MEDICAL UNIV
Filing Date
2022-10-10
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

There is a lack of effective nucleic acid vaccines against the four serotypes of dengue virus in the current technology, and live attenuated vaccines have safety risks and ADE effects, and cannot effectively protect susceptible populations.

Method used

A tetravalent dengue mRNA vaccine was developed, which encodes EDIII and TBT mRNAs in vitro by modifying pseudouracil and packaging them into lipid nanoparticles (LNPs) to induce a specific immune response in mice.

Benefits of technology

In mice, specific IgG antibodies against four serotypes of dengue virus were generated, inducing neutralizing antibodies and antiviral-specific T-cell immunity, providing protection against lethal viral attacks.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115779076B_ABST
    Figure CN115779076B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of vaccine preparation, and particularly relates to a tetravalent dengue mRNA vaccine, a liposome nanoparticle and a preparation method and application thereof. The present application provides an mRNA vaccine (mRNA-LNP) encoding a liposome nanoparticle-wrapped EDIII structural protein of four kinds of serum types DENV in series and a polypeptide containing multiple TBT epitopes. After mice are inoculated with the vaccine, specific humoral immunity, cellular immunity with high levels against four kinds of serum types dengue virus are generated, and antibodies with neutralizing effects are also generated. The serum after immunization can protect 3-day-old suckling mice from lethal DENV attack, which indicates that the neutralizing antibodies generated by the vaccine are sufficient to resist the lethal challenge, and the vaccine is an effective vaccine which can be used for long-term research.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of vaccine preparation technology, and in particular to a dengue quadrivalent mRNA vaccine, liposome nanoparticles, their preparation methods and applications. Background Technology

[0002] Dengue virus (DENV) is the most common vector-borne viral disease and a member of the Flaviviridae family, which also includes Zika virus, West Nile virus, yellow fever virus, and Japanese encephalitis virus. It is transmitted by the arthropod mosquito *Aedes aegypti*, which is much less contagious than *Aedes albopictus*. The virus contains a single-stranded, positive RNA genome encoding a single polypeptide containing three structural proteins: the pre-membrane protein (PRM), the envelope protein (E), and the capsid protein (C), as well as seven non-structural proteins. Dengue virus is classified into four distinct serotypes, dengue serotypes 1 through 4 (DENV-1 to DENV-4). Most countries where dengue is prevalent are affected by all four serotypes. It is primarily prevalent in tropical and subtropical regions.

[0003] Dengue infection presents with a range of severity, from self-limiting, febrile illness to more severe vascular leakage that can lead to multi-organ failure associated with a virus-driven cytokine storm. Currently, there are no specific antiviral drugs available for dengue. Notably, primary infection with a single serotype of dengue virus (DENV) can induce long-term immunity against that serotype, but subsequent infection with a heterotype of DENV increases the risk of developing severe dengue. This is because the humoral immune response following primary infection produces cross-reactive non-neutralizing antibodies that can bind to infectious viral particles from a secondary heterotype challenge via antibody-dependent enhancement (ADE), leading to increased infection of cells with Fcγ receptors. This poses a challenge to vaccine development, as a successful vaccine must elicit a balanced, neutralizing, and durable immune response against all four serotypes of DENV.

[0004] The most advanced DENV vaccines in clinical evaluation include CYD-TDV (Sanofi Pasteur), TAK-003 (DENV-AX; Takeda), and TV-003 (NIAID / NIH). All three are live attenuated vaccines, but live attenuated vaccines carry the risk of virulence reversion, posing safety concerns and potentially causing adverse drug reactions (ADE). Furthermore, they are not suitable for individuals most susceptible to severe dengue-related symptoms. Currently, the development of dengue virus vaccines in the field of nucleic acid vaccines is somewhat lagging. Some research teams have developed nucleic acid vaccines targeting one or two dengue virus serotypes, inducing specific humoral and cellular immunity against these serotypes in mice. However, no vaccine targeting all four dengue virus serotypes has been developed, and research on dengue virus nucleic acid vaccines remains in the preclinical stage.

[0005] Therefore, how to provide a vaccine that targets all four serotypes of dengue virus to solve the technical problem of the lack of corresponding dengue virus nucleic acid vaccines in the existing technology is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0006] The present invention aims to provide a tetravalent dengue mRNA vaccine, liposome nanoparticles, and a method for preparing the same. Modified pseudouracil was used to transcribe mRNA encoding EDIII and TBT in vitro, which was then packaged into lipid nanoparticles (LNPs). Inoculation of wild-type BALB / c mice with the DENV mRNA-LNP vaccine against four serotypes resulted in the production of specific IgG antibodies against all four dengue virus serotypes, and induced protective neutralizing antibodies and antiviral-specific T-cell immunity, demonstrating excellent efficacy.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] The present invention provides a quadrivalent dengue mRNA vaccine comprising mRNA for expressing an immunogen of dengue virus, the sequence of which is shown in SEQ ID NO.1.

[0009] The present invention also provides a liposome nanoparticle, wherein the mRNA is encapsulated in liposomes to form the liposome nanoparticle.

[0010] Preferably, the average particle size of the liposome nanoparticles is 80–120 nm.

[0011] The present invention also provides a method for preparing the liposome nanoparticles, wherein SM-102, DSPC, cholesterol, DMG-PEG2000 and anhydrous ethanol are mixed and allowed to stand to obtain a liposome solution. The liposome solution and mRNA solution are added to the organic phase channel and inorganic phase channel of a T-tube, respectively, to obtain an aqueous phase mRNA and a lipid phase. Then the aqueous phase mRNA and lipid phase are mixed.

[0012] Preferably, the molar ratio of SM-102, DSPC, cholesterol and DMG-PEG2000 is 40-60:8-12:28.5-48.5:1-2.

[0013] Preferably, the SM-102, DSPC, cholesterol, and DMG-PEG2000 are dissolved in anhydrous ethanol, and their concentrations after dissolution are 23.8 mg / mL, 5.86 mg / mL, 11.04 mg / mL, and 2.78 mg / mL, respectively.

[0014] Preferably, the mRNA solution uses citrate buffer as a solvent, and the concentration of the citrate buffer is 40-60 mM.

[0015] Preferably, the flow rate ratio of aqueous mRNA to lipid phase is 3:0.5 to 1.5.

[0016] Preferably, the concentration of mRNA in the mRNA solution is 0.15–0.19 mg / mL.

[0017] The present invention further provides the aforementioned tetravalent dengue mRNA vaccine, the aforementioned liposome nanoparticles, and the application of the liposome nanoparticles prepared by the aforementioned method in the preparation of drugs for treating dengue virus.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] 1. This invention provides an mRNA vaccine targeting four serotypes of DENV. The mRNA encoding EDIII and TBT is transcribed in vitro using modified pseudouracil and packaged into lipid nanoparticles (LNPs). After intramuscular injection, the mRNA-LNPs are delivered to muscle cells at the injection site and antigen-presenting cells in draining lymph nodes. Once the cells have endocytosed the mRNA-LNPs, the LNPs degrade in acidified endosomes, releasing the mRNA into the cytoplasm.

[0020] Then, the mRNA is translated into viral EDIII protein and TBT peptide. The EDIII protein and TBT peptide are embedded in the endoplasmic reticulum (ER) membrane and cleaved by host proteases into fragments that can be recognized by the major histocompatibility complex (MHC), which then presents them to CD4+. + / CD8 + T cells thus stimulate an immune response. Inoculation of wild-type BALB / c mice with the DENV mRNA-LNP vaccine against four serotypes produced specific IgG antibodies against the four serotypes of dengue virus and induced protective neutralizing antibodies and antiviral specific T cell immunity.

[0021] 2. Severe dengue complications are often associated with secondary heteroserotype infection with one of the four circulating serotypes. In this case, the humoral immune response against cross-reactive, poorly neutralizing epitopes can lead to increased infectivity of susceptible cells through antibody-dependent enhancement (ADE). In this way, antibodies produced after infection or vaccination can exacerbate the disease in subsequent infections. Currently, there are no available treatments to combat the disease caused by dengue virus, therefore, there is an urgent need to develop a safe and effective vaccine.

[0022] This invention develops an mRNA vaccine (mRNA-LNP) encoding lipid nanoparticles encapsulating the EDIII structural proteins of four serotypes of dengue virus in tandem with a polypeptide containing multiple TBT epitopes. After vaccination in mice, high levels of specific humoral and cellular immunity against the four serotypes of dengue virus were generated, along with neutralizing antibodies. The post-immunization serum protected 3-day-old suckling mice from lethal dengue virus attack, demonstrating that the neutralizing antibodies produced by the vaccine are sufficient to withstand a fatal challenge. This is an effective vaccine suitable for long-term research. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0024] Figure 1 Design diagram for mRNA vaccines;

[0025] Figure 2 Image of DNA gel electrophoresis;

[0026] Figure 3 Image of mRNA gel electrophoresis;

[0027] Figure 4 A graph showing mRNA-LNP characterization data;

[0028] Figure 5 A diagram showing the humoral immune response induced in mice immunized with the mRNA-LNP vaccine;

[0029] Figure 6 A diagram illustrating the dengue virus-specific T-cell immune response in mice immunized with mRNA-LNP vaccine.

[0030] Figure 7 Diagram of a neutralization experiment;

[0031] Figure 8 This is a subculture immunoassay. Detailed Implementation

[0032] The present invention provides a quadrivalent dengue mRNA vaccine comprising mRNA for expressing an immunogen of dengue virus, the sequence of which is shown in SEQ ID NO.1.

[0033] The specific sequence is as follows:

[0034]

[0035] The present invention also provides a liposome nanoparticle, wherein the mRNA is encapsulated in liposomes to form the liposome nanoparticle.

[0036] In this invention, the average particle size of the liposome nanoparticles is 80-120 nm; preferably 90-110 nm; more preferably 95-105 nm; and even more preferably 100 nm.

[0037] The present invention also provides a method for preparing the liposome nanoparticles, wherein SM-102, DSPC, cholesterol, DMG-PEG2000 and anhydrous ethanol are mixed and allowed to stand to obtain a liposome solution. The liposome solution and mRNA solution are added to the organic phase channel and inorganic phase channel of a T-tube, respectively, to obtain an aqueous phase mRNA and a lipid phase. Then the aqueous phase mRNA and lipid phase are mixed.

[0038] In this invention, the molar ratio of SM-102, DSPC, cholesterol, and DMG-PEG2000 is 40-60:8-12:28.5-48.5:1-2; preferably 44-56:9-11:32.5-44.5:1.5; further preferably 48-52:10:34.5-40.5:1.5; and even more preferably 50:10:38.5:1.5.

[0039] In this invention, SM-102, DSPC, cholesterol, and DMG-PEG2000 are dissolved in anhydrous ethanol, and their concentrations after dissolution are 23.8 mg / mL, 5.86 mg / mL, 11.04 mg / mL, and 2.78 mg / mL, respectively.

[0040] In this invention, the mRNA solution uses citrate buffer as a solvent, and the concentration of the citrate buffer is 40-60 mM; preferably 44-56 mM; more preferably 48-52 mM; and even more preferably 50 mM.

[0041] In this invention, the flow rate ratio of aqueous mRNA to lipid phase is 3:0.5 to 1.5; preferably 3:0.7 to 1.3; more preferably 3:0.9 to 1.1; and more preferably 3:1.

[0042] In this invention, the concentration of mRNA in the mRNA solution is 0.15–0.19 mg / mL; preferably 0.17 mg / mL.

[0043] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0044] Example 1

[0045] 1. mRNA vaccine design

[0046] First, a common B epitope, VDRGWGNGCGLFGKG, shared by the four DENV serotypes, was selected. Two Th epitopes were added, and the β-sheet structure at both ends of the B cell epitope was extended to ensure the presence of the loop region of the B cell epitope. The Th-B-Th polypeptide sequence is as follows: KYVKQNTLKLAT–GG-VDRGWGNGCGLFGKG-LL-LEYIPEITLPVIAALSIAES (as shown in Sequence 2). Based on the polypeptide sequence, the corresponding nucleotide sequence of Th-B-Th was obtained as follows:

[0047] AAGTACGTGAAACAGAACACACTGAAGCTGGCCACAGGCGGCGTGCTGGGCTCTCAGGAGGGCAGCATGGTGGATAGAGGCTGGGGCAACGGCTGCGGCCTCTTCGGCAAGGGCCTGCTGCTGGAATACATCCCCGAGATCACCCTGCCTGTGATCGCCGCTCTGAGCATCGCCGAAAGC (as shown in Sequence 3).

[0048] Based on the DENV sequences published on NCBI, the EDIII regions of four dengue virus serotypes were screened, originating from DENV-1 (Genbank: JQ581603.1), DENV-2 (Genbank: JN544360.1), DENV-3 (Genbank: KU216209.1), and DENV-4 (Genbank: JX024758.1). Finally, the Th-B-Th sequences and the EDIII regions of the four dengue virus serotypes were tandemly linked using the G4S3 flexible peptide. A TPA signal peptide was introduced at the 5' end, and a stop codon was introduced at the 3' end, resulting in a complete ORF frame. The 5' UTR, 3' UTR, and 120 polyAs were also added. The design is as follows. Figure 1 mRNA vaccine design diagram; the synthesized sequence is shown in Sequence 1:

[0049] 2. Preparation of in vitro transcription of mRNA and lipid nanoparticle delivery system

[0050] 2.1 Obtaining mRNA transcription template

[0051] The gene sequence was constructed into the pCDNA3.1(+) vector by Shanghai Genscript Biotech Co., Ltd. The synthesized pCDNA3.1-EDIII was digested with NdeI and SalI to construct the fragment into the PVAX1 expression vector for use as a DNA vaccine. Simultaneously, linearized plasmid templates were obtained by SalI digestion. The digestion system consisted of 5 μg plasmid with 4 μL of SalI enzyme, 10× Reaction Buffer, and RNase-free water to make a 50 μL reaction volume, incubated at 37℃ for 1 h. After reaction, 1 μL of the solution was subjected to agarose gel electrophoresis and photographed to confirm successful digestion. The DNA was then recovered using a universal DNA purification and recovery kit (Tiangen Biotech, DP214-03) according to the manufacturer's instructions.

[0052] 2.2 In vitro transcription of mRNA

[0053] The DNA template used in the in vitro transcription reaction contained an immunogen open reading frame with 5' and 3' uncoding regions flanking it, and terminated by a PolyA tail. All mRNA constructs used in this invention were transcribed via T7 RNA polymerase (Novoprotein, E131) and completely replaced with N1-methylpseudouracil (APExBIO, B7972-.1). After transcription, the mRNA was purified using 7.5 mM lithium chloride precipitation buffer. 50 μL of lithium chloride precipitation buffer (Thermo Fisher, AM9480) was added to every 20 μL of reaction mixture, and the mixture was incubated at -20°C for 30 min. Next, the mixture was centrifuged at 12000 rpm for 15 min in a pre-chilled centrifuge at 4°C. After centrifugation, the supernatant was discarded, and pre-chilled 70% ethanol was added. The mixture was gently pipetted and centrifuged at 12000 rpm for 1 min. This step was repeated three times, with the final centrifugation lasting 2 min. The supernatant was then discarded, and 60-100 μL of RNase-free water was added. After transcription, a Cap1 structure was added to the 5' end using a nearshore reagent kit (Novoprotein, M082-01B). Following capping, the mRNA was purified using 7.5 mM lithium chloride precipitation buffer, following the same procedure as above. The resulting mRNA concentration was measured using Nanodrop and then stored at -80°C for long-term storage. All water used in the above steps was RNase-free water.

[0054] 2.3 Preparation of mRNA-LNP lipid nanoparticle delivery system

[0055] 2.3.1 mRNA preparation

[0056] Before the experiment, the mRNA was thawed on ice and dissolved in 50 mM sodium citrate (treated with 1‰ DEPC overnight and then autoclaved) to a concentration of 0.17 mg / mL.

[0057] 2.3.2 Preparation of the mRNA-LNP system

[0058] Prepare the solutions fresh before the experiment. SM-102 (AVT, China), DSPC (AVT, China), cholesterol (AVT, China), and DMG-PEG2000 (AVT, China) were dissolved in anhydrous ethanol at a molar ratio of 50:10:38.5:1.5. The concentrations of SM-102, DSPC, cholesterol, and DMG-PEG2000 after dissolution in anhydrous ethanol were 23.8 mg / mL, 5.86 mg / mL, 11.04 mg / mL, and 2.78 mg / mL, respectively. For the LNP3:1 group, the lipid concentrations were prepared by halving the above lipid concentrations. After mixing equal volumes of each lipid component and equilibrating at room temperature for 2 min, the lipid mixture dissolved in anhydrous ethanol and mRNA (the inorganic phase for the control group was autoclaved PBS) were added to the organic phase and inorganic phase channels of a T-tube, respectively. The volume ratio of the mRNA solution dissolved in 50 mM citrate buffer to the liposome solution was 3:1. The aqueous phase (mRNA) and lipid phase were then mixed at a flow rate of 3:1. The LNP-encapsulated mRNA sample was placed in a dialysis bag (Viskase, USA), and the dialysis bag was placed in PBS (treated with 1‰ DEPC overnight and then autoclaved) for 16 h. After dialysis, the encapsulation efficiency was measured using the Quant-iT RiboGreen RNAAssay Kit (Invitrogen, USA). At the same time, a portion of the sample was taken and diluted in PBS at a volume ratio of 1:10, and the average LNP nanoparticle size was determined using DLS.

[0059] 3. Animal experiments

[0060] The mice used for mRNA vaccine immunization were 4-6 week old BALB / c mice (Animal Center of Army Medical University, Chongqing). Female mice were used for immunization in all experimental groups and the control group, while male mice were used for subsequent immunization in cages. The mRNA vaccine and the empty vector control group were administered via intramuscular injection. Each dose of the mRNA vaccine contained 15 μg of mRNA, 120 μL; the empty vector LNP (PBS-LNP) control group was administered via intramuscular injection, 200 μL per dose. Approximately 100 μL of blood was collected from the tail vein of the mice and centrifuged at 4°C, 10 min, and 3000 rpm to separate the serum. The serum was stored at -80°C until analysis using the ELISA method. One week after the third immunization, mice were euthanized by cervical dislocation after blood collection from the eyeballs, and the serum separation procedure was the same as above; the spleen was also harvested for ELISPOT. The suckling mice used in the in vivo neutralization experiment were bred by combining 4-6 week old BALB / c females and males purchased from the animal center. The neutralization experiment was conducted on the third day after the suckling mice were born, and subsequent immunization also used 3-day-old suckling mice. All research on mice in this study was approved by the Ethics Committee of Army Medical University and followed the guidelines of Army Medical University and the National Research Council regarding animal experimentation and husbandry.

[0061] 4. ELISA (Enzyme-Linked Immunosorbent Assay) method for determining total IgG in mouse serum.

[0062] Total IgG in mouse serum was detected using an enzyme-linked immunosorbent assay (ELISA). Four serotypes of Denguevirus Envelope Protein-Domain III (Sino Biolgical, 40531-V08B, 40471-V08Y1, 40532-V08H1, 40533-V08B2) antigen were diluted to 5 μg / mL with coating buffer, and 10 μg / mL of TBT was added to coat 96-well plates, 100 μL / well, with an antigen coating volume of 0.5 μg. The plates were incubated overnight at 4°C. The plates were washed five times with PBST solution to remove uncoated antigen. 200 μL of blocking buffer (PBST containing 5% BSA) was added to each well, and the plates were incubated at 37°C for 2 h. After blocking, discard the blocking solution, wash the plate three times with PBST solution, then add 100 μL of immune serum (using PBST diluted with 1% BSA) and blank control PBS solution to each well, and incubate at 37°C for 2 h. After incubation, wash the plate three times with PBST solution, add 100 μL / well of 5000-fold diluted HRP-goat anti-mouse IgG (Solarbio, SE131) diluted 1% with PBST solution (using PBST diluted with 1% BSA), and incubate at 37°C for 1 h. Wash five times with PBST solution, add 100 μL of chromogenic solution to each well, and incubate under dark conditions for 15–30 min. Add 100 μL of stop solution to each well to stop the chromogenic reaction. Read the absorbance at 450 nm using a microplate reader, and determine the final antibody titer of mouse serum based on the ratio of OD value to that of the blank control group.

[0063] 5. ELISPOT assay for antigen-specific cellular immunity

[0064] Seven days after the third immunization, mice were used to assess cellular immune responses using an IFN-γ and IL-4 pre-coated ELISPOT kit (Dayou, China). In short, serum-free RPMI1640 (Thermo Fisher Science) culture plates were pre-incubated for 15 min. Spleen cells from immunized mice were seeded at a density of 500,000 cells / well. The positive stimulant in the kit served as a positive control, and RPMI1640 culture medium served as a negative control. Equal volumes of synthetic peptides ET1 / ET2 / ET3 / ET4 were mixed and dissolved in deionized water to prepare a 0.8 μg / μL mixed peptide (TBT). The mixed peptide and TBT peptide were added as stimulants to the two experimental groups, respectively. After incubation at 37°C and 5% CO2 for 60 h, the plates were washed with wash buffer. 100 μL of 1:100 biotin-labeled anti-mouse IFN-γ and IL-4 antibody was added to each well, and the plates were incubated at room temperature for 1 h. After washing again according to the instructions, 100 μL of diluted enzyme-labeled avidin was added to each well, and the plates were incubated at room temperature for 1 h. After washing again, 100 μL of freshly prepared AEC chromogenic solution was added to each well according to the kit instructions. After adding the AEC substrate solution, the plates were incubated at 37°C in the dark for 15 min. The air-dried plates were read using an automated ELISPOT reader, CTL ImmunoSpot SC. The spot-forming cell count (SFC) per 500,000 cells was calculated.

[0065] 6. Dengue virus plaque reduction and neutralization experiment

[0066] 6.1 Vero cell seeding

[0067] Vero cell single-cell suspensions after digestion and centrifugation were counted, and then 1.5 × 10⁻⁶ cells were selected. 5 Cells were seeded per well in a 24-well plate and incubated overnight (approximately 16 hours) at 37°C in a 5% CO2 incubator. Cell growth was observed, and the cells were infected with the virus when the cell density reached approximately 95%.

[0068] 6.2 Viral Transfection

[0069] The viral stock solution was diluted with serum-free DMEM (50 PFU / 100 μL). Serum was inactivated at 56°C for 30 min, and then diluted to 1:50 with serum-free DMEM at 100 μL. Three replicates were set for each concentration gradient, and three replicates were set for the control group. After mixing, the mixture was incubated at 37°C for 1 h. The cell supernatant was aspirated from the 24-well plate, and the cells were washed once with PBS. The virus-serum mixture was added to the cells and incubated at 37°C for 1 h. Simultaneously, the 4°C methylcellulose semi-solid medium (pre-allocated and preheated) was placed in a 37°C water bath for preheating. After 1 h, the virus-serum mixture was aspirated, and methylcellulose was added directly. 1.5 mL of methylcellulose semi-solid medium was added to each well of the 24-well plate (the 24-well plate should not be allowed to dry out), and then the plates were incubated at 37°C in a 5% CO2 incubator.

[0070] 6.3 Plaque staining and counting

[0071] Six days later, obvious plaques were observed at the bottom of the wells under backlight. The covering methylcellulose semi-solid culture medium was removed in a biosafety cabinet, and the plates were fixed with 4% paraformaldehyde for 15 min. After washing once with PBS, 0.2 mL of crystal violet staining solution was added to each well of the 24-well plate. Staining was performed at room temperature for 20 min, followed by aspiration and washing once with PBS. Excess crystal violet was then gently washed away with water, observing the plaques in the wells throughout the process. After removing excess crystal violet, clearly defined plaques were visible to the naked eye. The number of plaques at different dilutions could be accurately counted using either a naked-eye or upright microscope.

[0072] 7. In vivo neutralization experiment and subsequent immunization

[0073] 7.1 In vivo neutralization experiment

[0074] Serum was extracted from tail blood of mice 7 days after the third immunization in the LNP6:1 group and inactivated at 56℃ for 30 min. The serum was then diluted with deionized water at a ratio of 1:50. The following procedures were performed in a P2 biosafety cabinet: 10 μL of the diluted serum was mixed with 10 μL of LDENV-2 (10 PFU, LD80) and DENV-4 (60 PFU, LD80) virus, incubated at 37℃ for 1 h, and then 20 μL of the virus-serum mixture was injected into suckling mice using a microsyringe. The survival rate of the suckling mice within 15 days after infection was observed. The experimental group used serum from the LNP6:1 group immunization, while the control group used serum from the empty vector-LNP group immunization.

[0075] 7.2 Subsequent Immunization

[0076] Serum was separated from tail blood of mice in the LNP6:1 group and the empty vector control group 7 days after the third immunization and inactivated at 56℃ for 30 min; the serum was then diluted with deionized water at a ratio of 1:20. The following procedures were performed in a biosafety cabinet in a P2 laboratory: 10 μL of diluted serum was mixed with 10 μL of DENV-2 (60 PFU, LD60) virus, incubated at 37℃ for 1 h, and then 20 μL of the virus-serum mixture was injected into suckling mice using a microsyringe. The survival rate of the suckling mice 15 days after infection was observed.

[0077] Experimental results

[0078] 1. In vitro transcription of mRNA

[0079] The constructed plasmid was digested with SalI to obtain a linearized DNA transcription template. Figure 1 Transcription, purification, and capping were performed using the Novoprotein (E131) in vitro transcription kit for nearshore proteins. During transcription, uridine was completely replaced with N1-methylpseudouracil (APExBIO, B7972-.1). The final result showed an OD (260 / 280) of approximately 2.20, and mRNA electrophoresis showed bands around 2000 bp in size. The purification level was high, and the mRNA was not degraded, making it suitable for further experimental research. Figure 2 DNA gel electrophoresis image: After SalI digestion for 1 hour, the plasmid was electrophoresed on a 1% agarose gel and TAE gel at 120V for 30 minutes. The plasmid is shown to be completely digested and ready for the next experiment. Figure 3 mRNA was transcribed and capped for purification by 1% agarose gel electrophoresis (containing 18% formaldehyde). The buffer was MOPS, and the electrophoresis conditions were 130V for 40min.

[0080] 2. Preparation of mRNA lipid nanoparticle system

[0081] The mRNA obtained in the previous step and the autoclaved PBS were mixed with the lipid phase in a T-tube. The lipid phase consisted of four lipids: SM-102, DSPC, cholesterol, and polyethylene glycol ester, in a molar ratio of 50:10:38.5:1.5. The diameter of the obtained lipid nanoparticles was approximately 100 nm, as determined by DLS and scanning electron microscopy, and the encapsulation efficiency was 80%–90%, as determined by the kit.

[0082] Figure 4The size and uniformity of lipid nanoparticles affect vaccine delivery efficiency. (A, B) show the particle size and dispersion coefficient of mRNA-LNP detected by DLS laser particle size analyzer, respectively. The results are expressed as standard error (n=3), ns indicates no significant difference, and asterisk indicates significant difference (t-test, **, P<0.01); (C) shows the lipid nanoparticles observed by scanning electron microscopy (TEM).

[0083] 3. mRNA vaccines can induce specific humoral responses against four serotypes.

[0084] Six-week-old female BALB / c mice were randomly divided into three groups of five each. Each group received an intramuscular injection of either one of two mRNA-LNPs (15 μg) or an empty vector-LNP, serving as a negative control. Mice were vaccinated intramuscularly on days 0, 14, and 42. On day 49 (one week after the final immunization), mice were euthanized by cervical dislocation, and serum and spleen cells were collected to detect antibody and T-cell responses, respectively. The vaccine induced high levels of E-specific immunoglobulin IgG. In the LNP6:1 mRNA-immunized serum group, the mean endpoint titer of DENV-1 and DENV-2 virus particle-specific immunoglobulins was 1*10-1. 5 DENV-3 is 3*10 5 DENV-4 is 6*10 5 TBT is 3.2*10 4 This indicates that mRNA vaccines can induce specific humoral immunity, and that antibody titers were highest in all groups one week after the third immunization. The LNP6:1 group showed superior antibody titers at all time points compared to other groups, suggesting that LNP6:1 is the optimal vaccine group among mRNA-LNP vaccine groups for eliciting high-titer humoral immunity. Figure 5 Humoral immune responses induced by mRNA-LNP vaccine in female BALB / c mice were immunized intramuscularly at days 0, 14, and 42 with 15 μg mRNA vaccine or empty vector LNP. Serum samples were collected at days 14, 28, and 49 post-primary immunization. The titers of dengue virus EDIII region and TBT-specific immunoglobulin antibodies for four serotypes were detected by ELISA. Data in the above figure are compared with the PBS group at days 14, 28, and 49. Results are expressed as standard errors (n=5), ns indicates no significant difference, and asterisks indicate significant differences (t-test, *, P<0.05; **, P<0.01; ***, P<0.001).

[0085] 4. mRNA vaccines induce dengue virus-specific cellular immune responses.

[0086] Since the humoral immunity induced by the LNP6:1 vaccine was the most significant among the experimental groups, this invention further investigated whether this vaccine could induce T-cell immunity against four serotypes of dengue virus. On day 49 of the above immunization, spleens from mice in the experimental group (LNP6:1) and the control group were analyzed using enzyme-linked immunosorbent assay (ELISPOT). The results showed that the mRNA-immunized group mice secreted significantly higher levels of IFN-γ and IL-4 than the empty vector-LNP group (…). Figure 6 The results showed that the mRNA-LNP vaccine successfully induced a dengue virus-specific cellular immune response. Figure 6 The levels of IFN-γ and IL-4 in mouse spleen cells were detected by ELISPOT assay to induce dengue virus-specific T-cell immune responses in mice immunized with mRNA-LNP vaccine. Results are expressed as standard errors (n=3). Within-group comparisons between each group and the PBS group were performed, with asterisks indicating significant differences (t-test, *, P<0.05; ***, P<0.001).

[0087] 5. mRNA vaccines can produce protective neutralizing antibodies.

[0088] 5.1 Neutralization Experiment

[0089] Seven days after the third immunization, neutralization experiments were conducted using collected mouse serum against DENV-2 and DENV-4. Firstly, at the cellular level, the plaque reduction neutralization experiment showed that mouse serum could neutralize the virus and reduce viral plaques on cells, indicating that the immune serum had a significant neutralizing effect on virus-infected cells. Figure 7 A). BALB / c 3-day-old suckling mice were infected with a DENV-2 and DENV-4 serum-virus mixture, and monitored for 15 days post-infection. Suckers injected with the empty vector-LNP vaccine serum-virus mixture began to die on day 7 post-infection. In the DENV-2 group, 60% of suckling mice died from viral infection within 15 days, and in the DENV-4 group, 67% of mice died. Suckers in the mRNA-LNP immune serum group had a 100% survival rate within 15 days after DENV-2 infection and a 70% survival rate after DENV-4 infection. Figure 7 B). These data indicate that in uninfected mice, the mRNA-LNP vaccine protects them from lethal DENV-2 and DENV-4 attacks. Figure 7Neutralization experiments were conducted at both the animal and cellular levels to verify the ability of immunized mouse serum to neutralize viral infection. (A) shows the in vitro neutralization experiments of DENV-2 and DENV-4, with results expressed as standard errors (n=4). An asterisk indicates a significant difference (t-test, *, P<0.05); (B) shows the in vivo neutralization experiments of DENV-2 and DENV-4. An asterisk indicates a significant difference (*, P<0.05).

[0090] 5.2 Subsequent immunization

[0091] Serum from the mRNA-LNP vaccine group, collected one week after the third immunization, was mixed with DENV-2 and incubated. Three-day-old suckling mice born to BALB / c mice after the third immunization were then infected. Monitoring was conducted for 15 days post-infection. The survival rate of suckling mice in the mRNA vaccine group reached 90%. Figure 8 The above data demonstrate that serum from this vaccine provides subsequent immune protection. Figure 8 The figure above shows the effect of subgeneration immunization of mRNA-LNP vaccine under DENV-2 virus infection; (n=3), asterisks indicate significant differences (*, P<0.05).

[0092] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A quadrivalent dengue mRNA vaccine, characterized in that, Includes mRNA for expressing the immunogen of dengue virus, the nucleotide sequence of which is shown in SEQ ID NO:

1.

2. A liposome nanoparticle, characterized in that, The mRNA of claim 1 is encapsulated in liposomes to form liposome nanoparticles.

3. The liposome nanoparticles according to claim 2, characterized in that, The average particle size of the liposome nanoparticles is 80–120 nm.

4. The method for preparing liposome nanoparticles according to claim 2 or 3, characterized in that, Mix SM-102, DSPC, cholesterol, DMG-PEG2000 and anhydrous ethanol, let stand to obtain liposome solution. Add the liposome solution and mRNA solution to the organic phase channel and inorganic phase channel of T-tube respectively to obtain lipid phase and aqueous phase mRNA. Then mix the aqueous phase mRNA with the lipid phase.

5. The method for preparing liposome nanoparticles according to claim 4, characterized in that, The molar ratio of SM-102, DSPC, cholesterol, and DMG-PEG2000 is 40–60: 8–12: 28.5–48.5: 1–2.

6. The method for preparing liposome nanoparticles according to claim 4 or 5, characterized in that, The SM-102, DSPC, cholesterol, and DMG-PEG2000 were dissolved in anhydrous ethanol, and their concentrations after dissolution were 23.8 mg / mL, 5.86 mg / mL, 11.04 mg / mL, and 2.78 mg / mL, respectively.

7. The method for preparing liposome nanoparticles according to claim 4, characterized in that, The mRNA solution uses citrate buffer as a solvent, and the concentration of the citrate buffer is 40–60 mM.

8. The method for preparing liposome nanoparticles according to claim 4, characterized in that, The flow rate ratio of the aqueous phase mRNA to the lipid phase is 3:0.5 to 1.

5.

9. The method for preparing liposome nanoparticles according to claim 4, characterized in that, The concentration of mRNA in the mRNA solution is 0.15–0.19 mg / mL.

10. The use of the dengue quadrivalent mRNA vaccine of claim 1, the liposome nanoparticles of claim 2 or 3, or the liposome nanoparticles prepared by any one of the methods of claims 4 to 9 in the preparation of dengue virus immunotherapies.

Citation Information

Patent Citations

  • Modified mRNA vaccine for dengue virus

    CN113663063A