Modified alphavirus ns p3
By introducing a Met residue mutation at position 167 of nsP3 of the alphavirus to modify the alphavirus replicon RNA, the problem of excessive innate immune response was solved, achieving efficient expression of heterologous genes and a broad adaptive immune response, especially in the application of vaccination.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ZIPHIUS VACCINES NV
- Filing Date
- 2024-11-12
- Publication Date
- 2026-07-24
AI Technical Summary
Existing alphavirus replicon RNA vectors tend to elicit strong innate immune responses when delivering heterologous genes, affecting their therapeutic or preventative uses. Furthermore, strategies to reduce innate immune responses have not been effectively tolerated in functional saRNAs.
By introducing a mutation in the Met residue at amino acid position 167 of the alphavirus nonstructural protein 3 (nsP3), the alphavirus nsP3 sequence was modified to form a replicon RNA encoding the mutated nsP3, thereby reducing the innate immune response while maintaining the efficient expression of the heterologous gene.
It achieved the goal of maintaining or increasing the expression level of heterologous genes while reducing the innate immune response, promoting a broad range of adaptive immune responses, and significantly improving the CD8+ response, especially during vaccination.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This disclosure relates to modified alphavirus nonstructural protein 3 (nsP3) and its self-amplifying RNA (saRNA), particularly wherein the saRNA is derived from alphavirus, and the sequence encoding nsP3 is modified to increase safety while maintaining gene expression. This disclosure also relates to methods for producing such engineered saRNA, and its use in medicine, such as in vaccination. Background Technology
[0002] Self-replicating RNA, or "replicon" RNA, is used as a vector for transgenic expression in vitro and in vivo. Alphavirus-based replicons derived from many different alphavirus species (e.g., Venezuelan equine encephalitis virus (VEEV), Sindbis virus, Semliki Forest virus) have been used as vectors for transgenic expression in vitro and in vivo. These vectors rely on the activity of the non-structural viral proteins encoded therein to replicate the replicon and mediate the expression of proteins encoded at the open reading frame (ORF) positions of structural genes, which are translated from subgenomic (SG) mRNA synthesized late in the replication lifecycle.
[0003] Self-amplified RNA can activate the innate immune system even more effectively than conventional mRNA. Such innate immune responses can either support or hinder the therapeutic or prophylactic use of saRNA constructs. Strategies to reduce the innate immune-stimulating activity of RNA have been reported, some of which can also be applied to saRNA. However, strategies to reduce the innate immune sensing activity of conventional mRNA are not necessarily well tolerated in functional saRNA (Minnaert et al. Adv Drug Delivery Rev. 176 (2021)113900).
[0004] Few reports exist in the literature regarding replicon RNAs modified in non-structural proteins, particularly replicon RNAs encoding modified nsP3. US2006 / 0251678 describes a VEEV replicon RNA encoding a mutated non-structural protein nsP3 with a Pro residue at amino acid 121. Li et al. (Nature Scientific Reports (2019) 9:6932) reported enhanced RNA replicons for immunotherapy and reported six mutations in the VEEV non-structural protein, two in nsP2 and four in nsP3. US2020 / 0109178 provides a replicon RNA encoding a heterozygous nsP3 that binds nsP3 fragments derived from Old World and New World alphaviruses in the hypervariable domain of nsP3 in an attempt to reduce or eliminate the immune response against a heterologous protein encoded by the replicon. Summary of the Invention
[0005] Several modified forms of alphavirus replicon RNA have been reported, each providing different functional roles. However, there remains a need for saRNA vectors tailored to reduce innate immune responses while efficiently delivering payloads encoded by heterologous genes of interest contained within the replicon RNA. This disclosure provides a modified form of the alphavirus nonstructural protein 3 (nsP3) sequence that imparts enhanced functionality to the entire replicon RNA construct, for example, within the alphavirus replicon RNA.
[0006] Therefore, in a first aspect, alphavirus nonstructural protein 3 (nsP3) is provided, which is modified at least by a mutation at amino acid position 167 of wild-type Venezuelan equine encephalitis virus (VEEV) nsP3 corresponding to SEQ ID NO: 1.
[0007] In some embodiments, the alphavirus nsP3 contains a Met residue at amino acid position 167, which corresponds to the wild-type VEEV nsP3.
[0008] In some embodiments, the alphavirus nsP3 is VEEV nsP3 modified at least by a mutation at amino acid position 167 (optionally the I167M mutation). In some embodiments, VEEV nsP3 has the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 18.
[0009] In another aspect, a nucleic acid comprising a sequence encoding the alphavirus nsP3 described herein is provided. In some embodiments, the sequence encoding nsP3 has the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity in sequence with SEQ ID NO: 8, provided that said sequence contains the A501G mutation of SEQ ID NO: 8.
[0010] In another aspect, a replicon RNA comprising sequences encoding alphavirus nonstructural proteins nsP1, nsP2, nsP3 and nsP4 is provided, wherein the alphavirus nsP3 is an alphavirus nsP3 containing at least one single amino acid mutation as described herein.
[0011] On the other hand, a replicon RNA comprising sequences encoding alphavirus nonstructural proteins nsP1, nsP2, nsP3, and nsP4 is provided, wherein said sequences are modified at least by a modification at position 4488 of the sequence corresponding to SEQ ID NO: 3 encoding wild-type VEEV nsP1-4.
[0012] The sequence encoding the non-structural protein may be derived from an alphavirus such as VEEV (e.g., TC-83 VEEV or Trinidad donkey virus), Everglades virus, Tonate virus, Mucambo virus, Cabassou virus, Mosso das pedras virus, Rio Negro virus, Pixuna virus, or variants thereof. Optionally, the sequence encoding the alphavirus non-structural protein may be derived from VEEV.
[0013] In some implementations, the sequence encoding alphavirus nsP1-4 is derived from VEEV, or has at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the wild-type sequence SEQ ID NO:3 encoding VEEV nsP1-4.
[0014] In some embodiments, the sequence encoding alphavirus nsP 1-4 has the nucleotide sequence of SEQ ID NO: 4.
[0015] In some embodiments, the replicon RNA further comprises a 5'UTR, one or more heterologous sequences encoding one or more heterologous gene products, and a 3'UTR, wherein each heterologous sequence is operatively linked to one or more subgenomic promoters and / or IRES elements.
[0016] In some embodiments, one or more of the heterologous sequences encode a heterologous protein. The heterologous protein may be an antigenic protein. The heterologous protein may be a therapeutic protein.
[0017] In another aspect, a method for expressing one or more heterologous gene products in a cell is provided, comprising: introducing a replicon RNA as described herein into a cell; and expressing the one or more heterologous gene products encoded by the replicon in the cell.
[0018] In another aspect, a cell containing the replicon RNA described herein is provided, optionally wherein said cell is a mammalian cell, such as a human cell.
[0019] On the other hand, nanoparticles comprising the replicon RNA described herein are provided, optionally wherein the nanoparticles are lipid nanoparticles.
[0020] In another aspect, a pharmaceutical composition is provided comprising the replicon RNA described herein, the cell described herein, or the nanoparticle described herein.
[0021] In another aspect, replicon RNA, cells, nanoparticles, or pharmaceutical compositions described herein are provided for use in medicine, optionally for methods of inducing (adaptive) immune responses in an individual, such as vaccination methods.
[0022] In another aspect, a method of treating a disease or condition in a human subject in need comprises: administering to the human subject a pharmaceutical composition comprising a replicon RNA according to any of the exemplary aspects / implementations described herein, thereby causing the replicon RNA to be expressed in one or more cells, tissues, or organs of the human subject. In some embodiments, the replicon RNA is administered in a therapeutically effective amount. In some embodiments, the therapeutically effective amount includes an amount sufficient to induce the expression of a heterologous protein that elicits an adaptive immune response.
[0023] On the other hand, a DNA template encoding a replicon RNA is provided, the replicon RNA containing nucleic acid encoding nsP3 as described herein.
[0024] In another aspect, a method for preparing replicon RNA is provided, said replicon RNA containing nucleic acid encoding nsP3 as described herein. Attached Figure Description
[0025] Figure 1 - In vitro luciferase expression in HeLa cells: luciferase expression (Fig. A and B) and cell viability (Fig. C and D) in HeLa cells transfected with simulated transfection or with construct 1 (parental wild-type VEEV saRNA), construct 2 (saRNA encoding VEEV nsP3 with the I167M mutation), or conventional mRNA, each encoding luciferase. Expression reported at 24 h (hpt) (Fig. A and C) or 48 h (Fig. B and D) post-transfection.
[0026] Figure 2 - In vitro luciferase expression in RD cells: luciferase expression at 24 hpt in RD cells transfected with simulated transfection or with construct 1 (parental wild-type VEEV saRNA), construct 2 (saRNA encoding VEEV nsP3 with I167M mutation), or conventional mRNA encoding luciferase (Fig. A) and cell viability (Fig. B).
[0027] Figure 3 - Protein expression dynamics in HeLa cells: mean fluorescence intensity (MFI) of all cells transfected with mimicry transfection or with construct 3 (parental wild-type VEEV saRNA), construct 4 (saRNA encoding VEEV nsP3 with the I167M mutation), or conventional mRNA encoding eBFP.
[0028] Figure 4 - Expression of subgenomic RNA in Hela cells: Normalized count of total subgenomic RNA in Hela cells after mimic transfection or transfection with parental saRNA (wild-type VEEVnsP) or saRNA encoding VEEVnsP3 with the I167 mutation.
[0029] Figure 5 - Volcano plot of transcripts in the IFN-α pathway: Differential expression analysis of cells transfected with saRNA encoding VEEV nsP3 with the I167 mutation compared to the parental saRNA (wild-type VEEV nsP): Transcripts that are part of the IFN-α pathway are shown in black, and all other transcripts are shown in gray; the points in the left half of the plot (to the left of point 0 on the X-axis) represent transcripts with lower abundance in cells transfected with saRNA encoding VEEV nsP3 with the I167 mutation compared to the parental saRNA, while the points in the right half of the plot (to the right of point 0 on the X-axis) represent transcripts with higher abundance in cells transfected with saRNA encoding VEEV nsP3 with the I167 mutation compared to the parental saRNA.
[0030] Figure 6 - In vivo protein expression kinetics: Total flux of luciferase activity in mice treated with empty LNPs (simulated) or LNPs compounded with saRNA containing wt VEEVnsP (parental), saRNA encoding VEEV nsP3 with the I167M mutation (I167M), or conventional mRNA encoding luciferase (mRNA) as measured over time.
[0031] Figure 7 - Serum IgG titer - Reports the concentration of anti-HA IgG in serum, as measured 50 days after the first injection of an empty LNP or an LNP complexed with a saRNA (parental) containing wt VEEV nsP, a saRNA (I167M) encoding VEEV nsP3 with the I167M mutation, or a conventional mRNA (mRNA) encoding hemagglutinin (HA).
[0032] Figure 8 - CD8+ T cells expressing cytokines - The percentage of CD8+ T cells expressing cytokines after HA peptide stimulation is reported 50 days after the first injection (29 days after the second injection) of an LNP compounded with an empty LNP (mimic) or an LNP compounded with a saRNA containing wt VEEV nsP (parental), a saRNA encoding VEEV nsP3 with the I167M mutation (I167M), or a regular mRNA encoding HA (mRNA); single-positive, double-positive, and triple-positive refer to the number of CD8+ T cells expressing one, two, or all three of IL2, TNF-α, or IFN-γ, respectively.
[0033] Figure 9 - CD4+ T cells expressing cytokines - The percentage of CD4+ T cells expressing cytokines after HA peptide stimulation is determined 50 days after the first injection (29 days after the second injection) using an empty LNP (mimic) or an LNP compounded with a saRNA containing wt VEEV nsP (parental), a saRNA encoding VEEV nsP3 with the I167M mutation (I167M), or a regular mRNA encoding HA (mRNA). Single-positive, double-positive, and triple-positive refer to the number of CD4+ T cells expressing one, two, or all three of IL2, TNF-α, or IFN-γ, respectively.
[0034] Figure 10Serum cytokine levels - Serum cytokine levels of interferon-γ, KC, MCP1, IP10, interferon-α, and IL-6 were reported, as measured by multiplex ELISA on day 1 after the first and second injections (day 29 after the second injection) using empty LNPs (dummy) or LNPs complexed with saRNA containing wt VEEV nsP (parental), saRNA encoding VEEV nsP3 with the I167M mutation (I167M), or conventional mRNA encoding HA (mRNA).
[0035] Figure 11 Tissue cytokine expression in lymph nodes and injection sites - Transcriptional levels of IFNα2 and IFNb1 in lymph nodes and muscle (injection site) were reported, as measured by RT-qPCR using empty LNPs (mock) or LNPs complexed with saRNA containing wt VEEV nsP (parental), saRNA encoding VEEV nsP3 with the I167M mutation (I167M), or conventional mRNA encoding HA (mRNA) one day after the first and second injections (21 days after the first injection): results are expressed as log2 fold changes relative to empty LNPs (mock).
[0036] Figure 12 - Homologous alphaviruses based on non-structural proteins - A schematic diagram of the alphavirus variant that is closest to wild-type VEEV based on homology in non-structural proteins.
[0037] Figure 13 - Percentage of human moDC cells expressing eBFP - Percentage of cells transfected with either mimicry transfection or with construct 3 (parental wild-type VEEV saRNA), construct 4 (saRNA encoding VEEV nsP3 with the I167M mutation), or conventional mRNA encoding eBFP.
[0038] Figure 14 - Level of eBFP expression in human moDC cells: mean fluorescence intensity (MFI) of all cells transfected with mimic transfection or with construct 3 (parental wild-type VEEV saRNA), construct 4 (saRNA encoding VEEV nsP3 with I167M mutation), or conventional mRNA encoding eBFP.
[0039] Figure 15- RT-qPCR of IFNB1: IFNB1 transcription levels determined by qPCR in cells transfected with construct 1 (parental 1), construct 2 (parental 1 with I167M mutation), construct 7 (parental 2), construct 8 (parental 2 with I167M mutation), construct 9 (parental 3), and construct 10 (parental 3 with I167M mutation) relative to mimicked HeLa cells.
[0040] Figure 16 - RT-qPCR of OAS1: OAS1 transcription levels determined by qPCR in cells transfected with construct 1 (parental 1), construct 2 (parental 1 with I167M mutation), construct 7 (parental 2), construct 8 (parental 2 with I167M mutation), construct 9 (parental 3), and construct 10 (parental 3 with I167M mutation) relative to mimicked transfected HeLa cells.
[0041] Figure 17 - RT-qPCR of PKR: PKR transcription levels determined by qPCR in cells transfected with construct 1 (parental 1), construct 2 (parental 1 with I167M mutation), construct 7 (parental 2), construct 8 (parental 2 with I167M mutation), construct 9 (parental 3), and construct 10 (parental 3 with I167M mutation) relative to mimicked transfected HeLa cells.
[0042] Figure 18 -Serium IgG titer- Serum anti-spike IgG concentrations were reported, as determined 42 days after the first injection (14 days after the second injection) of an empty LNP or an LNP complexed with a saRNA containing wtVEEV nsP (parental), a saRNA encoding VEEV nsP3 with the I167M mutation (I167M), a saRNA encoding VEEV nsP3 with the I167M mutation containing m5C (I167M+m5C), or a codon-optimized saRNA encoding VEEV nsP with the I167M mutation in nsp3 encoding the SARS-CoV2 spike protein (codon-optimized I167M).
[0043] Figure 19-CD8+ T cells expressing cytokines- The percentage of CD8+ T cells expressing cytokines after spike peptide stimulation was reported 42 days after the first injection (14 days after the second injection) of an LNP containing empty LNP or a saRNA (parental) containing wt VEEV nsP, a saRNA encoding VEEV nsP3 with an I167M mutation (I167M), a saRNA encoding VEEV nsP3 with an I167M mutation containing m5C (I167M+m5C), or a codon-optimized saRNA encoding VEEV nsP with an I167M mutation in nsp3 encoding the SARS-CoV-2 spike protein (codon-optimized I167M). Single-positive, double-positive, and triple-positive refer to the number of CD8+ T cells expressing one, two, or all three of IL2, TNF-α, or IFN-γ, respectively.
[0044] Figure 20 -CD4+ T cells expressing cytokines- The percentage of CD4+ T cells expressing cytokines after spike peptide stimulation was determined 42 days after the first injection (14 days after the second injection) following the first injection of an empty LNP or an LNP compounded with a saRNA containing wt VEEV nsP (parental), a saRNA encoding VEEV nsP3 with an I167M mutation (I167M), a saRNA encoding VEEV nsP3 with an I167M mutation containing m5C (I167M+m5C), or a codon-optimized saRNA encoding VEEV nsP with an I167M mutation in nsp3 encoding the SARS-CoV-2 spike protein (codon-optimized I167M). Single-positive, double-positive, and triple-positive refer to the number of CD4+ T cells expressing one, two, or all three of IL2, TNF-α, or IFN-γ, respectively.
[0045] Figure 21- Serum Cytokine Levels - Serum cytokine levels of interferon-γ, CXCL1, CCL2, CXCL10, interferon-α, and IL-6 were reported, as measured by multiplex ELISA on day 1 after the first and second injections (day 29 after the first injection) of empty LNP or LNP complexed with saRNA containing wt VEEV nsP (parental), saRNA encoding VEEV nsP3 with the I167M mutation (I167M), saRNA encoding VEEV nsP3 with the I167M mutation containing m5C (I167M+m5C), or saRNA encoding codon-optimized VEEV nsP with the I167M mutation in nsp3 encoding the SARS-CoV-2 spike protein (codon-optimized I167M).
[0046] Figure 22 - A schematic diagram of the timeline of the pig trial in Example 11, up to day 56. Detailed Implementation
[0047] This disclosure provides replicon RNAs that are engineered to reduce the immunogenicity of the anti-vector (e.g., innate immunity) without impairing the expression of the encoded gene of interest.
[0048] Surprisingly, the inventors have identified replicon RNAs, specifically alphavirus replicon RNAs containing the modified alphavirus nsP3 as described herein, that produce reduced amounts of RNA (mRNA) upon transfection into cells while maintaining a similar load compared to those without the modified replicon RNA provided herein, or at least a sufficient load encoded by one or more target genes in the saRNA to perform their intended function. High RNA content has been identified as a key factor in the reactivity of RNA therapeutics, particularly in triggering innate immune responses. However, attenuated mutations in the alphavirus replicon nsP region that lead to reduced RNA expression typically also result in reduced (peak) expression of the target load / heterologous gene. The examples described herein show that, surprisingly, replicon RNAs encoding alphavirus nsP3 containing the mutations described herein maintain a similar expression profile (GOI / heterologous protein expression profile) to replicones encoding wild-type alphavirus nsP3 from which they originate, despite producing reduced levels of subgenomic RNA. As the data further illustrate, the reduction in RNA amount leads to a reduction in markers associated with replicon RNA reactivity (e.g., serum levels of pro-inflammatory cytokines).
[0049] Furthermore, since the nsP3 modification disclosed herein substantially does not affect the expression of GOI / heterologous proteins encoded by the replicon, transfection using the saRNA encoding alphavirus nsP3 described herein enables a broad adaptive immune response to the (antigenic) heterologous protein encoded by the saRNA. The induced adaptive immune response includes humoral and cellular-mediated responses, and, as demonstrated in the examples, a significantly higher CD8+ response compared to conventional mRNA. This broad adaptive immune response, including humoral and cellular-mediated responses, is particularly beneficial in vaccination, both prophylactic and therapeutic. Alternatively, it may also be beneficial to maintain GOI expression levels while reducing reactivity in therapeutic settings where the replicon RNA encodes a therapeutic protein for protein replacement therapy.
[0050] Unless otherwise defined, all technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art. Additionally, some terms used herein have the meanings described in the specification.
[0051] It is important to note that, unless the context explicitly states otherwise, the terms "an," "a," and "the" as used herein refer to singular and plural indicators, respectively. The term "at least" preceding a series of elements should be understood to refer to each element in that series. Throughout the specification and claims, unless the context requires otherwise, the word "comprising" and its variations will be understood to imply inclusion of the stated integers, steps, or components (or groups thereof), but not to exclude any other integers, steps, or components. The term "comprising" and its variations may be replaced by the terms "containing," "including," or sometimes "having."
[0052] When used in this document, "consisting of" does not include any integers, elements, steps, or components not specified in the sentence. When used, "consisting substantially of" does not exclude elements, steps, or components that do not substantially affect the essential and novel features of the subject matter defined by the sentence.
[0053] As used herein, the term "nucleotide" refers to a nucleotide base that is a basic building block of nucleic acids. A nucleotide consists of a sugar molecule (ribose in RNA or deoxyribose in DNA) linked to a phosphate group and a nitrogenous base (adenine, cytosine, guanine, or uracil in RNA, or adenine, cytosine, guanine, or thymine in DNA). Unless otherwise stated, the nucleotide used to define the replicon RNA construct or sequence disclosed herein is a ribonucleotide. Alternatively, the DNA template used to prepare the replicon disclosed herein is a deoxynucleotide.
[0054] The term "nucleic acid" refers to a long chain of nucleotides, including RNA and DNA molecules. The term "nucleic acid sequence" refers to the nucleotide sequence that typically runs from the 5' end to the 3' end of a linear nucleic acid.
[0055] As used in this article, "recombinant" or "engineered" nucleic acid or protein refers to the fact that the nucleic acid associated with it has been altered through human intervention.
[0056] When used herein, "replicon RNA," which is interchangeable with "replicon," "self-amplifying RNA" ("saRNA"), or "self-replicating RNA" ("srRNA"), refers to an RNA molecule that, unlike regular mRNA, contains all the genetic information required to direct its own amplification or self-replication within a permissible cell. Typically, replicon RNA constructs are genomically engineered from positive-sense RNA viruses. To direct its own amplification, the RNA molecule encodes an enzyme complex for directing its own in vivo amplification within target cells and contains essential elements required for replication, which are recognized and utilized by the encoded polymerase.
[0057] The term "alphavirus" and its derivatives have their conventional meaning in the field and include a variety of species in the genus Alphavirus of the family Phytoviridae, such as Venezuelan equine encephalitis virus (VEEV; for example, specific strains known as Trinidad ass, TC-83, etc.), Sindbis virus, Western equine encephalitis virus (WEEV), Eastern Equine Encephalitis Virus (EEEV), Chikungunya virus, Everglades virus, Tonate virus, Mucambo virus, Cabassou virus, Mosso das pedras virus, Rio Negro virus, Pixuna virus, Madrigal virus, Highlands J virus, Fort Morgan virus, and other closely related variants. In some embodiments, the replicon element is derived from a selection of alphaviruses including: VEEV (e.g., specific strains known as Trinidad asthma, TC-83, etc.), Sindbis virus, WEEV, EEEV, Chikungunya virus, Evogre virus, Tonat virus, Mucampo virus, Cabasou virus, Moso das Pedras virus, Negro virus, Picsuna virus, Madridyaga virus, Highland J virus, and Morganburg virus. In some embodiments, the replicon element is derived from a selection of alphaviruses, including VEEV (e.g., specific strains known as TC-83, Trinidad ass, etc.), Evogre virus, Tonat virus, Mucambo virus, Kabaso virus, Moso das Pedras virus, Negro virus, and Pixuna virus. In one specific embodiment, the replicon element is derived from VEEV.
[0058] As used herein, a sequence or replicon element is "derived from" a particular alphavirus (e.g., VEEV) if it corresponds to or has significant sequence identity with a wild-type sequence or replicon element of that alphavirus. In some embodiments, a sequence or replicon element is "derived from" a alphavirus (e.g., VEEV) if it has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity with a corresponding wild-type sequence or replicon element of that alphavirus (e.g., VEEV).
[0059] As used herein, the term "heterologous" for nucleic acid sequences refers to a sequence from a different source than the nucleic acid sequence which it is juxtaposed or operatively linked to. For example, a heterologous sequence incorporated into the replicon RNA described herein refers to a nucleic acid sequence encoding a protein from a different source than the virus (e.g., alphavirus) from which the replicon is derived. A promoter operatively linked to a coding sequence is called a "heterologous promoter," which is not operatively linked to the coding sequence in its native state.
[0060] The replicon RNA provided thereby is alphavirus replicon RNA. "Alavirus replicon" or "alphavirus replicon RNA" is a replicon derived from the alphavirus genome. In some embodiments, the alphavirus replicon does not contain at least a portion of the sequence encoding alphavirus structural proteins. In some embodiments, the replicon also contains a heterologous nucleic acid, such as a target gene (GOI), also called a heterologous sequence, which can be derived from a variety of sequences derived from any desired source. For example, in the alphavirus replicon RNA, the alphavirus's own sequence encoding its structural proteins is replaced by one or more GOIs or heterologous sequences. Each GOI can be placed under the control of a dedicated (subgenomic) promoter or other control elements known to those skilled in the art.
[0061] In some embodiments, the replicon RNA contains the following elements in the said sequence (5'>3'): 5'Cap, 5'UTR sequence, sequences encoding the biologically active non-structural proteins nsP1, nsP2, nsP3 and nsP4 (catalyzing RNA amplification), one or more heterologous sequences (each of which can be operatively linked to a subgenomic promoter or IRES), 3'UTR sequence and poly(A) tail.
[0062] In some embodiments, the alphavirus replicon RNA contains the following elements in the stated sequence (5'>3'): a 5' Cap, a 5' UTR sequence, sequences encoding the biologically active alphavirus non-structural proteins nsP1, nsP2, nsP3, and nsP4 (catalyzing RNA amplification), one or more heterologous sequences (each operatively ligable to a subgenomic promoter or IRES), a 3' UTR sequence, and a poly(A) tail. In the embodiments described herein, nsP3 is the alphavirus nsP3 as described herein.
[0063] This disclosure provides a modified form of alphavirus nonstructural protein 3 (nsP3), namely, alphavirus nsP3 containing at least one mutation. As used herein, the term "modified" with respect to alphavirus nsP3 as described herein refers to the introduction of at least one single-amino acid mutation, such as a single-amino acid substitution.
[0064] The natural form of VEEV nsP3 mentioned herein comprises the amino acid sequence of SEQ ID NO 1 (i.e., wild-type VEEV nsP3). It should be understood that wild-type VEEV nsP3 may have the longer amino acid sequence of SEQ ID NO 17, which is a result of stop codon readthrough. It should also be understood that nsP3 can be formed by proteolytic cleavage of the entire nsP 1234 protein or by cleavage of nsP 123, depending on the stop codon readthrough at the end of nsP3. The first amino acid of SEQ ID NO 1 (or SEQ ID NO 17) corresponds to position 1330 of the amino acid sequence of the complete wild-type VEEV nsP 1234 polyprotein. Such a stop codon can also be (intentionally) removed. Therefore, in some embodiments, nsP3 contains an additional mutation in which the stop codon at position 551, corresponding to SEQ ID 18, is mutated to arginine, thereby removing this stop codon and resulting in default readthrough.
[0065] The alphavirus nsP3 disclosed herein is an alphavirus nsP3 that is modified at least by a mutation at position 167 of the wild-type VEEV nsP3 sequence corresponding to SEQ ID NO 1. Amino acid residue 167 of SEQ ID NO 1 corresponds to position 1496 of the amino acid sequence of the intact wild-type VEEV nsP 1234 polyprotein.
[0066] "The amino acid position of amino acid position 167, which corresponds to the wild-type VEEV nsP3 sequence of SEQ ID NO 1, can be determined by any method of amino acid sequence alignment known in the art, such as BLAST or FastA protein alignment."
[0067] The term "mutation" as used in this article refers to the substitution of a single amino acid in a protein or the substitution of a single nucleotide in RNA.
[0068] In some embodiments, the nsP3 sequence originates from an alphavirus selected from VEEV (e.g., TC-83VEEV or Trinidad ass virus), Evogre virus, Tonate virus, Mucampo virus, Cabosio virus, Moso das Pedras virus, Negro virus, and Pixuna virus and their variants. The wild-type nsP3 sequences of these alphaviruses are homologous to and have high sequence similarity to the wild-type VEEV nsP3 sequence.
[0069] Therefore, the alphavirus nsP3 disclosed herein can be alphavirus nsP3 selected from VEEV (e.g., TC-83VEEV or Trinidad donkey virus), Evogre virus, Tonat virus, Mucambo virus, Kabaso virus, Moso das Pedras virus, Negro virus and Pixuna virus and their variants, which are modified at least by a mutation at the position of amino acid residue 167 of the wild-type VEEV nsP3 sequence corresponding to SEQ ID NO 1.
[0070] It should be understood that the alphavirus nsP3 disclosed herein can be derived from any alphavirus from which the wild-type alphavirus nsP3 sequence is homologous to the wild-type VEEV nsP3 sequence. In some embodiments, the alphavirus from which nsP3 is derived can have a wild-type nsP3 sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity with the wild-type VEEV nsP3 sequence of SEQ ID NO 1. In some embodiments, the alphavirus from which nsP3 is derived can have a wild-type nsP3 sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence similarity with the wild-type VEEV nsP3 sequence of SEQ ID NO 1, optionally wherein the similarity scoring matrix is a BLOSUM45 matrix.
[0071] In some implementations, the alphavirus nsP3 is a VEEV nsP3 containing a mutation at amino acid position 167.
[0072] For the purposes of this disclosure, the alphavirus nsP3 mutation at position 167, corresponding to wild-type VEEV nsP3, is a single amino acid substitution. In some embodiments, the amino acid appearing at position 167, corresponding to wild-type VEEV nsP3, in the wild-type sequence of alphavirus nsP3 is replaced by an amino acid other than isoleucine or leucine, or an amino acid other than isoleucine, leucine, and valine.
[0073] In some embodiments, the alphavirus nsP3 contains a methionine (Met) residue at amino acid position 167, which corresponds to amino acid position 167 of wild-type VEEV nsP3. In embodiments where the alphavirus nsP3 is VEEV nsP3, the mutation at amino acid position 167 can be I167M. In some embodiments, VEEV nsP3 has the amino acid sequence of SEQ ID NO: 2. In some embodiments, VEEV nsP3 has the amino acid sequence of SEQ ID NO: 18 (as a result of stop codon readout). The first amino acid of SEQ ID NO: 2 or SEQ ID NO: 18 corresponds to position 1330 of the complete amino acid sequence of the VEEV nsP 1234 polyprotein.
[0074] In some embodiments, the alphavirus nsP3 has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 2, provided that the amino acid at position 167 is Met. In some embodiments, the alphavirus nsP3 has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 18, provided that the amino acid at position 167 is Met.
[0075] On the other hand, replicon RNAs are provided that contain sequences encoding alphavirus nonstructural proteins nsP1, nsP2, nsP3, and nsP4, wherein the alphavirus nsP3 is the alphavirus nsP3 described herein. Any replicon RNA construct encoding the alphavirus nonstructural proteins nsP1, nsP2, nsP3, and nsP4 can benefit from the inclusion of a sequence encoding nsP3 as described herein. Therefore, replicon RNAs encoding alphavirus nsP3 as described herein are provided. For example, recombinant alphavirus replicon RNAs in which the sequence encoding naturally occurring nsP3 is replaced by a sequence encoding nsP3 as described herein.
[0076] The sequence encoding nsP3 of the alphavirus described herein can be introduced into replicons derived from other viruses (e.g., alphaviruses other than VEEV) to achieve a function similar to that of the VEEV-derived replicons described herein. For example, the sequence encoding nsP3 of the alphavirus described herein can be introduced into a replicons derived from Sindbis virus.
[0077] The alphavirus nsP3 described herein confers specific characteristics on the entire replicon (e.g., the alphavirus replicon), as illustrated in this embodiment, particularly reduced RNA transcription (leading to a reduced innate immune response and / or reactivity), while inducing a broad range of adaptive immune responses against the encoded GOI (including humoral and cell-mediated immune (CMI) responses, including CD8+ T cell-induced responses). For example, a reduced innate immune response can be demonstrated by producing fewer pro-inflammatory transcripts associated with the IFN-α pathway. Reduced reactivity can be demonstrated, for example, by measuring serum cytokine levels (e.g., IFN-γ, CXCL-1 (KC), TNF-α, CCL2 (MCP-1), CXCL10 (IP10), IFN-α, and IL-6). Vaccines that elicit a strong CMI response are particularly sought for pathogens that are persistently present or hidden within host cells, such as certain viruses and certain bacteria (e.g., Chlamydia trachomatis and Mycobacterium tuberculosis). A balanced CMI and humoral (antibody-mediated) response are expected to provide robust and durable immunity.
[0078] Non-structural proteins
[0079] As defined herein, a replicon RNA is an RNA molecule that, unlike regular mRNA, contains all the genetic information required to direct its self-amplification or self-replication within the cell.
[0080] The replicon RNA can be alphavirus replicon RNA. Typically, for alphavirus replicon RNA, non-structural proteins 1-4 (nsP 1-4) form an RNA-dependent RNA polymerase (RDRP) responsible for the replication of the saRNA, resulting in copies of the saRNA. Therefore, multiple copies of subgenomic RNA are generated from each initially delivered saRNA. This leads to the translation of more copies of the heterologous coding sequence compared to non-self-amplified RNA.
[0081] The replicon RNA may contain sequences encoding the alphavirus nonstructural proteins nsP1, nsP2, nsP3, and nsP4, optionally independently derived from one or more alphavirus genomes, wherein nsP3 is the alphavirus nsP3 described herein.
[0082] The replicon RNA may contain sequences encoding the alphavirus nonstructural proteins nsP1, nsP2, nsP3, and nsP4, wherein said sequences are modified at least by a modification at position 4488 of the sequence corresponding to the wild-type VEEV nsP1-4. As used herein, "nsP1-4" may refer to the nsP12234 polyprotein.
[0083] "The nucleotide position corresponding to amino acid position 4488 of the sequence encoding wild-type VEEV nsP 1-4" can be determined by any method of nucleotide sequence alignment known in the art, such as BLAST or FastA nucleotide alignment.
[0084] The sequences encoding non-structural proteins (nsP1, nsP2, nsP3, and nsP4) can be derived from alphaviruses such as VEEV (e.g., TC-83VEEV or Trinidad donkey virus), Evogre virus, Tonat virus, Mucambo virus, Caboso virus, Mosodas Pedras virus, Negro virus, Pixuna virus, and their variants.
[0085] In some embodiments, the sequences encoding non-structural proteins (nsP1, nsP2, nsP3, and nsP4) are derived from VEEV. Wild-type sequences encoding VEEV nsP1-4 are provided in SEQ ID NO: 3.
[0086] As defined elsewhere in this document, a sequence may be “derived from” a particular alphavirus (e.g., VEEV) if it corresponds to or has significant sequence identity with a wild-type sequence of that particular alphavirus (e.g., VEEV), such as having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity.
[0087] In some embodiments, the sequence encoding alphavirus nsP1-4 has the nucleotide sequence of SEQ ID NO: 4 (i.e., the sequence encoding VEEEV nsP1-4 modified by the A4488G mutation). In some embodiments, the sequence encoding alphavirus nsP1-4 has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 4, provided that the sequence encodes nsP3 containing a Met residue at position 167 corresponding to residue 167 of SEQ ID NO 1.
[0088] Alternatively, the sequences encoding each non-structural protein (nsP1, nsP2, nsP3, and nsP4) can be independently derived from one or more alphaviruses selected from VEEV (such as TC-83VEEV or Trinidad donkey virus), Evogre virus, Tonat virus, Mucambo virus, Kabaso virus, Moso das Pedras virus, Negro virus, Picsuna virus, and their variants.
[0089] In some embodiments, non-structural proteins 1, 2, and / or 4 correspond to their natural (wild-type) counterparts. In some embodiments, non-structural proteins nsP1, nsP2, and nsP4 are wild-type.
[0090] In alternative implementations, sequences encoding modified forms of nonstructural proteins (e.g., modified forms of nsP1, nsP2, and / or nsP4) are used. Further modifications of native nsPs (in addition to the nsP3 mutations described herein) have been described in the art and can also be applied to the nsP3 or replicons described herein (see, for example: Li, Y. et al. In vitroevolution of enhanced RNA replicons for immunotherapy. Sci Rep 9, 6932(2019); LaPointe AT et al. Increasing the capping efficiency of the SindbisVirus nsP1 Protein negatively affects viral infection. mBio 9(6):e02342-18((2018)) to, for example, increase transcription or translation efficiency, or generate a favorable immune response (innate and / or adaptive).
[0091] In some embodiments, the replicon RNA comprises sequences encoding non-structural proteins nsP1, nsP2, and / or nsP4 derived from VEEV. The wild-type sequence encoding VEEV nsP1 is provided in SEQ ID NO: 5. The wild-type sequence encoding VEEV nsP2 is provided in SEQ ID NO: 6. The wild-type sequence encoding VEEV nsP4 is provided in SEQ ID NO: 9.
[0092] The wild-type RNA sequence encoding VEEV nsP3 is provided in SEQ ID NO: 7, and the RNA sequence encoding VEEV nsP3 modified by the I167M mutation is provided in SEQ ID NO: 8. The RNA sequences of SEQ ID NO: 7 and SEQ ID NO: 8 include a stop codon "UGA" near the 3' end, followed by a readout. Therefore, based on the stop codon readout, SEQ ID NO: 7 can encode SEQ ID NO: 1 or SEQ ID NO: 17. Similarly, SEQ ID NO: 8 can encode SEQ ID NO: 2 or SEQ ID NO: 18, depending on the stop codon readout. It should be understood that RNA sequences lacking the stop codon readout but still encoding wild-type VEEV nsP3 of SEQ ID NO: 1 or VEEV nsP3 with the I167M mutation of SEQ ID NO: 2 can be introduced into the replicon RNAs described herein.
[0093] In some embodiments, the RNA sequence encoding alphavirus nsP3 has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 8, provided that the sequence encodes nsP3 containing a Met residue at position 167 corresponding to residue 167 of SEQ ID NO 1.
[0094] Therefore, the sequences encoding nsP1-4 can include SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8 and SEQ ID NO: 9 (i.e. encoding wild-type VEEV nsP1, 2 and 4, as well as nsP3 modified by the I167M mutation).
[0095] In some embodiments, the non-structural proteins nsP1, nsP2, and nsP4 are derived from VEEV and contain additional mutations in nsP2, such as Q739L (see Petrakova O et al. Noncytopathic replication of Venezuelan equine encephalitis virus and eastern equine encephalitis virus replicons in Mammalian cells. J Virol. 2005 Jun;79(12):7597-608). Any mutations (e.g., further adaptive mutations) in non-structural proteins known to those skilled in the art that confer the characteristics exhibited by the replicon RNA can be considered for use in combination with the nsP3 mutation at position 167 described herein.
[0096] For the replicon RNAs provided herein, replicon elements from replicon RNAs of any virus (e.g., alphavirus) can be used as the basis for deriving replicon sequences, such as the aforementioned alphaviruses that can derive sequences encoding nsP.
[0097] Suitable wild-type alphavirus sequences are well-known and available from sequence depositories such as the American Center for Type Culture Collection, Rockville, Md. Representative examples of suitable alphaviruses include Aura virus (ATCC VR-368), Bebaru virus (ATCC VR-600, ATCC VR-1240), Kabaso virus (ATCC 30VR-922), Chikungunya virus (ATCC VR-64, ATCC VR-1241), Eastern equine encephalomyelitis virus (ATCC VR-65, ATCC VR-1242), Morganburg virus (ATCC VR-924), Getah virus (ATCC VR-369, ATCC VR-1243), Kyzylagach (ATCC VR-927), Mayaro virus (ATCC VR-66, ATCC VR-1277), Middleburg virus (ATCC VR-370), and Mukamba 5 virus (ATCC VR-580, ATCC VR-368). VR-1244), Ndumu virus (ATCC VR-371), Pixuna virus (ATCC VR-372, ATCC VR-1245), Ross River virus (ATCC VR-373, ATCC VR-1246), Semliki Forest virus (ATCC VR-67, ATCC VR-1247), Sindbis virus (ATCC VR-68, ATCC VR-1248), Tonate virus (ATCC VR-925), Triniti virus (ATCC VR-469), Una virus (ATCC VR-374), Venezuelan equine encephalomyelitis (ATCC VR-69, ATCC VR-923, ATCC VR-1250, ATCC VR10 1249, ATCC VR-532), Western equine encephalomyelitis (ATCC VR-1244). VR-70, ATCCVR1251, ATCC VR-622, ATCC VR-1252), Whataroa virus (ATCC VR-926), and Y-62-33 (ATCC VR-375). In one specific embodiment, the alphavirus is Venezuelan equine encephalitis virus (VEEV). In a more specific embodiment, the alphavirus is a live attenuated Venezuelan equine encephalitis virus (VEEV), such as strain TC-83.
[0098] 5' cap
[0099] The replicon RNA thus provided may have at least one 5' cap. As used herein, "5' cap" is an entity, typically a modified nucleotide entity, that typically "caps" the 5' end of mature mRNA. The 5' cap can usually be formed from modified nucleotides, particularly derivatives of guanine nucleotides. Preferably, the 5' cap is attached to the 5' end via a 5'-5'-triphosphate bond. The 5' cap can be methylated, for example, m7GpppN, where N is the terminal 5' nucleotide of the nucleic acid carrying the 5' cap, typically the 5' end of RNA. Other examples of 5′ cap structures include glycerol groups, reverse deoxygenated base residues (partially), 4′,5′ methylene nucleotides, l-(β-D-erythrofuranosyl) nucleotides, 4′-thionucleotides, carbocyclic nucleotides, 1,5-dehydrated hexitol nucleotides, L-nucleotides, α-nucleotides, modified base nucleotides, threo-pentofuranosyl nucleotides, and acyclic 3′,4′-open cyclic nucleotides. Nucleotide), acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5-dihydroxypentyl nucleotide, 3′-3′-reverse nucleotide moiety, 3′-3′-reverse debasement moiety, 3′-2′-reverse nucleotide moiety, 3′-2′-reverse debasement moiety, 1,4-butanediol phosphate, 3′-aminophosphate, hexyl phosphate, aminohexyl phosphate, 3′-phosphate, 3′-thiophosphate, dithiophosphate, or bridged or non-bridged methylphosphonate moiety. 5'-cap structures that can be used for further modification in the context of the replicon RNA provided herein are cap 1 (methylation of the ribose of the adjacent nucleotide of m7GpppN), cap 2 (methylation of the ribose of the adjacent nucleotide downstream of m7GpppN and the second nucleotide), cap 3 (methylation of the ribose of the adjacent nucleotide downstream of m7GpppN, the second nucleotide, and the third nucleotide), cap 4 (methylation of the ribose of the adjacent nucleotide downstream of m7GpppN, the second nucleotide, the third nucleotide, and the fourth nucleotide), ARCA (anti-reverse CAP analog), modified ARCA (e.g., phosphate thioester modified ARCA), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-denitro-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine. A particularly preferred 5'-cap is the CleanCap structure provided by TriLink BioTechnologies.
[0100] 5' Untranslated Region (5'UTR)
[0101] Typically, the replicon RNA provided contains a 5'UTR. The 5'UTR is the nucleotide sequence at the 5' end of the mRNA molecule upstream of the start codon and is therefore not translated into protein. The 5'UTR can play several roles in gene expression and / or post-transcriptional regulation, including the regulation of translation initiation and protein expression.
[0102] In some implementations, the 5'-UTR used is heterologous to the heterologous coding sequence, for example, derived from or retained from an alphavirus genome derived from a replicon. Even though a 5'-UTR derived from a naturally occurring genome is preferred, synthetically engineered 5'-UTRs may also be used in the context of this disclosure.
[0103] Subgenomic promoters / IRES
[0104] The replicon RNA provided thereby may contain one or more heterologous sequences, each operatively linked to one or more promoters and / or IRES elements, optionally wherein said promoters are subgenomic promoters. Each heterologous sequence may encode one or more heterologous gene products.
[0105] In some implementations, the replicon sequence encoding a viral structural protein (e.g., an alphavirus structural protein) is replaced by one or more heterologous sequences, thereby placing the heterologous sequence under the control of a natural viral promoter (e.g., an alphavirus promoter). Alternatively, one or more heterologous sequences may be placed under the control of heterologous regulatory elements such as heterologous subgenomic promoters.
[0106] In some implementations, the one or more heterologous sequences are operatively linked to one or more promoters (e.g., subgenomic promoters). Two or more heterologous sequences may each be operatively linked to different promoters (e.g., subgenomic promoters). Alternatively, two or more heterologous sequences may be operatively linked to the same promoter (e.g., a subgenomic promoter).
[0107] As used herein, the term "subgenomic promoter" refers to those sequences that constitute the functional elements required to generate subgenomic RNA species. Subgenomic promoters are capable of using RNA as a template to drive gene expression; subgenomic promoters are recognized by RNA-dependent RNA polymerases, which may be viral RNA replicases. The promoter itself may be a complex derived from more than one segment, naturally occurring, homologous or heterologous to the replicon, or synthetic. It should be noted that subgenomic promoters are associated with specific genes initiating the transcription of subgenomic RNA material or its transcription, and are functionally recognized by RNA-dependent RNA polymerases (or viral RNA replicases) when contained in RNA molecules with appropriate (-) polarity. A negative-sense RNA molecule containing a functional copy of a subgenomic promoter, comprising a core promoter and an activation domain, can be synthesized by RNA-dependent RNA polymerases using a positive-sense RNA molecule as a template, or it may have been synthesized by (cellular) RNA polymerase II as a transcript initiated by the polII promoter.
[0108] In some implementations, the one or more heterogeneous sequences are operatively connected to one or more IRES elements. Two or more heterogeneous sequences may each be operatively connected to different IRES. Alternatively, two or more heterogeneous sequences may be operatively connected to the same IRES.
[0109] Therefore, internal ribosome entry site (IRES) sequences can be incorporated into replicon RNA to control the expression of heterologous coding sequences. An IRES is an RNA element whose natural form allows for cap-independent translation initiation (ribosome assembly). IRES elements have been used to regulate the expression of target genes administered via mRNA.
[0110] In some implementations, one or more heterologous sequences are operatively linked to one or more promoters (e.g., subgenomic promoters), and one or more heterologous sequences are operatively linked to one or more IRES elements.
[0111] Heterologous sequences (also known as genes of interest (GOI)) and their usage
[0112] Generally, the saRNA or replicon RNA described herein is considered a means of customizing the expression of products encoded by heterologous sequences placed under the control of subgenomic promoters, IRES, or equivalents. Therefore, some embodiments relate to the use of replicon RNAs to express encoded products in cells.
[0113] Each heterologous sequence of the replicon RNA provided herein may encode one or more heterologous gene products. The heterologous gene products may be, for example, heterologous proteins, oligonucleotides, or polynucleotides, optionally wherein the oligonucleotides or polynucleotides are RNA (e.g., siRNA, gRNA). In this document, the gene products are heterologous to the virus from which the replicon RNA originates.
[0114] In some implementations, one or more heterologous sequences encode heterologous proteins, such as heterologous proteins derived from pathogens (e.g., bacteria, viruses, fungi, protozoa, or multicellular parasitic pathogens), allergens, or tumors.
[0115] In some embodiments, the heterologous protein is an antigenic protein. For example, in some embodiments, replicon RNA is used as a carrier for delivering pathogen-derived antigens. Any protein-derived antigen known in the art can be considered for delivery via replicon RNA encoded by a heterologous sequence.
[0116] In some embodiments, the replicon RNA is used as a carrier for delivering tumor-derived antigens. Any tumor-associated antigen (TAA) or tumor-specific antigen (TSA) available in the art can be considered a heterologous sequence of the replicon RNA provided herein.
[0117] The replicons described herein are particularly useful for delivering antigens (especially pathogen-derived antigens) for preventive or therapeutic inoculation purposes.
[0118] Alternatively, based on the sustained expression profile determined in the in vivo experiments reported herein, the replicon is considered suitable for replacement therapy. Therefore, in some embodiments, the heterologous protein is the therapeutic protein. Such a therapeutic protein may be another protein that is endogenous to the individual, but which the individual cannot produce at sufficient levels, or which the endogenous protein is expressed in a non-functional form. The replicon RNA of the present invention can be used to deliver the (correct) protein in protein replacement therapy.
[0119] 3' Untranslated Region (3'UTR)
[0120] The disclosed replicon RNA may contain a 3'UTR.
[0121] The 3'-UTR is typically a portion of mRNA, located between the protein-coding region (i.e., the open reading frame) and the 3'-terminus of the mRNA. The 3'-UTR of mRNA is not translated into an amino acid sequence. The 3'-UTR sequence is typically encoded by a gene, which is transcribed into the corresponding mRNA during gene expression. In the context of this disclosure, the 3'-UTR corresponds to a replicon sequence located at the 3' end of the stop codon of the heterologous coding sequence, preferably immediately following the 3' end of the stop codon of the heterologous coding sequence, and extending to the 5' side of the 3' end of the replicon or poly(A) tail, preferably extending to the nucleotide immediately following the 5' end of the poly(A) tail. The term "corresponds to" means that the 3'-UTR sequence can be an RNA sequence, such as in the replicon sequence used to define the 3'-UTR sequence, or a DNA sequence corresponding to such an RNA sequence. Preferably, the 3'-UTR used according to this disclosure is heterologous to the heterologous coding sequence, for example, derived from or retained from the alphavirus genome from which the replicon is derived. Even though 3'-UTRs derived from naturally occurring genomes are preferred, synthetically engineered UTRs may also be used in the context of this disclosure.
[0122] poly(A) tail
[0123] The term "3′-poly(A) tail" or "poly(A) tail" generally refers to a segment of adenine nucleotides at the 3′ end of mRNA. In the context of this disclosure, the term refers to such a poly(A) tail at the 3′ end of the replicon 3′UTR. In some cases, it can be as short as 20 nucleotides or contain up to about 500 adenine nucleotides. In some cases, the length of the 3′-poly(A) tail may be an essential element for the stability of the RNA chain. The length can be up to about 400 adenine nucleotides, for example, about 20 to about 400, preferably about 30 to about 400, more preferably about 30 to about 300, and even more preferably about 30 to about 250. In embodiments, the poly(A) tail has about 30, about 40, about 50, about 60, about 70, about 80, about 100, or about 120 nucleotides. The poly(A) tail can be a variant, such as a segmented poly(A) tail, characterized by consisting of at least two A-containing elements, each of which is defined as a nucleotide sequence of 20-60 adenosines separated by spacer elements of varying lengths (see, for example, Trepotec Z, Geiger J, Plank C, Aneja MK, Rudolph C. Segmented poly(A) tails significantly reduce recombination of plasmid DNA without affecting mRNA translation efficiency or half-life. RNA. 2019 Apr;25(4):507-518).
[0124] In some embodiments, the replicon RNA disclosed herein is further modified in a manner independent of the modifications to the alphavirus nsP3 described herein, thereby potentially further improving overall replicon function. Many such modifications are known to those skilled in the art and are therefore considered for use in the replicon RNA disclosed herein.
[0125] Therefore, in some implementations, codon optimization is applied to the nucleotide sequence of the replicon RNA. Depending on the codon optimization algorithm used, characteristics of the replicon RNA, such as overall stability and further reduction of innate perception, can be achieved.
[0126] In some implementations, codon optimization of the replicon RNA is performed according to an algorithm described by He Zhang et al. (Nature (2023) 621, 396-403). Alternative codon optimization tools are also available and are known to those skilled in the art.
[0127] The use of modified nucleosides in the replicon RNA described herein has also been considered. In some embodiments, one or more modified nucleosides are used in the manufacture or design of the replicon RNA, which is selected from the group consisting of: pseudouridine, N1-methyl-pseudouridine, 5-methyl-uridine, pseudocytidine, N1-methyl-pseudocytidine, and 5-methyl-cytidine. In one embodiment, the modified nucleoside is independently selected from N1-methyl-pseudouridine or 5-methyl-cytidine. In one embodiment, the replicon RNA comprises substantially 50%, 60%, 70%, 80%, 90%, or 100% of modified cytidine and / or modified uridine (e.g., N1-methyl-pseudouridine), respectively. In one embodiment, 100% of the cytidine is modified cytidine.
[0128] Preparation method
[0129] The replicon RNA described herein can be obtained by any method known in the art for the manufacture of RNA molecules. Typically, synthetic RNA molecules are prepared by in vitro transcription (IVT). IVT requires a linear DNA template containing a dedicated promoter that initiates transcription of the target RNA sequence.
[0130] Therefore, this disclosure provides DNA templates encoding replicon RNA as described herein, particularly replicon RNA as defined in claims. DNA templates are typically obtained by linearizing a plasmid containing the coding sequences of a promoter and a target RNA. Alternatively, the template can be obtained using other techniques known in the art to provide a synthetic DNA template suitable for IVT, such as, but not limited to, PCR, rolling circle amplification (RCA), or synthetic DNA fragment synthesis. In some embodiments, the DNA template is provided in a method (e.g., IVT) for preparing the modified replicon RNA described herein. Common promoters for transcribing RNA from a DNA template include T7, SP6, or T3 promoters. The IVT reaction mixture also contains ribonucleoside triphosphates, a suitable phage RNA polymerase (e.g., T7, SP6, or T3 RNA polymerases, including modified variants of them described in the art) for the promoter present in the DNA template, and a buffer system suitable for the RNA polymerase used. An RNase inhibitor may also be contained in the reaction mixture. Determining the exact conditions used in the IVT reaction (particularly depending on the amount of RNA required for a particular application and the length and nature of the target RNA molecule) is within the skill of those skilled in the art. Various RNA synthesis kits are available, some of which are optimized for long RNA transcripts. An example is the HiScribe T7 High-Yield RNA Synthesis Kit (NewEngland BioLabs).
[0131] Typically, RNA molecules are protected by a 5′-cap. 5′-capping of RNA can be performed concurrently with the IVT reaction using the following chemical RNA cap analogs to produce the 5′-guanosine cap structure according to the manufacturer's protocol: 3′-O-Me-m7G(5′)ppp(5′)G [ARCA cap]; G(5′)ppp(5′)A; G(5′)ppp(5′)G; m7G(5′)ppp(5′)A; m7G(5′)ppp(5′)G (New England BioLabs). 5′-capping of modified RNA can also be performed post-transcriptionally using a vaccinia virus capping enzyme to produce the "Cap0" structure: m7G(5′)ppp(5′)G (New England BioLabscap). The Cap1 structure can be generated using both a vaccinia virus capping enzyme and a 2′-O methyltransferase to produce: m7G(5′)ppp(5′)G-2′-O-methyl. The Cap2 structure can be generated from the Cap1 structure, followed by 2′-O-methylation of the penultimate nucleotide at 5′ using a 2′-O-methyltransferase. The Cap3 structure can be generated from the Cap2 structure, followed by 2′-O-methylation of the penultimate nucleotide at 5′ using a 2′-O-methyltransferase. The enzyme can be derived from a recombinant source. Alternatively, 5′-capping of polynucleotides can be achieved through co-transcriptional capping using m2 7,3′-oGpppG or m2 7,2′-oGpppGARCA (CellScript Inc), CleanCap technologies such as CleanCap AU (TriLinkBiotechnologies LLC), 5′-thiophosphate cap analogs (Univ. Warszawski), or by using alternative cap analogs.
[0132] Expression methods, nanoparticles and cells
[0133] This disclosure provides a method for expressing one or more heterologous gene products in cells, comprising: introducing a replicon RNA as described herein into a cell; and expressing the one or more heterologous gene products encoded by the replicon in the cells. In some embodiments, the one or more heterologous gene products are heterologous proteins. In some embodiments, the one or more heterologous gene products are heterologous RNAs (e.g., siRNA or gRNA). In some embodiments, the heterologous gene product is a heterologous protein, which is an antigenic protein, particularly an antigenic protein that induces a prophylactic and / or therapeutic immune response when expressed by the replicon RNA, said immune response being at least in part due to a wide range of humoral and cellular mediators (including CD8+ and / or CD4+ T-cell responses), similar to those reported for the constructs reported herein.
[0134] The replicon RNAs described herein are suitable for delivery to cells in in vitro cell cultures and to subjects in vivo via any means known in the art for RNA delivery. Viral particle-like encapsulations have been described. Non-viral formulations, including cationic lipids, LNPs, polymers, and protamine sulfate, as well as physical methods such as electroporation, can be used to deliver RNA therapeutic agents.
[0135] Methods known in the art for using mRNA for cell transfection and / or for individual (therapeutic) administration of mRNA are also considered for delivering the modified replicon RNAs described herein, such as those mentioned by Xiang Li et al. (Theranostics 2024, Vol. 14, Issue 2, pages 738-760) or Paunovska K, et al. Drug delivery systems for RNA therapeutics. Nat Rev Genet. 2022 May;23(5):265-280. These typically include cationic moieties that allow lipids to bind to negatively charged RNA, thereby protecting the RNA from RNase activity and facilitating efficient uptake within the cell, including endosome escape. Furthermore, the inclusion of the nsP1-4 replicon sequence in saRNAs makes them significantly longer than their conventional mRNA counterparts, which is important for formulation. In recent years, in particular, Bloom K. et al. (Self-amplifying RNA vaccines for infectious diseases. (2021) Gene Ther 28, 117–129) and Liu Y. et al. (Liu, Y.; Li, Y.; Hu, Q. Advances in saRNAVaccine Research against Emerging / Re-Emerging Viruses. Vaccines 2023, 11, 1142) have described several new or specialized approaches aimed at improving saRNA delivery.
[0136] This disclosure provides nanoparticles comprising replicon RNA as described herein. In some embodiments, the nanoparticles are lipid nanoparticles (LNPs). LNP formulations known to those skilled in the art, such as formulations for vaccines comprising mRNA, typically comprise ionizable cationic lipids, auxiliary or structural lipids, such as DSPC or phosphatidylcholine-based analogs, polyethylene glycol-conjugated lipids, and cholesterol. In some embodiments, lipid nanoparticle technology is used to formulate replicon RNA using ionizable cationic lipids, such as those described in WO2023078946, WO2023078950, or WO2023078954 (or US18 / 705454, US18 / 705479, or US18 / 705396, respectively, which are incorporated herein by reference). In some embodiments, the nanoparticles are virus-like particles (VLPs). In some implementations, the nanoparticles are polymer-based particles (e.g., polymer-based carriers mentioned in Table 2 of Xiang Li et al., Theranostics 2024, Vol. 14, Issue 2, or similar).
[0137] In some embodiments of this method, the replicon RNA is introduced into the cell via direct transfection.
[0138] This disclosure also provides cells comprising the replicon RNA as described herein. The cells may be mammalian cells, such as human cells. The cells may lack native expression of one or more heterologous gene products (e.g., proteins) encoded by the replicon RNA. The cells may have defective expression of one or more heterologous gene products (e.g., proteins) encoded by the replicon RNA.
[0139] Pharmaceutical Composition
[0140] This disclosure provides pharmaceutical compositions comprising replicon RNA as described herein, nanoparticles comprising replicon RNA as described herein, or cells comprising replicon RNA as described herein.
[0141] In embodiments where the pharmaceutical composition comprises a cell containing replicon RNA, one or more heterologous gene products encoded by the replicon RNA are typically expressed in the cell. For example, a transcription or translation product encoded by a heterologous sequence of the replicon RNA may be expressed in the cell. In embodiments where the heterologous gene product is a protein, the cell may present the protein on its cell surface. In some embodiments, the pharmaceutical composition comprising one or more modified replicon RNAs provides in situ release of the translation product of the one or more heterologous sequences. In some embodiments, the heterologous sequence encoded by the replicon RNA is a chimeric antigen receptor (CAR), and the cell is an immune cell, such as a human immune cell or an immune cell isolated from a patient. In these embodiments, the pharmaceutical composition is used for CAR-based therapies, such as CAR-T cell therapy or CAR-NK cell therapy. Typically, CAR-based therapies are designed for the treatment of cancer. Alternatively, CAR-based therapies providing the replicon RNA described herein may also be used to treat certain autoimmune diseases.
[0142] In some embodiments, replicon RNA encoding a CAR construct as described in US20240115606 (incorporated herein by reference) is provided, as well as immune cells, such as NK cells, containing such replicon RNA, and pharmaceutical compositions containing such immune cells and / or replicon RNA.
[0143] The replicon RNA described herein, when appropriately formulated into a pharmaceutical composition, can be used in methods of treating a subject's disease, whether preventative or therapeutic. The subject is preferably a mammal, more preferably a human.
[0144] Alternatively, replicon RNAs, nanoparticles, cells, or pharmaceutical compositions as described herein may be used in methods for inducing an immune response in an individual or for vaccination. As explained elsewhere herein, the alphavirus nsP3 described herein generates a broad range of adaptive immune responses (including robust humoral and cell-mediated responses, including CD8+ T cell responses) that are particularly advantageous for the prophylactic treatment of diseases in subjects.
[0145] Alternatively, replicon RNA as described herein, nanoparticles as described herein, cells as described herein, or pharmaceutical compositions as described herein may be used in therapies to treat gene expression disorders in patients.
[0146] The most common route of administration for this pharmaceutical composition is injection, such as intradermal (ID), subcutaneous (SC), intramuscular (IM), intranodal (IN), and intravenous (IV). In one specific embodiment, IM administration is of the pharmaceutical composition containing a suitably formulated replicon RNA. Other routes, including mucosal administration such as intranasal injection, intratracheal instillation, and intravaginal injection, as well as intratumoral injection described for mRNA delivery (e.g., reviewed by Zeng C et al., Curr Top Microbiol Immunol. 2022;440:71-110), are also considered suitable for the replicon RNA disclosed herein.
[0147] The replicon RNA pharmaceutical compositions described herein can be prepared, packaged, or marketed in bulk as a single unit dose or as multiple single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition containing a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dose of the active ingredient to be administered to a subject or a convenient fraction of such a dose, such as half or one-third of such a dose. The relative amounts of the active ingredient, pharmaceutically acceptable carrier, and any other components in the pharmaceutical compositions of this disclosure will vary depending on the identity, size, and condition of the subject being treated and further on the route of administration of the composition. As an example, the compositions may contain 0.1% to 100% (w / w) of one or more of the replicon RNAs described herein. In addition to the replicon RNA component, the pharmaceutical compositions of this disclosure may also contain one or more other pharmaceutically active agents. It is also contemplated that controlled-release or sustained-release replicon RNA formulations may be prepared using known dosage forms and techniques.
[0148] Exemplary dosage forms suitable for parenteral administration (e.g., subcutaneous, intradermal, subdermal, intramuscular, intravenous, intraperitoneal, intra-articular, and infusion) include, for example, solutions, suspensions, dispersions, emulsions, etc. They can also be prepared as sterile solid compositions (e.g., lyophilized compositions) that can be dissolved or suspended in a sterile injectable medium just before use. They may contain, for example, suspending agents or dispersants known in the art.
[0149] Treatment
[0150] This disclosure also includes methods for treating a disease or condition or inducing an immune response in a subject in need, the methods comprising administering a pharmaceutical composition comprising any of the replicon RNAs described herein, thereby causing expression of a heterologous gene of interest encoded by said replicon RNA in one or more cells, tissues, or organs of a human subject. In some aspects, the replicon RNA is administered in a therapeutically effective amount. In some embodiments, a therapeutically effective amount includes or is an amount sufficient to cause expression of a heterologous protein encoded by the replicon to prevent, reduce (severity), or eliminate one or more symptoms of the disease or condition. In other embodiments, the methods relate to treating a gene expression disorder in a human subject, optionally wherein said patient lacks endogenous expression of one or more heterologous gene products (e.g., proteins) encoded by the replicon RNAs described herein, or wherein said endogenously expressed proteins are abnormally or dysfunctional.
[0151] In some embodiments, the use of replicon RNA in CAR-based therapies is provided. Thus, a treatment method is provided comprising the step of administering a therapeutically effective amount or number of immune cells, said immune cells containing replicon RNA encoding a chimeric antigen receptor, to a subject in need. In a further embodiment, such treatment is cancer treatment, such as treatment of hematologic malignancies (e.g., ALL, DLBCL, and multiple myeloma) or solid tumor malignancies. In another embodiment, the replicon RNA is used in a treatment method as described in US20240115606.
[0152] In other embodiments, the use of replicon RNA in preventive treatment or vaccination is provided to avoid the occurrence of disease or disease symptoms, reduce the severity of disease or disease symptoms, or slow the progression of disease or disease symptoms. As used herein, the term "vaccination" refers to a treatment method that uses replicon RNA as described herein to induce or enhance an immune response in a subject (receiving treatment) against a heterologous protein encoded by the replicon RNA. Thus, a therapeutically effective amount of replicon RNA used for vaccination includes, or is sufficient to cause expression of a heterologous protein encoded by the replicon to induce an immune response sufficient to prevent, reduce (or otherwise occur the severity of one or more symptoms of a disease or condition) or eliminate one or more symptoms of a disease or condition that would otherwise occur.
[0153] In some embodiments, the disease or condition is caused by a pathogen and / or the condition is an infection by a pathogen. Therefore, in some embodiments, the replicon RNA contains a heterologous gene of interest encoding a pathogen antigen. Antigens suitable for vaccination are considered here, i.e., antigens known in the art to elicit a protective immune response (e.g., neutralizing antigen-specific antibodies and / or T cells), particularly pathogens known to require a robust cellular immune response to prevent infection or reduce the severity of disease caused by infection.
[0154] The term "pathogen" refers to pathogenic biological material that is capable of causing disease in a subject (e.g., a mammal). Pathogens include microorganisms such as bacteria, single-celled eukaryotes (protozoa), fungi, and viruses.
[0155] The terms "antigen," "antigenic peptide," "epitope," and "immunogenic peptide," etc., are used interchangeably and refer to an antigenic determinant in a molecule (such as an antigen), i.e., a portion or fragment of an immunologically active compound that is recognized by the immune system of a subject exposed to the antigen and elicits an antigen-specific immune response. In the context of the vaccination methods described herein, the antigen is derived from the target pathogen, i.e., the pathogen against which the evoked immune response is directed.
[0156] In some implementations, the target pathogen is a virus, such as those selected from the following: coronaviruses, orthomyxoviruses, paramyxoviridae viruses, pneumoviruses, mumps viruses, paramyxoviruses, metapneumoviruses, and morbilliviruses, poxviridae, orthopoxviruses, such as smallpox virus. The following viruses are listed: vera, picornaviruses, enteroviruses, rhinoviruses, heparnaviruses, cardioviruses, foot-and-mouth disease virus, Bunyavirus, Filoviruses, Togaviruses, Flaviviruses, Pestiviruses, Hepadnaviruses, other hepatitis viruses, Rhabdoviruses, Caliciviridae, retroviruses, reoviruses, parvoviruses, herpesviruses, Papovaviruses, and adenoviruses. In a further embodiment, the target virus from which the antigen is derived is a known respiratory virus, such as influenza virus, respiratory syncytial virus, human metapneumovirus, rhinovirus, parainfluenza virus, coronavirus (such as SARS coronavirus (SARS-CoV)), adenovirus, or bocavirus.
[0157] In some embodiments, the targeted pathogen is a selection of bacteria including: Neisseria meningitidis, Streptococcus pneumoniae, Streptococcus pyogenes, Moraxella catarrhalis, Bordetella pertussis, Staphylococcus aureus, Clostridium tetani, Corynebacterium diphtheriae, Haemophilus influenzae, Pseudomonas aeruginosa, Streptococcus agalactiae, Chlamydia trachomatis, Chlamydia pneumoniae, Helicobacter pylori, and Escherichia coli. *Clostridium perfringens*, *Bacillus anthracis*, *Yersinia pestis*, *Staphylococcus epidermis*, *Clostridium perfringens* or *Clostridium botulinum*, *Legionella pneumophila*, *Coxiella burnetiid*, *Brucella*, *Francisella*, *Neisseria gonorrhoeae*, *Treponema pallidum*, *Haemophilus ducreyi*, *Enterococcus faecalis* or *Enterococcus faecium*, *Staphylococcus saprophyticus*, *Yersinia enterocolitica* enterocolitica), Mycobacterium tuberculosis, Rickettsia, Listeria monocytogenesThe bacteria listed include monocytogenes, Vibrio cholerae, Salmonella typhi, Borrelia burgdorferi, Porphyromonas gingivalis, and Klebsiella.
[0158] In some embodiments, the target pathogen is a pathogen known to cause sexually transmitted infections (STIs), such as syphilis, gonorrhea, chlamydia, trichomoniasis, hepatitis B, herpes simplex virus (HSV), human immunodeficiency virus (HIV), or human papillomavirus (HPV). In some embodiments, the antigen is a chlamydia antigen, such as that described in WO2014 / 146663 (the antigen described therein is incorporated herein by reference) or a similar antigen.
[0159] In some embodiments, the target pathogen is a pathogenic parasite. In some embodiments, the pathogenic parasite is a parasitic protozoan belonging to a genus selected from the group consisting of: *Plasmodium*, *Toxoplasma*, *Babesia*, *Eimeria*, *Theileria*, *Neospora*, *Sarcocystis*, *Leishmania*, and *Trypanosoma*. In some embodiments, the parasite is a worm, such as a nematode. In some embodiments, the parasitic worm belongs to a genera selected from the following genera: *Ancyclostoma*, *Necator*, *Brugia*, *Wuchereria*, *Loa*, *Mansonella*, *Trichinella*, *Trichuris*, *Ascaris*, *Anisakis*, *Dracunculus*, *Strongy'hides*, *Haemonchus*, *Schistosoma*, and *Fasciola*. In some embodiments, the antigen is selected from migration inhibitory factor (MIF) antigens as described in WO2015 / 144732 (the antigens described therein are incorporated herein by reference).
[0160] In some implementations, the term "subject" refers to vertebrates, particularly mammals. In some implementations, mammals are humans, non-human primates, domesticated animals such as dogs, cats, sheep, cattle, goats, horses, etc., laboratory animals such as mice, rats, rabbits, guinea pigs, etc., and captive animals such as zoo animals.
[0161] In some implementations, the term "subject" also refers to non-mammal vertebrates, such as birds (e.g., domesticated birds, such as chickens, ducks, geese, or turkeys) and fish (e.g., farmed fish).
[0162] In some embodiments, in the vaccination methods described herein, the therapeutically effective amount of replicon RNA is at least 0.1, 0.5, 1, 2, 3, 4, or 5 μg of replicon RNA per dose, and / or up to 30, 20, 15, 10, 9, 8, 7, 6, or 5 μg per dose, for example 0.1 to 10 μg, 0.5 to 10 μg, 1 to 10 μg, about 1 μg, about 2.5 μg, about 5 μg, about 7.5 μg, or about 10 μg, particularly when the subject is a mammal, such as a human or a domesticated animal.
[0163] In some embodiments, the method of vaccination includes step (a) administering a first dose of the replicon RNA and step (b) administering a second dose of the same replicon RNA. In another embodiment, the method further includes step (c) administering a third dose of the same replicon RNA.
[0164] In some embodiments, the interval between steps (a) and (b) and / or between steps (b) and (c) is at least 4 weeks / month, at least 6 weeks, at least 8 weeks / two months, and / or up to 18 months, up to 15 months, up to 12 months / about one year, up to 9 months, up to 6 months, up to 4 months, or up to 3 months. In some embodiments, the interval between steps (a) and (b) is shorter than the interval between steps (b) and (c). The need for steps (b) and / or (c) in the vaccination method and the interval between method steps also depend on the nature of the antigen contained in the heterologous protein expressed by the replicon RNA.
[0165] Adjuvants have been described to support (and sometimes enable) vaccine compositions containing antigens or antigen-generating moieties to achieve robust immune responses against pathogens (see Facciolà A, et al. An Overview of Vaccine Adjuvants: Current Evidence and Future Perspectives. Vaccines(Basel). 2022 May 22;10(5):819). As illustrated in the examples, pharmaceutical compositions containing replicon RNA as described herein, particularly when formulated in lipid nanoparticles as described herein, elicit a broader adaptive immune response (humoral and cellular mediated immune responses) and / or an adaptive immune response at lower doses than corresponding compositions containing mRNA. Thus, replicon RNA administered in the pharmaceutical compositions described herein provides a broad immune response in the absence of any additional adjuvants. Therefore, in some embodiments, compositions containing replicon RNA as described herein for use in vaccination methods do not contain additional adjuvants.
[0166] The invention is further described by way of the following non-limiting embodiments, which illustrate the invention and are not intended to, nor should they be construed as, limiting the scope of this disclosure.
[0167] Example
[0168] Example 1 - saRNA Production
[0169] Construct a plasmid encoding a saRNA construct having the following 5' to 3' sequences: - 5' UTR (SEQ ID NO: 10) or alternatively, 5' UTR (SEQ ID NO: 19), - nsP VEEV wild-type (SEQ ID NO: 3) or containing the A4488G mutation (SEQ ID NO: 4), wherein the A4488G nucleotide substitution results in VEEV nsP3 (I167M) containing an amino acid mutation at position 167, or codon-optimized nsP containing the A4488G mutation (SEQ ID NO: 23), wherein the A4488G nucleotide substitution results in VEEV nsP3 (I167M) containing an amino acid mutation at position 167, or alternative VEEV nsP (SEQ ID NO: 20), or alternative VEEV nsP containing the A4488G mutation (SEQ ID NO: 21), wherein the A4488G nucleotide substitution results in VEEV nsP3 (I167M) containing an amino acid mutation at position 167.
[0170] - Subgenomic UTR (SEQ ID NO: 11), - GOI selected from luciferase (SEQ ID NO: 12), eBFP (SEQ ID NO: 13), HA (SEQ ID NO: 14), or SARS-CoV-2 spike protein (SEQ ID NO: 22). - 3'UTR (SEQ ID NO: 15) and - polyA tail (SEQ ID: 16) or 80A polyA tail (SEQ ID NO: 24), when indicated.
[0171] The plasmid was linearized by digestion with BspQI. The linearized plasmid was used as an IVT template with the HiScribe T7 High-Yield RNA Synthesis Kit (New England Biolabs (NEB)). In the construct containing modified nucleotides, cytosine nucleotides were completely replaced by 5-methylcytosine nucleotides. The template DNA was then digested with Turbo DNAse for 30 minutes (ThermoFisher). The resulting IVT saRNA was then purified using the Monarch RNA Clearance Kit (NEB).
[0172] The constructs used in the experiment are numbered as follows:
[0173] Example 2 - saRNA delivery: Lipofectamine or lipid nanoparticles (LNP)
[0174] To test saRNAs, they were delivered to cells using Lipofectamine or formulated in lipid nanoparticles (LNPs). Lipofectamine transfection was performed as described in Example 3. LNPs were formulated according to the following protocol: saRNAs were complexed in LNPs using Ignite (Precision NanoSystems) with a mixture of 35% ionizable cationic lipids (C12-200 or ((piperazine-1,4-diylbis(ethane-2,1-diyl))bis(azanetriyl))tetra(butane-4,1-diyl)tetra(2-hexyldecanoate) (LNPa) or ((2-(4-(2-((2-butyloctanoyl)oxy)ethyl)piperazine-1-yl)ethyl)azanediyl)bis(butane-4,1-diyl)bis(2-butyloctanoate) (LNPb)); 20% DOPE; 1.5% DMG-PEG2000; and 43.5% cholesterol. If necessary, dialyze the LNP against the buffer solution in Tris-HCl (10 mM, pH 7.4) overnight.
[0175] Example 3 - Bioluminescence and Viability in HeLa or RD Cells
[0176] 10,000 HeLa cells or 25,000 rhabdomyosarcoma (RD) cells were seeded in 96-well plates with clear bottoms and black walls. HeLa cells were grown and seeded in MEM medium supplemented with 10% FBS, 1% penicillin / streptomycin, 1% sodium pyruvate, and 1% MEM NEAA (all from Gibco) and RD cells were grown and seeded in DMEM medium supplemented with 10% FBS and 1% penicillin / streptomycin. After 24 hours, cells were transfected with luciferase-expressing saRNA constructs (constructs 1 and 2) using Lipofectamine MessengerMax (ThermoFisher) at a 1:2 (μg / μl) RNA / lipofectamine ratio (10 ng / well for both HeLa and RD). Transfection occurred in OptiMEM medium. Four hours post-transfection, the OptiMEM containing the saRNA-lipofectamine complex was removed and replaced with 50 μL of growth medium. Luciferase activity and viability were measured at 24 and 48 hours post-transfection using the ONE-Glo + Tox luciferase reporter gene and cell viability assay (Promega). For the "simulated" treatment construct, the same protocol as under RNA was not used, and therefore only lipofectamine was present.
[0177] like Figure 1 and 2 As shown, compared with wild-type nsP3, the I167M mutation in nsP3 did not significantly affect luciferase expression or cell viability in HeLa and RD cells. Therefore, compared with wild-type nsP3 replicon RNA and conventional mRNA, introducing nsP3 mutations into replicon RNA did not significantly reduce the expression of the heterologous gene of interest, nor did it affect cell viability.
[0178] Example 4 - Flow Cytometry Time Process of HeLa Cells
[0179] 50,000 HeLa cells were seeded in 24-well plates (see Protocol 0 for culture medium composition). After 24 hours, cells were transfected with eBFP-expressing saRNA constructs (constructs 3 and 4) (50 ng / well) using optiMEM, Lipofectamine MessengerMax (ThermoFisher), at a 1:2 (μg / μl) RNA-lipofectamine ratio. From day 1 to day 7 post-transfection, cells were dissociated daily with trypsin and washed twice daily with cell staining buffer (PBS + 2% FBS + 5 mM EDTA). Cells were then measured by flow cytometry on a Cytoflex (Beckman Coulter) instrument. eBFP signal was measured using a 450 / 45 BP filter with an APD detector. The median fluorescence intensity (MFI) of all cells and the MFI of eBFP-positive cells were used as readings.
[0180] like Figure 3 As shown, constructs 3 and 4 provide similar eBFP expression profiles. This further supports the conclusion that the mutation at amino acid position 167 of nsP3 in the replicon RNA does not significantly reduce the expression of the gene of interest compared to wild-type nsP3 replicon RNA and regular mRNA.
[0181] Example 5 - RNAseq / Innate Immunity
[0182] 250,000 HeLa cells / well were seeded in 6-well plates. After 24 hours, cells were transfected with saRNA test samples using Lipofectamine MessengerMax (ThermoFisher) (250 ng / well) at a 1:2 RNA:lipofectamine ratio. 24 hours post-transfection, total RNA was isolated using the rNeasy microkit (QIAGEN). RNA was sequenced using the QuantSeq 3' mRNA FWD Kit (Lexogen) and then sequenced on Nextseq500 (Illumina). Fastq files were trimmed using Trimmomatic, and read counts were determined using kallisto and human genome (hg38). Differential expression was determined using DESeq2.
[0183] Figure 4 The results showed that, compared to wild-type nsP3, the mutation at position 167 produced significantly less subgenomic RNA. As explained elsewhere in this paper, high RNA levels are a key factor in the reactivity of RNA therapeutics; therefore, improved safety and tolerability are expected for replicons that produce reduced subgenomic RNA.
[0184] in addition, Figure 5 This study illustrates the difference in transcript expression after transfection with saRNA encoding nsP3 with a mutation at position 167, compared to saRNA encoding wild-type nsP. All transcripts associated with the interferon-α pathway (black dots) are shown to indicate differences in the expression of pro-inflammatory markers of the innate immune response. Figure 5 The results showed that, compared with wild-type saRNAs, the expression levels of nsP3-mutant saRNAs were lower for the vast majority of IFN-α pathway transcripts. Therefore, the nsP3 mutation at position 167 leads to a reduced innate immune response compared to wild-type nsP3.
[0185] Example 6 - In vivo expression
[0186] Eight-week-old SWISS mice (Janvier Labs) were intramuscularly injected (IM) with 4 µg (50 µL) of saRNA formulated in LNP containing C12-200 as an ionizable cationic lipid.
[0187] On days 0, 1, 3, 5, 7, 10, 15, 20, 25 and 30 following administration of samples containing constructs 1 and 2, mice were subcutaneously injected with 200 µL of 15 mg / ml luciferase, and luciferase activity was measured using IVIS (Perkin-Elmer) 10 minutes later.
[0188] Figure 6 This demonstrates the in vivo expression of GOI in the observed constructs, thus confirming the in vitro observation that the nsP3 mutation at position 167 does not affect the overall GOI expression profile compared to wild-type nsP3.
[0189] Example 7 - In vivo adaptive immunity
[0190] Eight-week-old SWISS mice (Janvier) were injected with 2 μg of the saRNA-LNP complex on days 0 and 21. SaRNA constructs 5 and 6, containing HA as the GOI, were tested. 5 μg of conventionally modified mRNA-LNP complex was used as a control. ((2-(4-(2-((2-butyloctanoyl)oxy)ethyl)piperazin-1-yl)ethyl)azanediyl)bis(butane-4,1-diyl)bis(2-butyloctanoate) was used as an ionizable cationic lipid for the RNA-containing LNP formulation. Each group consisted of 6 mice, with one group of constructs sacrificed on day 22 after the first injection and another group sacrificed on day 50 after the first injection.
[0191] IgG antibody concentration
[0192] On day 50, serum antigen-specific total IgG levels were measured by ELISA. Baseline signal was determined by analyzing serum from the five days prior to the first injection. ELISA plates (Anti Mouse Total IgG kit, Thermo Fisher) were coated overnight at 4°C with 100 µL / well of recombinant influenza A H1N1 (A / California / 07 / 2009) hemagglutinin (HA) (Sino Biologicals) at a concentration of 1 µg / mL. The next day, the plates were blocked at 37°C for 1 hour with shaking at 400 RPM using 2x assay buffer from the Anti Mouse total IgG kit (Thermo Fisher). Samples were diluted 1 / 40,000. Standard dilution series were prepared using influenza A H1N1 HA (A / California / 07 / 2009) specific monoclonal antibody (Thermo Fisher, Clone 02), from 3200 ng / µL to 0 ng / µL. After blocking, the sample was incubated at 37°C for 1 hour with shaking at 400 RPM. The detection antibody (Anti MouseTotal IgG kit) was added at a concentration of 0.5x, and the plate was incubated at 37°C for 1 hour with shaking at 400 RPM. Between each step, the plate was washed 3 to 5 times with PBS + 0.05% Tween 20 using a Hydrospeed plate washer (Tecan). 100 µL of TMB was added to each well, and the plate was incubated at room temperature in the dark for 15 minutes. The reaction was terminated by adding 100 µL of 1M H2SO4. The plate was read at 450 nm and 560 nm after shaking for 10 seconds using an Infinite F plexer (Tecan).
[0193] Figure 7 The anti-HA IgG response to saRNA encoding nsP3 with a mutation at position 167 was similar to that of saRNA encoding WT nsP and to conventional mRNA. Therefore, it is concluded that saRNA encoding modified nsP3 with a mutation at position 167 can promote a favorable humoral response (e.g., post-vaccination).
[0194] Spleen cell stimulation
[0195] Cryopreserved spleen cells were thawed and resuspended in RPMI supplemented with 10% FBS, 1% penicillin / streptomycin, and 50 µM β-mercaptoethanol (all from Gibco). 10 6Cells were seeded in 96-well round-bottom plates and incubated overnight at 37°C. Spleen cells were then stimulated with a 0.6 nmol / mL HA peptide pool (Miltenyi) or without stimulation. Two hours post-stimulation, cells were treated with a transport inhibitor mixture (eBioscience). Six hours post-stimulation, cells were washed in CSB and dead cells were stained with FVS620 reactive dye (BD). Next, cells were stained for 20 minutes at 4°C in BD Horizon™ Brilliant Stain Buffer (BD) with an antibody against the following marker: CD8a (APC-H7, BD). Cells were then washed twice with CSB as per the manufacturer's instructions and fixed (Inside Fix; Miltenyi) and permeabilized (Inside Perm; Miltenyi). Next, intracellular cytokines were stained for 20 minutes at 4°C using antibodies against the following markers in BD Horizon™ Brilliant Stain Buffer Plus (BD) and Inside Perm (Miltenyi): CD3 (eFluor450; invitrogen), CD4 (BV605; BioLegend), IL2 (R718; BD), IFNγ (BV786; BD), TNFα (PE; BD), IL17A (AF488; BD), IL4 (PE-Cy7; Invitrogen), and IL10 (BV510; BD). Cells were then washed twice in CSB and analyzed using a Cytoflex flow cytometer (Beckman Coulter).
[0196] Figure 8 and 9 This study demonstrated the generation of T cells expressing CD8+ and CD4+ cytokines after transfection with the saRNA construct, while conventional mRNA failed to induce a robust CD8+ T cell response. Therefore, transfection with saRNA encoding a modified nsP3 with a mutation at position 167 can generate robust cell-mediated immune responses, including CD8+ T-cell responses (e.g., post-vaccination).
[0197] Systemic innate immune response
[0198] Serum levels of IFN-γ, CXCL-1, TNF-α, CCL2, IL-12, CCL5, IL-1β, CXCL10, GM-CSF, IL-10, IFN-β, IFN-α, and IL-6 were measured on days 1 and 22 following saRNA-LNP injection using a murine multiplex ELISA antiviral response assay (Biolegend). Log2 was calculated as the fold change relative to the median cytokine concentrations of construct 5.
[0199] Figure 10 This indicates that the saRNA encoding the I167M mutant nsP3 showed lower serum cytokine levels compared to saRNA encoding WT nsP and conventional mRNA, suggesting an overall favorable trend toward lower reactivity. No cytokines with baseline measurements were observed.
[0200] Cytokine expression in lymph nodes and injection sites - local innate immune response
[0201] On day 22 following saRNA-LNP injection, muscle and lymph nodes were collected for RNA extraction. RT was performed using the QIAGEN Genomics Service. 2 qPCR detection was performed using Profiler PCR Arrays (QIAGEN). PPM03543A and PPM03594C were used to quantify Ifna2 and Ifnb1 transcripts, respectively. PPM35281A, PPM34664A, and PPM03559F were used as internal control genes (normalizers). Log2 of the fold change relative to empty LNP-injected mice (simulated group) was calculated.
[0202] Figure 11 Compared to wild-type saRNA, the I167M mutant saRNA construct showed lower levels of interferon α and β transcripts in lymph nodes and muscle tissue.
[0203] Example 8 - moDC transfection
[0204] Monocytes were isolated from CD14+ positive fractions of human PBMCs using MACS. Monocytes differentiated for 5 days by stimulation with 50 ng / mL IL-4 and 50 ng / mL GM-CSF. On day 5, moDCs were transfected with Lipofectamine MessengerMax (ThermoFisher) (500 ng / well) at an RNA:lipofectamine ratio of 1:1. Twenty-four hours post-transfection, cells were measured by flow cytometry on a Cytoflex (Beckmancoulter). eBFP signal was measured using a 450 / 45 BP filter in combination with an APD detector. Median fluorescence intensity (MFI) of all cells and MFI of eBFP-positive cells were used as readings.
[0205] Figure 13 The results showed that the construct containing the nsP3 mutation (construct 4) was transfected into a higher percentage of human moDCs compared to the parental construct (construct 1). Figure 14 The average fluorescence of moDC transfected with construct 4 was also higher than that of construct 4.
[0206] Example 9 - Innate Immune Combination Construct
[0207] 50,000 HeLa cells / well were seeded in 24-well plates. After 24 hours, cells were either transfected using a mock transfection or with saRNA test samples transfected using Lipofectamine MessengerMax (ThermoFisher) (50 ng / well) at a 1:2 RNA:lipofectamine ratio. Cells were transfected with three parental saRNAs (constructs 1, 7, and 9) and three constructs (constructs 2, 8, and 10) in which the A4488G mutation was introduced into the parental saRNA. Total RNA was isolated using the Monarch Total RNA Miniprep Kit 24 hours post-transfection. Transcript levels were quantified using the Luna Universal One-Step RT-qPCR Kit. Expression levels were normalized using NAA35 primers (F: CTCGTGTGTTACTGACAGTGC, R: TGGTTCACAAGGGGTTCAAAA) and CWC15 primers (F: AAAAGCCACGGTTAGACCAGA, R: GGGTTTCCGCTCAGAATGTTT). The innate response of transfected cells was quantified using IFNB1 primers (F: GTCACTGTGCCTGGACCATAG, R: GTTTCGGAGGTAACCTGTAAGTC), OAS1 primers (F: TGTCCAAGGTGGTAAAGGGTG, R: CCGGCGATTTAACTGATCCTG), and PKR primers (F: ACGCTTTGGGGCTAATTCTTG, R: CCCGTAGGTCTGTGAAAAACTT).
[0208] Figure 15-17 The results showed that, compared to wild-type nsP3, when nsP3 was mutated at position 167, similar levels of interferon signaling were observed in all three constructs containing the nsP3 mutation.
[0209] Example 10 - In vivo adaptive immunity in mice
[0210] Eight-week-old SWISS mice (Janvier) were injected with 3 µg of saRNA-LNP complexes on days 0 and 28. saRNA constructs 11, 12, 13, and 14, containing the SARS-CoV-2 spike protein as the GOI, were tested. saRNA constructs were formulated using ((piperazine-1,4-diylbis(ethane-2,1-diyl))bis(azanetriyl))tetra(butane-4,1-diyl)tetra(2-hexyldecanoate) as an ionizable cationic lipid for the formulation of RNA-containing LNPs. Each group included six mice.
[0211] IgG antibody concentration
[0212] On day 42, serum antigen-specific total IgG levels were determined by ELISA (BM501-1.0, BioMARIC). Baseline signal was determined by analyzing serum from the five days prior to the first injection.
[0213] Figure 18 The study showed an anti-spike IgG response against saRNA encoding nsP3 with a mutation at position 167, similar to that against saRNA encoding WTnsP. Constructs of nsP containing m5C nucleotide modifications or codon optimization also showed similar IgG responses. Therefore, it is concluded that saRNA encoding modified nsP3 with a mutation at position 167 can promote a favorable humoral response (e.g., post-vaccination).
[0214] Spleen cell stimulation
[0215] Cryopreserved spleen cells were thawed and resuspended in RPMI supplemented with 10% FBS, 1% penicillin / streptomycin, and 50 µM β-mercaptoethanol (all from Gibco). 10 6 Cells were seeded in 96-well round-bottom plates and incubated overnight at 37°C. Spleen cells were then stimulated with a spike peptide pool (Miltenyi) or without stimulation. Two hours post-stimulation, cells were treated with a transport inhibitor mixture (eBioscience). Six hours post-stimulation, cells were washed in CSB and dead cells were stained with FVS620 reactive dye (BD). Next, cells were stained for 20 minutes at 4°C in BD Horizon™ Brilliant Stain Buffer (BD) with an antibody against the following marker: CD8a (APC-H7, BD). Cells were then washed twice with CSB as per the manufacturer's instructions and fixed (Inside Fix; Miltenyi) and permeabilized (Inside Perm; Miltenyi). Next, intracellular cytokines were stained for 20 minutes at 4°C using antibodies against the following markers in BDHorizon™ Brilliant Stain Buffer Plus (BD) and Inside Perm (Miltenyi): CD3 (eFluor450; invitrogen), CD4 (BV605; BioLegend), IL2 (R718; BD), IFNγ (BV786; BD), TNFα (PE; BD), IL17A (AF488; BD), IL4 (PE-Cy7; Invitrogen), and IL10 (BV510; BD). Cells were then washed twice in CSB and analyzed using a Cytoflex flow cytometer (Beckman Coulter).
[0216] Figure 19 and 20 The study demonstrated the generation of T cells expressing CD8+ and CD4+ cytokines after transfection with all saRNA constructs. The construct containing modified nsP3 induced similar or higher T cell responses compared to the parental construct. This suggests that transfection with saRNA encoding modified nsP3 with a mutation at position 167 can generate robust cell-mediated immune responses, including CD8+ T-cell responses (e.g., post-vaccination).
[0217] Systemic innate immune response
[0218] Serum levels of IFN-γ, CXCL-1, TNF-α, CCL2, IL-12, CCL5, IL-1β, CXCL10, GM-CSF, IL-10, IFN-β, IFN-α, and IL-6 were determined using a murine multiplex ELISA antiviral response assay (Biolegend) one day after the first saRNA-LNP injection (day 1) and one day after the second saRNA-LNP injection (day 29). Log2 of the fold change in cytokine concentration relative to the median cytokine concentration of construct 11 was calculated. No cytokines with baseline measurements were shown.
[0219] Figure 21 This indicates that the saRNA encoding the I167M mutation nsP3 showed lower serum cytokine levels compared to saRNA encoding WT nsP and conventional mRNA, suggesting an overall favorable trend toward lower reactivity.
[0220] Example 11 - In vivo immunity in pigs
[0221] This swine vaccination trial further demonstrated the use of replicons containing the nsP3 mutation as described herein in vaccination: replicons containing the nsP3 mutation were compared with commercially available mRNA constructs (known as INN raxtozinameran). For appropriate comparison, the antigen-coding GOI of the tested replicons was used to correspond to the antigen-coding sequence of raxtozinameran. In addition to the nsP3-mutated replicons (construct 15), further modified replicons were evaluated.
[0222] The presence of SARS-CoV-2, PHEV, and PRCV antibodies was screened in a total of up to 64 (N) approximately 4-month-old Landrace pigs (32 females / 32 immunized castrated males). Animals were randomly assigned to 8 groups (n=8) and injected with 1000 µL of the drug product or 300 µL of the control solution via IM in the neck region according to a 4-week primary-booster interval. Table 1 lists the groups being tested. The negative control contained only buffer. For reference, the commercially available mRNA vaccine raxtozinameran was used. Each saRNA construct tested contained a mutation in the nsP3 region that resulted in the I167M substitution in the nsP3 protein. The saRNA in group 4 was further modified by 100% substitution of cytosine with 5-methyl-cytosine (m5C). The saRNAs in groups 5 and 6 were further modified by providing a longer poly A tail (80A). Each saRNA construct was formulated in an LNP as described in Example 2 above.
[0223] The pigs were followed up until day 168, at which point they were euthanized. A schematic diagram of the experimental setup is shown below. Figure 22 This includes the injection time, the time of blood sampling for humoral, cell-mediated, and innate immune responses, and toxicity. At the time of euthanasia, liver, kidneys, spleen, draining lymph nodes, heart, and muscle tissue from the injection site will also be collected for analysis.
[0224] Table 1
[0225] Humoral immune response readout
[0226] Adaptive humoral immune responses were measured on sera collected on days 7, 0, 14, 21, 28, 42, 49, 56, 70, 84, 91, 98, 112, 140, and 168. Total IgG levels in serum were measured by ELISA. Additionally, a virus neutralization assay (VNT) was performed to quantify neutralizing antibody titers at the same time points as the total antibody response, except on day 7.
[0227] Cellular immune response readout
[0228] Heparinized blood was collected at baseline D0, D28, D42, D56, D70, D84, D98, D112, D140, and D168. PBMCs were isolated to quantify adaptive cell-mediated immune response (CMI) using ELIspot and / or flow cytometry, which should include the following biomarkers: LD-CD3-CD4-CD8a-CD8b-TNFα-IL-2-IFNγ.
[0229] Innate immune response readout
[0230] The innate immune response will be measured on serum samples collected on days 0, 1, 28, and 29. One or more of the following serum cytokines will be analyzed: IFNα, IFNβ, IFNγ, IL-1β, IL-6, IL-10, and TNFα.
[0231] Preliminary toxicity characteristics
[0232] Toxicological biomarkers will be measured in blood samples collected at multiple time points (D0, D28, D35, D98, D168) to predict organ-specific toxicity, with priority given to liver and kidney biomarkers. The following biomarkers may be analyzed, and additional biomarkers may be excluded: Liver: ALT and AST (low specificity and low sensitivity) Kidneys: GFR, urea, creatinine Muscle: Creatine kinase (CK; low specificity and low sensitivity) Histopathological analysis of the collected pig tissues at the time of euthanasia can be performed to further assess the toxicity of specific organs.
[0233] In each replicon RNA treatment group, strong humoral and cell-mediated immune responses were observed after both primary and booster administration, demonstrating that alphavirus nsP3 modification can be successfully used in replicon RNA to generate the desired immune response against the GOI-encoded antigen. This example further illustrates that the nsP3 modification described herein can be used in combination with other modifications to replicon RNA, such as elongating the polyA tail and using modified nucleosides.
[0234] Example 12 - In vivo immunization in pigs
[0235] Given the strong humoral and cell-mediated immune responses observed in Example 11, subsequent trials were initiated in pigs (7 weeks old) using alternative doses of the replicon RNA construct. Replicon treatment groups receiving doses of 1, 5, and 10 µg of construct 15 were compared with the registered mRNA-based vaccine Comirnaty. TM Comparisons were made. In the additional replicon treatment group, a replicon (construct 18) encoding Chlamydia trachomatis MOMP was administered at a dose of 5 µg. The treatment regimen specified primary vaccination on D0, followed by a booster on D28. Blood samples were collected at baseline, after primary immunization, and after booster to assess and characterize humoral, cell-mediated, and innate immune responses, and data on toxicity characteristics (including reactive and / or innate immune responses) were collected.
[0236] Example 13 - In vivo immunization in non-human primates
[0237] The aim of this study was to validate the applicability of replicon RNA in non-human primates and thereby establish connections with data from rodents and pigs (as described above). To this end, the replicon treatment group received initial and booster doses of LNP-formulated construct 15 via IM at doses of 10 µg or 5 µg per dose, administered every 2 months / 56 days. The registered mRNA-based vaccine Comirnaty... TM This will be used as a positive reference. Animal health parameters (e.g., injection site examination, body temperature measurement, etc.) and blood parameters (humoral immunity (including VNT), CMI, innate immunity, and toxicity) will be monitored to demonstrate its use for vaccination purposes against antigens encoded by GOI contained in replicon RNA as described herein.
[0238] sequence list
Claims
1. An alphavirus nonstructural protein 3 (nsP3) containing a single amino acid mutation at amino acid position 167 of wild-type Venezuelan equine encephalitis virus (VEEV) nsP3 corresponding to SEQ ID NO:
1.
2. An alphavirus nsP3 containing, for example, a Met residue other than Ile, Leu, or Val at amino acid position 167, which corresponds to wild-type VEEV nsP3.
3. The alphavirus nsP3 according to claim 1 or 2, wherein the alphavirus nsP3 is VEEV nsP3, wherein the VEEV nsP3 contains a single amino acid mutation at amino acid position 167, optionally containing the I167M mutation.
4. The VEEV nsP3 according to claim 3, wherein the amino acid sequence of the VEEV nsP3 is SEQ ID NO: 2 or SEQ ID NO:
18.
5. A nucleic acid comprising a sequence encoding the alphavirus nsP3 of any one of claims 1 to 4.
6. A replicon RNA comprising sequences encoding alphavirus nonstructural proteins nsP1, nsP2, nsP3 and nsP4, wherein the alphavirus nsP3 is the alphavirus nsP3 of any one of claims 1 to 4.
7. A replicon RNA comprising sequences encoding alphavirus nonstructural proteins nsP1, nsP2, nsP3, and nsP4, said sequences being modified by a mutation at least at nucleotide position 4488, corresponding to the sequence encoding wild-type VEEV nsP1-4 in SEQ ID NO:
3.
8. The replicon RNA according to claim 6 or 7, wherein the sequence encoding nsP 1-4 is derived from an alphavirus selected from VEEV (e.g., TC-83 VEEV or Trinidad donkey virus), Everglades virus, Tonate virus, Mucambo virus, Cabassou virus, Mosso das pedras virus, Rio Negro virus, Pixuna virus, and variants thereof.
9. The replicon RNA according to any one of claims 6 to 8, wherein the sequence encoding alphavirus nsP 1-4 is derived from VEEV, or has at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the wild-type sequence SEQ ID NO:3 encoding VEEV nsP 1-4.
10. The replicon RNA according to claim 9, wherein the nucleotide sequence encoding the sequence of alphavirus nsP 1-4 is SEQ ID NO:
4.
11. The replicon RNA according to any one of claims 6 to 10, further comprising a 5'UTR, one or more heterologous sequences encoding one or more heterologous gene products, and a 3'UTR, wherein each heterologous sequence is operatively linked to one or more subgenomic promoters and / or IRES elements.
12. The replicon RNA of claim 11, wherein one or more of the heterologous sequences encode a heterologous protein, such as a heterologous antigen protein.
13. A method for expressing one or more heterologous gene products in cells, the method comprising: Introduce the replicon RNA of any one of claims 6 to 12 into the cell; And express in the cells one or more heterologous gene products encoded by the replicon RNA.
14. A cell comprising the replicon RNA of any one of claims 6 to 12, wherein the cell is optionally a mammalian cell, such as a human cell.
15. A nanoparticle comprising the replicon RNA of any one of claims 6 to 12, wherein the nanoparticle is optionally a lipid nanoparticle.
16. A pharmaceutical composition comprising: a replicon RNA of any one of claims 6 to 12 or a nanoparticle of claim 15, and at least one carrier, optionally wherein the pharmaceutical composition comprises one or more nanoparticles containing the replicon RNA.
17. A pharmaceutical composition comprising the cells of claim 14 and at least one carrier.
18. The pharmaceutical composition according to claim 16 or 17, wherein the replicon RNA encodes a heterologous protein, such as a heterologous protein for treatment or vaccination.
19. A method for administering a vaccine to a subject, comprising the following steps: Administering a therapeutically effective amount of the pharmaceutical composition of claim 16, comprising the replicon RNA of claim 12, to a subject in need, thereby inducing expression of the heterologous protein and an immune response in the subject, wherein optionally the therapeutically effective amount is 1 to 10 μg per dose.