A migration body tracer genetically modified mouse model, a construction method and application thereof
By integrating the CAG-LSL-TSPAN4-RFP-Avi-tag-PolyA expression cassette into a mouse model and activating the TSPAN4-RFP-Avi-tag fusion protein using the Cre tool mouse, the technical bottleneck of in vivo tracking of migratory organisms was solved, enabling precise labeling and real-time dynamic monitoring of migratory organisms, which can be applied to the research and drug screening of migratory organism-related diseases.
Patent Information
- Application Number
- CN202610335302.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-19
- Publication Date
- 2026-06-19
Smart Images

Figure CN122228979A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and in particular relates to a migration tracer gene-modified mouse model, its construction method and application. Background Technology
[0002] Migrasomes are a newly proposed class of extracellular membrane organelles / vesicle structures highly coupled with cell migration, typically forming at the ends or crossovers of retraction fibers (RFs) generated at the trailing edge of migrating cells and exiting the cell via "migratory exocytosis / migratory release." Migrasomes are generally 0.5-3 μm in diameter, significantly larger than classic exosomes (30-150 nm). Electron microscopy reveals that migrasomes contain numerous small vesicles approximately 50-100 nm in diameter, exhibiting a "vesicle-enclosed-vesicle" structural feature. In recent years, migrasomes, as an independent and important subtype within the extracellular vesicle (EV) lineage, have attracted considerable attention for their potential roles in development, physiological homeostasis, and disease.
[0003] Despite the significant research and application potential of endosomes, substantial technical bottlenecks remain in their detection and application. First, there is a lack of specific molecular markers. Currently, tetraspan membrane proteins such as TSPAN4 are mainly used as markers, but TSPAN4 is not a endosome-specific protein and its expression varies significantly across different cell types. Second, there is marker overlap with other endosomes (EVs) such as exosomes, making it difficult for existing marker systems to achieve high-specificity recognition. Third, most current studies are based on in vitro cell models; the detection of endosomes in in vivo tissues is difficult to achieve through routine tissue sections, and a stable tracing tool is lacking, thus preventing real-time dynamic monitoring.
[0004] The maternal-fetal interface is a highly dynamic microenvironment composed of placental trophoblasts, maternal endometrial cells, immune cells (uNK cells, macrophages, Treg cells), endothelial cells, and stromal cells. Its core biological processes include trophoblast invasion and migration, spiral artery remodeling, establishment of immune tolerance, and regulation of the inflammation-repair balance. These processes all rely on highly active cell migration and signal communication—the very setting for the function of the migration organism. Therefore, establishing an in vivo real-time monitoring and tracing model of the movement and function of migration organisms at the maternal-fetal interface is of profound significance for a deeper understanding of the mechanisms underlying adverse pregnancy outcomes. In view of this, this invention proposes a gene-modified mouse model for migration organism tracing, its construction method, and its applications. Summary of the Invention
[0005] The purpose of this invention is to provide a gene-modified mouse model for migratory body tracking, its construction method and application, aiming to solve the technical problem of the lack of standardized tools in the prior art that can specifically label and dynamically track migratory bodies in real time.
[0006] The objective of this invention is achieved through the following technical solution:
[0007] A migration tracer gene-modified mouse model, wherein a target expression cassette is integrated into the genome of the mouse model, and the nucleotide sequence of the target expression cassette is shown in SEQ ID NO.1, including the coding sequences of the promoter, LSL, key structural proteins of the migration, fluorescent tag, and modification tag.
[0008] Furthermore, the promoter is the CAG promoter; LSL is the stop expression element with loxp sites inserted at both ends; the key structural protein of the migratory system is TSPAN4; the fluorescent tag is RFP; the modification tag is Avi-tag; and the structure of the target expression cassette is CAG-LSL-TSPAN4-RFP-Avi-tag-PolyA.
[0009] Furthermore, in the nucleotide sequence of the target expression cassette, bases 1-1720 are the CAG promoter, bases 1721-3382 are the LSL sequence, bases 3412-4125 are the TSPAN4 protein coding sequence, bases 4126-4800 are the RFP coding sequence, and bases 4801-4845 are the Avi-tag coding sequence.
[0010] Furthermore, the target expression box was specifically integrated into the mouse H11 site, and the integration was achieved through homologous targeted repair mediated by the 5' homologous arm and the 3' homologous arm;
[0011] The nucleotide sequence of the 5' homologous arm is shown in SEQ ID NO.2; the nucleotide sequence of the 3' homologous arm is shown in SEQ ID NO.3.
[0012] A method for constructing a mouse model modified with a migration tracer gene, as described above, includes the following steps:
[0013] sgRNA was designed and synthesized based on the mouse H11 site sequence. The nucleotide sequence of sgRNA is shown in SEQ ID NO.4. At the same time, the target expression cassette was designed and synthesized, and the donor template was constructed.
[0014] Cas9 mRNA, sgRNA and donor template were co-injected into the cytoplasm of mouse zygotes;
[0015] The fertilized eggs that survived the injection were transferred into the oviduct of a pseudopregnant female mouse, and the mouse was allowed to become pregnant and give birth.
[0016] Genotyping and validation of newborn mice were performed to obtain transgenic mice that correctly integrated the target expression cassette at the H11 site, which are the migration tracer gene-modified mouse models.
[0017] Furthermore, the donor template contains a 5' homologous arm, a 3' homologous arm, and a target expression box located between the two homologous arms, all of which are completely consistent with the flanking sequence of the mouse H11 site.
[0018] An application of the above-mentioned migration tracer gene-modified mouse model in the preparation of migration in vivo tracing tools involves mating the migration tracer gene-modified mouse model with tissue-specific Cre tool mice to activate the expression of the TSPAN4-RFP-Avi-tag fusion protein in the target expression box, thereby achieving the tracing of migrations in specific tissues or cells.
[0019] Furthermore, the tissue-specific Cre tool mouse is the Elf5-Cre tool mouse; by mediating the activation of TSPAN4-RFP-Avi-tag fusion protein expression in placental trophoblast cells through Elf5-Cre, real-time dynamic tracking of migratory bodies in placental trophoblast cells is achieved.
[0020] An application of the above-described migration tracer gene-modified mouse model in the preparation of a drug screening tool for studying migration-related diseases.
[0021] Compared with the prior art, the beneficial effects of the present invention are:
[0022] This invention successfully constructed a gene-modified mouse model for migratory organism tracing, breaking through the core technical bottleneck of migratory organism detection and tracing:
[0023] In terms of model construction, this invention fuses the key structural protein TSPAN4 of the migratory body with the fluorescent tag RFP and the modification tag Avi-tag, and integrates it into the H11 site of mice to obtain a genetically stable TSPAN4 overexpressing transgenic mouse model (i.e., a migratory body tracer gene modified mouse model), thus achieving precise labeling of the migratory body at the endogenous level.
[0024] In terms of construction method, the present invention introduces an LSL structure into the target expression box, so that the TSPAN4-RFP-Avi-tag fusion gene is in the expression off state when it is not mated with tissue-specific Cre tool mice. Through the time and space-specific activation mediated by Cre tool mice, the non-specific interference of systemic expression is avoided, which solves the pain point of existing technologies that are difficult to identify in vivo migrants and cannot be tracked in real time.
[0025] In terms of application, this invention has verified through multi-dimensional validation that the model can accurately trace migratory organisms in placental trophoblast cells, providing a standardized tool for assessing the disease progression under physiological and pathological conditions by observing the biological behaviors of migratory organisms, such as their trajectory and differences in the packaging and assembly of their contents. It can be directly applied to the mechanism research and drug screening of diseases such as adverse pregnancy, achieving the expected goals of in vivo migratory organism tracing and disease research. Attached Figure Description
[0026] Figure 1 : Schematic diagram of the construction of the TSPAN4 overexpression transgenic mouse model.
[0027] Figure 2 : Schematic diagram of the hybridization strategy between TSPAN4 overexpressing transgenic mice and placental trophoblast tissue-specific Cre tool mice (Elf5-cre) (Avi in the figure represents Avi-tag).
[0028] Figure 3 Laser confocal microscopy was used to detect the expression of TSPAN4, RFP, and Avi-tag signals in placental trophoblasts of Control and KI mice. a: RFP signal expression in placental trophoblasts of Control and KI mice, scale bar: 100μm (main image), 50μm (magnified view); b: Fluorescence images of RFP and Avi-tag signal expression in placenta from Control and KI mice detected by RFP antibody and Biotin-cy3 staining, scale bar 15μm; c: Double staining of TSPAN4 and RFP signals in placenta from KI mice, scale bar 15μm.
[0029] Figure 4 The expression of RFP signal was verified by flow cytometry and Western blot of migratory bodies isolated from the placenta of Control and KI mice. Specifically, a) flow cytometry was used to detect RFP signal in migratory bodies derived from the placenta of Control and KI mice; b) Western blot was used to detect the expression of RFP signal and migratory body-specific markers (CPQ, PIGK, TSPAN4) in migratory bodies derived from the placenta of Control and KI mice.
[0030] Figure 5 Transmission electron microscopy observations of the placenta from KI mice. The left image shows typical migratory structures on the surface of placental trophoblast cells; the right image is a magnified view of a portion of the migratory structures. Detailed Implementation
[0031] To provide a clearer understanding of the technical features, objectives, and beneficial effects of this invention, the technical solution of this invention is described in detail below, but this should not be construed as limiting the scope of implementation of this invention. Unless otherwise specified, the methods used in this invention are conventional methods in this technical field. In this invention, materials, reagents, or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0032] I. The present invention provides a modified fusion protein, wherein modification refers to inserting at least one tag on the fusion protein, and the fusion protein is obtained by fusing a transmembrane protein with a fluorescent tag.
[0033] The modification was tagged with Avi; the transmembrane protein was TSPAN4 (Tetraspanin 4), a specific marker of the migration body; and the fluorescent tag was RFP.
[0034] Avi-tag is a biotin-affinity tag that can be detected by biotin. It consists of 15 amino acid residues, with an amino acid sequence from the N-terminus to the C-terminus: N-GLNDIFEAQKIEWHE-C (as shown in SEQ ID NO. 5). Its function is to label the protein. Subsequent detection can be achieved through the specific binding of the immunodeterminant cluster formed by the Avi-tag peptide chain to its monoclonal antibody and a biotin affinity assay. Avi-tag was chosen in this invention because of its small fragment size, optimal efficacy, ease of operation, and convenient biotin affinity detection method. Compared to other fusion tags, it does not affect the interaction and expression of the target protein molecule.
[0035] TSPAN4 belongs to the tetraspanin family and is one of the core structural proteins in migrasome formation. Its structure is highly conserved, exhibiting typical tetraspanin topological features, with both its N-terminus and C-terminus located intracellularly. In this invention, RFP and Avi-tag are linked to the C-terminus of TSPAN4 without disrupting the transmembrane structure, a rational design. In addition to TSPAN4, other proteins in its family, such as TSPAN7, TSPAN9, and TSPAN11, as well as molecules with single-transmembrane structures like Integrinα5 and NDST1, can also be used in this invention.
[0036] RFP is characterized by its small fluorescent group and strong emission. Other fluorescent proteins to choose from include EGFP, ZsGreen, tdTomato, mCherry, YFP, and BFP. However, RFP performs best, exhibiting higher sensitivity and being less prone to false positives or autofluorescence compared to other fluorescent proteins.
[0037] II. The present invention provides a co-expression system in which the modified transmembrane protein described above is linked to a fluorescent tag and then co-expressed in a fusion expression manner.
[0038] The co-expression system contains a stop expression element. The stop element is flanked by loxp sequences, forming a loxp-stop-loxp structure. The final structure of the co-expression system is CAG-LSL-TSPAN4-RFP-Avi-tag-PolyA, with its nucleotide sequence shown in SEQ ID NO.1. Here, CAG is the promoter; LSL is an abbreviation for the loxp-stop-loxp structure; and PolyA is a polyadenylate tailing sequence used to terminate transcription and stabilize the mRNA.
[0039] In SEQ ID NO.1: bases 1-1720 are the CAG promoter, bases 1721-3382 are the loxp-stop-loxp sequence, bases 3383-3402 are the backbone sequence, bases 3403-3411 are the Kozak sequence (enhancing ribosome recognition start site), bases 3412-4125 are the TSPAN4 protein coding sequence, bases 4126-4800 are the RFP coding sequence, bases 4801-4845 are the Avi-tag coding sequence, bases 4846-4848 are the vector backbone, and bases 4849-5080 are BGH pA (PolyA derived from bovine growth hormone).
[0040] III. This invention provides a method for constructing a TSPAN4 overexpression transgenic mouse model, comprising: injecting Cas9 mRNA, sgRNA and a donor template into mouse zygotes, wherein the donor template contains a 5' homologous arm, a 3' homologous arm and a target expression cassette (CAG-LSL-TSPAN4-RFP-Avi-tag-PolyA, whose nucleotide sequence is shown in SEQ ID NO.1) that are completely consistent with the flanking sequence of the mouse H11 site; taking the surviving zygotes after injection and transplanting them into the oviduct of pseudopregnant female mice to await birth; and performing genotyping and verification on the newborn mice to obtain transgenic mice that correctly integrate the target expression cassette at the H11 site, which is the TSPAN4 overexpression transgenic mouse model.
[0041] Before mating with specific tool mice, the TSPAN4 overexpression transgenic mouse model has its exogenously inserted TSPAN4-RFP-Avi-tag fusion gene in a closed state due to the presence of the LSL structure. After mating with specific tool mice, its offspring can express the TSPAN4-RFP-Avi-tag fusion protein in specific tissues or cells.
[0042] IV. This invention provides an application technique for tracing and / or screening migratory organisms in a TSPAN4 overexpressing transgenic mouse model at specific times and locations. The method for tracing and / or screening in a specific time and location is as follows: TSPAN4 overexpressing transgenic mice are crossed with placental trophoblast tissue-specific Cre tool mice (Elf5-cre). Through selection and backcrossing, offspring mice homozygous for the target gene and Cre-positive are obtained. The expression of fluorescent tags in the tissues of the offspring mice is detected to trace the expression of migratory organisms in specific tissues. TSPAN4 serves as a specific marker for migratory organisms, and its fusion-expressed RFP-Avi-tag accumulates on the migratory organisms along with TSPAN4. Since RFP can generate a fluorescent signal, detecting the expression of the fluorescent tag allows for precise tracing of migratory organisms.
[0043] The method for detecting the migration trajectory of the migratory organism is as follows: placental tissue is collected during the E8.5-E11.5 stage of pregnancy, frozen sections are prepared, and RFP signals are detected using confocal microscopy or Avi-tag signals are detected using the properties of Avi-tag and biotin.
[0044] Spatial localization of the migratory organisms was achieved. Simultaneously, the isolated and purified migratory organisms were analyzed by flow cytometry, and Western blot was used to verify the TSPAN4-RFP-Avi-tag fusion protein and migratory organism-related specific markers. Transmission electron microscopy was then used for morphological observation of the ultrastructure of the migratory organisms. Through these multi-dimensional detection methods, a comprehensive analysis of the formation, dynamic changes, and molecular characteristics of the migratory organisms was achieved.
[0045] Based on the highly migratory nature of placental trophoblast cells at the maternal-fetal interface, this invention utilizes the Elf5-cre tool mouse to activate TSPAN4-RFP-Avi-tag overexpression, generating migratory cells labeled with RFP-Avi-tag, thereby detecting the biological behavior of placental trophoblast cells communicating with the fetus through these migratory cells.
[0046] The specific implementation of the present invention will be described in detail below with reference to specific embodiments. The mice used in the embodiments were all purchased from Jiangsu GemPharmatech Co., Ltd.
[0047] Example 1: Construction of a TSPAN4 overexpression transgenic mouse model;
[0048] Using classic CRISPR-Pro gene editing technology (gene editing via CRISPR / Cas9), a gene knock-in was performed at a specific site on mouse chromosome 11 (H11) to construct a TSPAN4 overexpressing transgenic mouse model (see schematic diagram). Figure 1 The specific steps are as follows:
[0049] (1) Based on the mouse H11 site sequence, sgRNA (5'-CTGAGCCAACAGTGGTAGTA-3', as shown in SEQ ID NO.4) was designed and synthesized; at the same time, a target expression cassette (CAG-LSL-TSPAN4-RFP-Avi-tag-PolyA, whose nucleotide sequence is shown in SEQ ID NO.1) was designed and synthesized for insertion into the mouse H11 site.
[0050] (2) Construct a donor vector containing a 5' homologous arm, a 3' homologous arm and a target expression box located between the two homologous arms, which are completely consistent with the flanking sequence of the mouse H11 site.
[0051] (3) Cas9 mRNA, sgRNA and donor template were injected together into the cytoplasm of mouse zygotes.
[0052] (4) Take the fertilized eggs that survive the injection and transplant them into the oviduct of the pseudopregnant female mouse, and wait for her to become pregnant and give birth.
[0053] (5) In the fertilized egg, the Cas9 mRNA injected into the cytoplasm is translated to express the Cas9 nuclease. Guided by the sgRNA, the Cas9 nuclease recognizes and binds to the genomic target sequence at the H11 site, and then performs site-specific cleavage of the double-stranded DNA at that site. Subsequently, the cell uses the donor template as a repair template and integrates the target expression cassette into the H11 site through homologous targeted repair.
[0054] (6) Genotyping and verification were performed on the newborn mice to obtain transgenic mice that correctly integrated the target expression cassette at the H11 site (genotype: TSPAN4-RFP-Avi-tag). loxp / loxp This refers to the TSPAN4 overexpression transgenic mouse model.
[0055] The sequence information of the 5' homologous arm is shown in SEQ ID NO.2, as follows:
[0056] TCAAAGTTTACAGAGAAGTCATATAGTAATTTTTCTGAAATTTACTGGCACAATGTTAATCCAGCCTGACTCCAACTAATTAATGGTCACATTAATTTAAGTCTTTCCCTTGCCTCTGCTGCATTAGTTTCTCTCAAAATTGTTAACTTACAACTTGAAGTCTGGTATTATAAATTGAATGTAAAGCATTCTGAAAGATACTATACTGATTGCAGGTTTTTCAGTCAGGTTCAAGCTAATTTGACCAGTCATTGGATTAATTATGGATCTGGGGCCATAAATGCTATTTTAATTCCACTATAGAGATTAAAATAAGCCATTCTCCATTTCATAATATTCTATTGGACTTTGACTGCAGGGGCCTCCAAGTCTTGACAGTAGATTATAATCCTTCAGCTGCCCACTCTACTGGAGGAGGACAAACTGGTCACTTTTCAGCAAAACCTGGCTGTGGATCAGGGCAGTCTGGTACTTCCAAGCTCATTAGATGCCATCATGCTCTCACTGCCTCCTCAGCTTCAAGAGGAATCTGGAAAAAGCAGTCCCACTGGTCAGGAAAGGAACACTAGTGCACTTATCCTGGGTGTCTGCTGAGCTCGAGAGTCGACCTTAATTAAGTC。
[0057] The sequence information of the 3' homologous arm is shown in SEQ ID NO.3, as follows:
[0058] GTAAGGGCAGGATGTGTCAAACTGCCAATAGAGAACTACTTACTCTTCAGGCTGAAGCTGATGGAACAGGTAACAAAGGCAAACACTAATCATGATCAGCAAGATGAAGCAGAAAGGGAACAAGGGGATATTAAATGTGTATAGACACGCTAGAGAGATGGCTCAGCAGTTAAGAGAACTAGCTGGTCTTTCAGAGGTCCTGAGATCAATTTTAGACACCCACATGGTGGCTCATGACCA。
[0059] Example 2: Obtaining a mouse model with specific overexpression of TSPAN4 in placental trophoblasts;
[0060] The Elf5-cre tool mouse was mated with the TSPAN4 overexpressing transgenic mouse constructed in Example 1 (see schematic diagram). Figure 2 To achieve specific overexpression of TSPAN4 in placental trophoblast cells, the specific steps are as follows:
[0061] (1) Select healthy individuals at 8 weeks of age, and use male mice (Elf5-Cre) + / - (carrying Cre alone) and female mice (TSPAN4-RFP-Avi-tag) loxp / loxp The mice were caged together in a 1:2 ratio in the evening (caging together in the evening makes it easier to accurately calculate gestational age). The next morning, the vaginal plugs of the female mice were checked. The day a plug was found was recorded as day 0.5 of the embryonic period (E0.5). After a positive plug test, the pregnant mice were immediately separated into different cages to reduce stress.
[0062] (2) After the pregnant mice give birth to F1 generation mice, the toes or tail tissues of the mice are harvested 5-7 days later for gene identification to screen for Elf5-Cre. + / - -TSPAN4-RFP-Avi-tag loxp / + Genotyped mice are allowed to grow to sexual maturity.
[0063] (3) Inoculate the qualified F1 generation mice with TSPAN4-RFP-Avi-tag loxp / loxp Backcrossing was performed to obtain experimental mice.
[0064] The overexpressing mice (hereinafter referred to as KI mice) required for the experiment have the genotype Elf5-Cre. + / - -TSPAN4-RFP-Avi-tag loxp / loxp The control mice (hereinafter referred to as Control mice) have the genotype TSPAN4-RFP-Avi-tag. loxp / loxp Or TSPAN4-RFP-Avi-tag loxp / + .
[0065] (4) At 8.5-11.5 days of gestation (E8.5-11.5), pregnant mice were euthanized and their hearts were perfused to obtain placentas from suckling mice for subsequent experiments: a portion of the fresh placentas was placed in paraformaldehyde at 4°C overnight (for placental immunofluorescence staining to detect RFP signals), and another portion of the fresh placentas was subjected to the operation in Example 4 (isolation and purification of placental migratory cells for flow cytometry and Western blot detection of migratory cell-related marker expression); before conducting subsequent experiments, a portion of the placenta from suckling mice was taken to detect its genotype.
[0066] Example 3: Immunofluorescence verification of TSPAN4-RFP-Avi-tag fusion protein expression in mouse placenta;
[0067] (1) The placentas of Control mice and KI mice whose genotypes were established in Example 2 were removed from paraformaldehyde and soaked in 10% sucrose solution and 30% sucrose solution respectively. After the placental tissue settled to the bottom of the sucrose solution, the placental tissue was embedded and frozen with OCT and cut into 10 μm thick frozen sections.
[0068] (2) After the sections were dried, the cell nuclei were stained in the dark, fixed and mounted, and the presence of obvious RFP red signals in the villous trophoblast layer of the placenta of KI mice was detected by laser confocal microscopy. Figure 3 As shown in Figure a, compared with Control mice, KI mice exhibited significant red fluorescence (RFP signal) in the villous trophoblast layer of the placenta, indicating that the mouse model constructed in this invention specifically expresses the TSPAN4-RFP-Avi-tag fusion protein in placental trophoblast cells, enabling effective tracking of migratory organisms.
[0069] (3) Mouse placenta was subjected to dual-color staining using Biotin-cy3 and RFP antibodies and TSPAN4 antibody, respectively. The procedure was as follows: a. Frozen sections were thawed at room temperature, and short-term PFA fixation was performed if necessary; b. After washing with PBS, the sections were permeated with a buffer containing a small amount of detergent (such as Triton X-100) to promote antibody entry into the tissue; c. Blocking was performed with a blocking solution containing serum / protein (such as normal donkey / sheep serum or BSA (bovine serum albumin)) to reduce non-specific binding (a small amount of detergent can be added); d. The sections were incubated with the primary antibody (RFP antibody, or TSPAN4 antibody and RFP antibody) overnight in a humidified chamber at 4°C; e. The sections were washed thoroughly with PBS or TBST multiple times to reduce background; f. The sections were incubated with a fluorescent secondary antibody that matched the host of the primary antibody for 1 hour in the dark; g. The cell nuclei were stained; h. The sections were mounted with anti-quenching mounting medium and stored in the dark; i. Laser confocal microscopy was used to take pictures. The results are as follows. Figure 3 As shown in Figures b and c, co-localization of Biotin and RFP signals was observed in the placenta of KI mice, indicating fusion expression of RFP and Avi-tag; co-localization of TSPAN4 and RFP signals was also observed, indicating fusion expression of TSPAN4 and RFP. This demonstrates that the TSPAN4-RFP-Avi-tag fusion protein constructed in this invention was correctly expressed and co-localized in placental trophoblast cells.
[0070] Example 4: Isolation and purification of mouse placental migratory bodies;
[0071] (1) After cutting the fresh placenta into small tissue pieces, resuspend it in digestion solution (1% type I and 1% type IV collagenase mixture), place it in a 37°C water bath for 20 minutes to digest, and then stop digestion with 1640 medium containing 10% heat-inactivated fetal bovine serum. Dilute the collagenase digestion solution 5 times by volume.
[0072] (2) All subsequent centrifugation operations were performed at 4°C. Cell pellet was obtained by centrifugation at 1000 rpm for 5 min; the supernatant was centrifuged at 1000 g for 10 min to remove larger fragments, and the supernatant was further centrifuged at 4000 g for 20 min to remove more cell debris. The supernatant was then centrifuged at 20000 g for 30-60 min, and the resulting pellet was the coarse exosome. The supernatant was transferred to a new centrifuge tube and centrifuged at 160000 g for 2-3 h to obtain the pellet as exosomes.
[0073] (3) The crude migrants obtained in the previous step were subjected to density gradient centrifugation using Optiprep (Sigma-Aldrich) as the density medium to establish density gradients of 40% (1 ml), 35% (1 ml), 30% (1 ml), 25% (1 ml), 20% (1 ml), 15% (1 ml), 10% (1 ml) and 5% (1 ml) and the sample (5%, 1.5 ml). The samples were centrifuged at 4°C with a horizontal rotor at 150,000 g for 4 h using a high-speed centrifuge. The purified migrant samples were enriched between 10% and 25%. The precipitate was washed with PBS and centrifuged again at 20,000 g for 30 min.
[0074] Example 5: Flow cytometry and Western blot detection of migratory bodies;
[0075] The purified migratory cells obtained in Example 4 were subjected to flow cytometry staining and Western blot analysis. The specific steps are as follows:
[0076] (1) The flow cytometry detection steps are as follows: a. Sample fixation: The obtained migratory cells are first fixed with 2% paraformaldehyde for 30 min. b. Sample blocking: The sample is blocked with 0.1% Triton-100-3% BSA solution for 30 min. c. Primary antibody incubation: The specific marker antibody PIGK is diluted with PBS, and the prepared migratory cells are resuspended in the antibody dilution buffer and stained at 4℃ for 1 h. d. Staining termination: The sample is resuspended with 2 volumes of PBS, centrifuged at 20000g for 30 min, and the supernatant is discarded. e. Secondary antibody incubation: The sample is incubated with the fluorescently labeled antibody at 4℃ in the dark for 30 min, staining is terminated with 2 volumes of PBS, centrifuged at 20000g for 30 min, and the supernatant is discarded. f. Sample resuspending: The sample is resuspended in 200 μL of PBS and transferred to a flow cytometer tube. g. Instrument preparation: The instrument parameters are adjusted, the instrument is calibrated, the threshold is set, and the voltage is optimized. h. Sample detection: Select the appropriate fluorescence detection channel based on the labeled dye, control the flow rate appropriately, and divide the particle size groups according to the FSC / SSC (forward scattered light / side scattered light) distribution. i. Determine the fluorescence threshold based on the blank control and isotype control for subsequent data analysis.
[0077] The results are as follows Figure 4 As shown in Figure a, the left figure shows that the KI group's migrates have obvious RFP signals and are shifted to the right; the right figure shows that NC (negative control) and Isotype (stained only with Alexa-647 fluorescent secondary antibody) have no RFP signals, while the migrates in the Control group and KI group both have RFP signals and are shifted to the right, indicating that the migrates express PIGK.
[0078] (2) The specific operation of Western blot is as follows: a. Sample lysis and protein collection: Add lysis buffer (commonly RIPA, etc.) and protease / phosphatase inhibitor to the migration body, lyse on ice; centrifuge and collect the supernatant to obtain total protein. b. Protein quantification and sample preparation: Determine protein content using the BCA method, and standardize the sample loading amount for each sample; add sample buffer (containing reducing agent) and heat to denature. c. SDS-PAGE electrophoresis separation: Select an appropriate concentration of gel and prepare it according to the molecular weight of the target protein. d. Transfer membrane: Activate the PVDF (polyvinylidene fluoride) membrane by soaking it in methanol, and then transfer the protein from the gel to the PVDF membrane using the wet transfer method. e. Blocking: Block with 5% milk powder or BSA to reduce non-specific binding. f. Incubation with primary antibody: Add PIGK or TSPAN4 antibody, incubate overnight at 4°C or for 2 hours at room temperature. g. Washing membrane: Wash the PVDF membrane multiple times with TBST to reduce background. h. Incubation with secondary antibody: Add goat anti-rabbit HRP-conjugated secondary antibody or fluorescent secondary antibody, and incubate in the dark / as needed. i. Colorimetric / Imaging: Imaging with ECL luminescent solution added to the HRP system; or scanning imaging using the fluorescence channel. j. Analysis and calibration: Compare the grayscale and quantification of the target protein with an internal control (such as β-actin / GAPDH).
[0079] The results are as follows Figure 4 As shown in Figure b, RFP signals were detected in the KI group of migrants, while no RFP signals were detected in the Control group; both the Control and KI groups expressed migrant-related specific markers (CPQ, PIGK, TSPAN4).
[0080] Example 6: Transmission electron microscopy observation of placental tissue and migratory bodies;
[0081] The following steps were taken to observe the ultrastructure of placental tissue and its migration bodies: (1) Fresh mouse placenta was cut into 1 cubic centimeter pieces on ice and placed in 2.5% glutaraldehyde solution and fixed overnight at 4°C; (2) The sample was rinsed with PBS at 4°C; (3) The sample was fixed again with 1% osmium tetroxide solution at 4°C; (4) The sample was dehydrated in ethanol and acetone solution at 4°C; (5) The sample was impregnated with acetone and resin; (6) The sample was embedded in pure resin at 60°C overnight; (7) Ultrathin sections were prepared and the sections were retrieved using a nickel mesh; (8) The samples were soaked in 1% NaIO4 or 1% H2O2 for 10 min and washed 3 times with water; (9) The samples were observed under a transmission electron microscope.
[0082] The results are as follows Figure 5 As shown, the left side is an electron micrograph of the placenta from KI mice, showing typical migratory structures on the surface of placental trophoblast cells; the right side is a magnified representative image of the migratory structures, clearly showing their morphological characteristics.
[0083] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make several modifications and improvements without departing from the concept of the present invention, and these should also be considered within the scope of protection of the present invention. These modifications and improvements will not affect the effectiveness of the present invention.
Claims
1. A mouse model modified with a migration tracer gene, characterized in that, The mouse model has a target expression cassette integrated into its genome. The nucleotide sequence of the target expression cassette is shown in SEQ ID NO.1, including the coding sequences of the promoter, LSL, key structural proteins of the migratory system, the coding sequence of the fluorescent tag, and the coding sequence of the modification tag.
2. The migration-tracing gene-modified mouse model according to claim 1, characterized in that, The promoter is the CAG promoter; the LSL is a stop expression element with loxp sites inserted at both ends; the key structural protein of the migratory body is TSPAN4; the fluorescent tag is RFP; the modification tag is Avi-tag; the structure of the target expression cassette is CAG-LSL-TSPAN4-RFP-Avi-tag-PolyA.
3. The migration-tracing gene-modified mouse model according to claim 1, characterized in that, In the nucleotide sequence of the target expression cassette, bases 1-1720 are the CAG promoter, bases 1721-3382 are the LSL sequence, bases 3412-4125 are the TSPAN4 protein coding sequence, bases 4126-4800 are the RFP coding sequence, and bases 4801-4845 are the Avi-tag coding sequence.
4. The migration-tracing gene-modified mouse model according to claim 1, characterized in that, The target expression box is integrated into the mouse H11 site, and the integration is achieved through homologous targeted repair mediated by the 5' homologous arm and the 3' homologous arm. The nucleotide sequence of the 5' homologous arm is shown in SEQ ID NO.2; the nucleotide sequence of the 3' homologous arm is shown in SEQ ID NO.
3.
5. A method for constructing a migration tracer gene-modified mouse model according to any one of claims 1-4, characterized in that, Includes the following steps: sgRNA was designed and synthesized based on the mouse H11 site sequence, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO.4; at the same time, the target expression cassette was designed and synthesized, and the donor template was constructed. Cas9 mRNA, sgRNA and donor template were co-injected into the cytoplasm of mouse zygotes; The fertilized eggs that survived the injection were transferred into the oviduct of a pseudopregnant female mouse, and the mouse was allowed to become pregnant and give birth. Genotyping and validation of newborn mice were performed to obtain transgenic mice that correctly integrated the target expression cassette at the H11 site, which are the migration tracer gene-modified mouse models.
6. The construction method according to claim 5, characterized in that, The donor template contains a 5' homologous arm, a 3' homologous arm, and a target expression box located between the two homologous arms, all of which are completely identical to the flanking sequence of the mouse H11 site.
7. The application of a gene-modified mouse model for migratory body tracking according to any one of claims 1-4 in the preparation of an in vivo migratory body tracking tool, characterized in that, The mouse model modified with the migration tracer gene was mated with tissue-specific Cre tool mice to activate the expression of the TSPAN4-RFP-Avi-tag fusion protein in the target expression box, thereby achieving the tracing of migrations in specific tissues or cells.
8. The application according to claim 7, characterized in that, The tissue-specific Cre tool mouse is the Elf5-Cre tool mouse; by mediating the activation of TSPAN4-RFP-Avi-tag fusion protein expression in placental trophoblast cells through Elf5-Cre, real-time dynamic tracking of migratory bodies in placental trophoblast cells is achieved.
9. The use of a migration tracer gene-modified mouse model according to any one of claims 1-4 in the preparation of a drug screening tool for studying migration-related diseases.