New target for prevention and treatment of cryptococcus neoformans brain infection PDE4B

By targeting phosphodiesterase PDE4B, the PDE4B agonist MR-L2 was used to prevent and treat cryptococcal meningoencephalitis neonate, solving the problem of the lack of effective measures in the existing technology and achieving the effect of significantly reducing brain infection and prolonging survival time.

CN122326565APending Publication Date: 2026-07-03NANJING MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610268568.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-06
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

Currently, there are no effective measures for the prevention and treatment of cryptococcal meningoencephalitis neonate. Existing antifungal drugs have side effects such as high hepatotoxicity and fungal resistance, and new prevention and treatment methods are urgently needed.

Method used

Using phosphodiesterase PDE4B as the target and the PDE4B agonist MR-L2 as the drug, cryptococcal meningoencephalitis was prevented and treated by inhibiting or activating PDE4B. The efficacy was verified using in vitro BBB and mouse models.

Benefits of technology

The PDE4B agonist MR-L2 significantly reduced Cryptococcus neoformans brain infection, providing an effective prevention and treatment method and prolonging the survival time of infected mice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122326565A_ABST
    Figure CN122326565A_ABST
Patent Text Reader

Abstract

This invention provides a novel target PDE4B for the prevention and treatment of Cryptococcus neoformans brain infection. Specifically, it relates to the application of drugs targeting phosphodiesterase PDE4B in the preparation of drugs for the prevention and / or treatment of Cryptococcus neoformans meningoencephalitis. The drug targeting PDE4B is the PDE4B agonist MR-L2 (CAS: 2374703-19-0). The PDE4B agonist MR-L2 described in this invention can significantly reduce Cryptococcus neoformans brain infection, providing an effective prevention and treatment method for Cryptococcus neoformans meningoencephalitis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a novel target PDE4B for the prevention and treatment of Cryptococcus neoformans brain infection. Background Technology

[0002] Fungi are an important class of medical microorganisms, with an estimated 300 million people worldwide infected and 1.5 million deaths annually. In 2022, the World Health Organization (WHO) published a list of pathogenic fungi, with Cryptococcus neoformans (Cn) ranking first among key priority pathogenic fungi. Cryptococcus neoformans is an opportunistic pathogen. Inhaled, it generally causes asymptomatic infection; a small number of patients may present with pulmonary cryptococcosis, or the fungus may be released into the bloodstream, causing fungemia. Bloodborne Cryptococcus neoformans can cross the blood-brain barrier (BBB), causing fatal meningoencephalitis. According to the latest global burden of disease estimates, there are 150,000 cases of cryptococcal meningoencephalitis annually, with over 110,000 deaths each year; the mortality rate is as high as 40-60%. Currently, there are no effective preventive measures for cryptococcal meningoencephalitis. General preventive measures include treating the underlying disease and correcting immunodeficiency or immunosuppression. Current antifungal drugs have side effects such as high liver toxicity and fungal resistance after long-term use.

[0003] Therefore, it is urgent to conduct in-depth research on the pathogenesis of cryptococcal meningoencephalitis and to develop prevention and control strategies, and to provide effective prevention and control measures. Summary of the Invention

[0004] To address the limitations of existing technologies, this invention provides a novel target, PDE4B, for the prevention and treatment of cryptococcal meningoencephalitis.

[0005] The technical solution of this invention is as follows: Application of drugs targeting phosphodiesterase PDE4B in the preparation of drugs for the prevention and / or treatment of cryptococcal meningoencephalitis neonate.

[0006] Furthermore, the drug that targets phosphodiesterase PDE4B is a phosphodiesterase PDE4B agonist.

[0007] Furthermore, the drug that targets phosphodiesterase PDE4B is the PDE4B agonist MR-L2.

[0008] Furthermore, the MR-L2 is a compound with CAS number 2374703-19-0, and its structural formula is: .

[0009] Furthermore, the drug that targets phosphodiesterase PDE4B also contains pharmaceutically acceptable excipients.

[0010] The advantages of this invention over existing technologies are as follows: This invention analyzed macrophages in the central nervous system using scRNA-Seq and found that PDE4B is a key target regulating the macrophage-mediated development of Cryptococcus neoformans meningoencephalitis (CNP) caused by Cryptococcus neoformans infection. In both in vitro BBB and Cryptococcus neoformans meningoencephalitis mouse models, administration of PDE4B inhibitors or PDE4B knockout exacerbated brain infection. Consistent with this, the PDE4B agonist MR-L2 significantly reduced Cryptococcus neoformans brain infection, providing an effective preventative measure against Cryptococcus neoformans meningoencephalitis. Attached Figure Description

[0011] Figure 1 scRNA-Seq analysis revealed heterogeneity of CD45+ infiltrating cells in brain tissue following Cryptococcus neoformans infection, including: (A) Cryptococcus neoformans was inoculated via the tail vein to prepare a single-cell suspension of brain tissue. CD45+ cells were sorted by flow cytometry and detected by scRNA-Seq. (B) UMAP dimensionality reduction analysis showed that the infiltrating white blood cells in the brain tissue were mainly myeloid cells (monocytes / macrophages and neutrophils) and lymphoid cells (T / NK lymphocytes, B lymphocytes, etc.). (C) Analysis of the distribution of fungal RNA in various cell types revealed that monocytes / macrophages had the highest correlation with fungi. (D) Classical markers of various cell types, such as the characteristic expression of Cd68 and Adgre1 in monocytes / macrophages. (E) Frozen sections of brain tissue showed the presence of fungi within macrophages.

[0012] Figure 2 scRNA-Seq analysis of Trojan cell-related genes, including: (A) Using the WGCNA algorithm, the correlation coefficient (PersonCoefficient) between any two genes was calculated, and a hierarchical clustering tree between genes was constructed based on this. Based on the weighted correlation coefficient of genes, genes were classified according to their expression patterns, and genes with similar patterns were grouped into one module, thus dividing the 14,680 genes obtained from sequencing into 23 modules. (B) We then performed a correlation analysis between the obtained modules and fungal RNA (CNAG index), and found that the green module had the highest correlation with the CNAG index, suggesting that the information of the green module may be related to fungal entry into Trojan cells. (C) Examples of green module genes, including Pde4b, Cxcr4, etc.

[0013] Figure 3 Cryptococcus neoformans regulates PDE4b expression in macrophages, including: (AC) qPCR validation of PDE4a, PDE4b, and PDE4d expression levels in BMDM cells 6 hours after Cryptococcus infection; (D) Western blot analysis of PDE4B expression in H99-treated RAW264.7 cells; (E) Western blot analysis of PDE4B expression in H99-treated BMDM cells; (F) Western blot analysis of PDE4B expression in BMDM cells treated with CAP59 and H99, respectively; (G) Western blot analysis of PDE4B expression in BMDM cells treated with HKC (heat inactivated at 60℃ for 30 minutes) and H99, respectively; (H) Schematic diagram of colonies of H99 and Cryptococcus with strong melanin expression (M-H99); (I) Western blot analysis of PDE4B expression in BMDM cells treated with M-H99 and H99, respectively; Data are expressed as mean ± standard error (SEM); **P<0.01, ****P<0.0001; Independent samples t-test was used; ns indicates no significant difference.

[0014] Figure 4 PDE4b inhibitors promote macrophage differentiation and migration, among which: (AC) qPCR was used to verify the expression levels of Arg1 and NOS2 in BMDM after 24 hours of treatment with Rolipram or Nerandomilast; Rolipram: a PDE4 inhibitor; Nerandomilast: a PDE4b inhibitor; (D) Flow cytometry was used to detect Arg1 expression in BMDM after Rolipram treatment. + A representative diagram of macrophage gating strategies; (E) Arg1 + Percentage of cells in macrophages; (F) Flow cytometry analysis of F4 / 80 cells after Rolipram treatment with BMDM. + CCR2 + A representative diagram of macrophage gating strategies; (G)F4 / 80 + CCR2 + Percentage of cells in total cells; (H) qPCR verification of CCR2 expression level in BMDM after 24 hours of Nerandomilast treatment; (I) CCR7 expression level in BMDM after Rolipram treatment. + A representative diagram of macrophage gating strategies; (J) CCR7 + Percentage of cells in macrophages; (KL) qPCR verification of CCR7 expression levels in BMDM after 24 hours of treatment with Rolipram and Nerandomilast; (M) Flow cytometry detection of CXCR4 after Rolipram treatment of BMDM. + A representative diagram of macrophage gating strategies; (N)CXCR4+ Percentage of cells in macrophages; (OP) qPCR verification of CXCR4 expression level in BMDM after 24 hours of treatment with Rolipram and Nerandomilast; (QS) qPCR detection of Arg1, CCR7 and CXCR4 expression levels in BMDM after 24 hours of Nerandomilast treatment and PKA inhibition; Data are expressed as mean ± standard error (SEM); *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; Independent samples t-test was used; ns indicates no significant difference.

[0015] Figure 5 PDE4B inhibitors promote Cryptococcus trojans' crossing of the BBB, among which: (A) Fungal colony counts were performed after stimulating BMDM cells with different concentrations of Rolipram to rule out the drug's bactericidal ability; (B) RAW264.7 cells were treated with Rolipram (40 μM) for 3 hours, and the culture medium was mixed by pipetting and fungal colony counts were performed to detect the killing effect; (C) RAW264.7 cells were treated with Rolipram (40 μM) for 3 hours, and after rinsing away free bacteria, fungal colony counts were performed to detect phagocytosis; (D) Schematic diagram of the in vitro BBB model; (E) Confocal imaging at F4 / 80. + Macrophages engulf fluorescent fungus H99 Tdtomato Representative images; Original magnification: 800×; Scale bar: 5μm; (FI) After processing BMDM with Rolipram or Nerandomilast respectively, count and statistically analyze the number of bacteria invading the lower chamber of the Transwell; (GJL) Statistically analyze H99 bacteria invading the lower surface of the Transwell chamber as captured by confocal imaging. Tdtomato Number (n=4 / group, each point represents 3-4 fields of view); (HKM) confocal imaging of H99 invasive to the subventricular surface in the Transwell in vitro BBB model in different treatment groups. Tdtomato Representative figures; original magnification: 200×; scale bar: 20 μm; data are expressed as mean ± standard error (SEM); *P<0.05, **P<0.01, ****P<0.0001; independent samples t-test was used for comparisons between two groups, and one-way ANOVA was used for comparisons of more than two groups; ns indicates no significant difference.

[0016] Figure 6 PDE4B deficiency promotes the exacerbation of cryptococcal infection in brain tissue through the Trojan cell pathway, including: (AB) Compared with the Vehicle group, mice injected intraperitoneally with Rolipram and Nerandomilast showed increased fungal load in brain tissue; (C) PDE4b was stimulated with H99. - / - Three hours after BMDM in mice, the killing ability of macrophages against fungi was detected by fungal colony counting; (D) PDE4b was stimulated with H99. - / - After 3 hours of BMDM, free bacteria were rinsed off, and the phagocytic capacity of macrophages was tested; (E) The number of H99 cells phagocytosed and invaded the lower luminal surface of the Transwell chamber was statistically analyzed using confocal imaging. Tdtomato The number of macrophages (n=4 / group, each point represents 3-4 fields of view); (F) Confocal imaging of representative images of macrophages invading the subventricular surface of the Transwell in vitro BBB model (green: F4 / 80+ macrophages; red: H99). Tdtomato DAPI: cell nucleus; Original magnification: 200×; Scale bar: 20μm; (GH)PDE4b + / - and PDE4b - / - In mice infected with Cryptococcus neoformans, the fungal load in the brain tissue was increased (n=5 / group); (I) 24 hours after mice were injected intraperitoneally with Clodronate Liposomes to clear macrophages, they were infected with H99 (5×10⁻⁶) via the tail vein. 5 After 48 hours, mice were sacrificed, and brain tissue was digested into a single-cell suspension for flow cytometry analysis; F4 / 80 + CD11b + In the representative gating strategy diagram of macrophages, macrophages in peripheral blood were basically cleared; (JK) After treatment similar to Figure I, the fungal load in the brain tissue of PDE4bKO mice was significantly reduced in the spleen and brain tissue after the removal of peripheral macrophages (n=4 / group); (L) Flowchart of macrophage adoptive transfer; (M) As shown in Figure L, 48 hours after adoptive transfer, mice were sacrificed and brains were harvested. The proportion of different colored fluorescent tags H99 infiltrating the brain tissue was detected by flow cytometry and a percentage bar chart was plotted (n=4 / group); This data was analyzed using two-way ANOVA and multiple comparisons were performed using the Sidak post-hoc test; Data are expressed as mean ± standard error (SEM); *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; Independent samples t-test was used for comparisons between two groups, and one-way ANOVA was used for comparisons of more than two groups; ns indicates no significant difference.

[0017] Figure 7 Activation of PDE4B can improve cryptococcal infection in the brain, including: (A) Flowchart of animal experiments; (B) After MR-L2 stimulated PDE4b levels in vivo, the fungal load in brain tissue was significantly reduced (n=5 / group); (C) MR-L2 significantly prolonged the survival of mice after Cryptococcus neoformans infection; ***P<0.001; Independent samples t-test was used. Detailed Implementation

[0018] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.

[0019] Example 1: scRNA-Seq analysis of brain tissue leukocytes during Cryptococcus neoformans infection (corresponding to...) Figure 1 AD) Cell preparation for single-cell sequencing: 6-8 week old WT mice were injected via tail vein with 1×10 5 CFUH99Tdtomato bacterial suspension (resuspended in 100 μl PBS) was used to euthanize mice 6 hours after infection. Free cells in the blood vessels were thoroughly removed by cardiac perfusion with saline. Brain tissue was dissected and mechanically minced combined with enzymatic digestion to prepare a single-cell suspension. The suspension was filtered through a 70 μm cell sieve and centrifuged using a Percoll density gradient to obtain the cells. Subsequently, flow cytometry was used to sort leukocytes (CD45+) that had not phagocytosed Cryptococcus neoformans. + Tdtomato - ) and leukocytes (CD45) that have already engulfed Cryptococcus neoformans. + Tdtomato + The H99Tdtomato strain was used for single-cell sequencing. The H99Tdtomato strain is a standard Cryptococcus neoformans strain expressing the tdTomato fluorescent protein.

[0020] 1. Single-cell sequencing (1) After the cell suspension is injected into the SCOPE-chip microfluidic chip, under the influence of gravity, individual cells will randomly fall into the pre-set microwells in the chip, ensuring that only one cell is captured in each microwell. Subsequently, millions of magnetic beads carrying specific cell barcodes and molecular markers (UMIs) are added to these microwells. By optimizing the experimental design, it is ensured that only one magnetic bead coexists with a single cell in each microwell.

[0021] (2) After cell lysis inside the chip, the released mRNA can bind to the oligo-dT sequence on the surface of the magnetic beads through its poly(A) tail, thereby effectively capturing the mRNA and labeling it with cell origin information (CellBarcode) and molecular identity information (UMI) in the process. Then, the magnetic beads in the chip are recovered, and the captured mRNA is converted into cDNA using reverse transcription, followed by PCR amplification.

[0022] (3) The amplified cDNA needs to be further fragmented and adapter sequences and other necessary modifications are added to construct a library suitable for the Illumina sequencing platform. Finally, the constructed sequencing library is loaded into the Illumina high-throughput sequencing system to achieve gene expression analysis at the single-cell level, thereby obtaining cellular transcriptome data.

[0023] 2. Sequencing Results Data Analysis (1) After normalizing and dimensionality reduction analysis of the sequencing results, the UMAP algorithm was used for two-dimensional visualization. Cluster analysis was performed on the transcriptome data based on known marker genes and literature data.

[0024] (2) Cryptococcus neoformans-specific gene sequences were retrieved from single-cell transcriptome data, and the distribution of fungal RNA in different cell types was analyzed.

[0025] (3) Differential gene expression analysis was performed on the cell populations in which fungal RNA was detected, and the expression of macrophage marker genes such as CD68, Adgre1, and Lyz2 was detected.

[0026] We learned from infection with Cryptococcus neoformans H99 Tdtomato CD45 was isolated from mouse brain tissue + Cells were analyzed using single-cell RNA sequencing (scRNA-Seq). Figure 1 A). UMAP dimensionality reduction analysis was used to map the infiltrating leukocytes in the brain tissue following Cryptococcus neoformans infection. Figure 1 B). The results showed that fungal RNA was mainly enriched in cell populations that highly expressed monocyte / macrophage-specific genes, specifically marker genes such as CD68, Adgre1, and Lyz2. Figure 1 CD).

[0027] Example 2: Immunofluorescence staining for detecting fungal phagocytosis in brain tissue 1. Establishment of a mouse infection model Six- to eight-week-old C57 mice were injected with Cryptococcus neoformans via the tail vein. The mice were euthanized 48 hours after infection for tissue collection.

[0028] 2. Mouse tissue sampling (1) Cardiac perfusion 1) Mice were anesthetized by intraperitoneal injection of sodium pentobarbital to ensure that they were in a state of deep anesthesia; 2) Place the anesthetized mouse on the operating table and fix its limbs. Use sterile scissors to make a longitudinal incision along the mouse's sternum to open the chest cavity and expose the heart. 3) Using sterile scissors, cut open the right atrial appendage of the heart and shorten the inferior vena cava. Insert a syringe into the apex of the heart and inject PBS into the mouse heart to slowly remove residual blood until the perfusion fluid flows out from the heart and other parts.

[0029] (2) Mouse brain tissue sampling 1) Depending on the experimental requirements, isolate the lungs and spleen of the mice and place them in a suitable solution or container for later use; 2) Fix the mouse in a prone position on the operating table, cut open the skin on the head, separate the skull, and carefully remove the brain tissue of the mouse with forceps. Place it in a suitable solution or container for later use, depending on the experimental purpose.

[0030] 3. Preparation of paraffin sections of brain tissue 1) Dehydration: After cleaning, the brain tissue was placed in 70%, 80%, 95%, and 100% ethanol in sequence for dehydration.

[0031] 2) Transparent: Soak in xylene for 30 minutes each time, repeat twice.

[0032] 3) Paraffin embedding: The tissue was immersed in melted paraffin at about 60 °C for 1 hour, and this was repeated twice. After the paraffin solidified, it was cut into thin sections with a thickness of 3-5 μm.

[0033] 4) Drying: Dry the cut slices at 60℃.

[0034] 5) Dewaxing and rehydration: After dewaxing the slide in xylene, it is then sequentially rehydrated in 100%, 95%, 80%, and 70% alcohol and rinsed before use.

[0035] 4. Immunofluorescence staining 1) Take 4 μm thick slices from paraffin-embedded brain tissue, lay them flat on a glass slide, and perform dewaxing and rehydration treatment. Finally, rinse the glass slide with distilled water.

[0036] 2) Use citric acid repair solution to perform antigen repair at a high temperature of 100 ℃.

[0037] 3) Block endogenous peroxidase in brain tissue with 3% hydrogen peroxide, incubate at room temperature in the dark for 25 minutes, and wash three times with PBS.

[0038] 4) Shake off the PBS and block with 3% BSA at room temperature for 30 minutes.

[0039] 5) Remove the blocking solution, add the first primary antibody solution (rabbit anti-mouse F4 / 80 antibody), and incubate overnight at 4 °C.

[0040] 6) After washing, add HRP-labeled goat anti-rabbit IgG and incubate at room temperature for 1 hour.

[0041] 7) To enhance the signal of HRP-labeled secondary antibody and improve detection sensitivity, add TSA, incubate at room temperature in the dark for 10 minutes, and then wash.

[0042] 8) Further repair treatment of antigens in tissues, i.e., microwave heating the slides in citric acid antigen repair solution.

[0043] 9) Add the second primary antibody, rabbit anti-mouse CD45 antibody, and incubate overnight at 4 °C in the dark.

[0044] 10) After washing, add CY5-labeled goat anti-rabbit IgG and incubate at room temperature for 1 hour.

[0045] 11) After cleaning, add DAPI to cover the tissue area and incubate at room temperature in the dark for 10 minutes.

[0046] 12) After washing, add anti-fluorescence quenching mounting medium and seal the slide.

[0047] 13) Microscopic observation results.

[0048] The results showed that CD45 was present in the brain tissue of cryptococcal-infected mice. + F4 / 80 + The cells were able to engulf fluorescently labeled Cryptococcus, and CD45 + F4 / 80 - This phenomenon was not observed in cells, suggesting that monocytes / macrophages are closely related to the early infection process of fungi. Figure 1 E), suggesting that monocytes / macrophages may act as Trojan horses in Cryptococcus neoformans brain infection.

[0049] Example 3: Analysis of Trojan cell-related genes using scRNA-Seq (1) The weighted gene co-expression network analysis (WGCNA) algorithm was applied to classify genes according to their expression patterns based on the weighted correlation coefficients of the genes. Genes with similar patterns were grouped into one module, thus dividing the 14,680 genes obtained from sequencing into 23 modules.

[0050] (2) The correlation between these modules and fungal RNA (CNAG index) was analyzed.

[0051] (3) Analyze the core genes in the inner circle of this module, including Pde4B, Sema4d, Clec4e and Gbp3.

[0052] Based on the single-cell sequencing results, the 14,680 genes obtained from sequencing were divided into 23 modules ( Figure 2 A); and the correlation between these modules and fungal RNA (CNAG index) was analyzed. The results showed that the green module had the highest correlation with fungi ( Figure 2 B). Analysis of the core genes in the inner circle of this module, including Pde4B, Sema4d, Clec4e, and Gbp3, suggests that these genes may be closely related to fungal entry into Trojan cells, Trojan cell differentiation, and the fungal invasion process. Figure 2 C). Among these core genes, PDE4B is a preferred target for further research due to its importance in regulating macrophage function and immune responses.

[0053] Example 4: Flow cytometry analysis of PDE4B expression levels in macrophages of mouse brain tissue infected with Cryptococcus neoformans. 1. Establishment of a mouse infection model Same as Example 2

[0054] 2. Mouse tissue sampling Same as Example 2

[0055] 3. Flow cytometry experiment (1) Preparation of single-cell suspension from mouse tissue 1) After cutting and removing the mouse brain tissue with surgical scissors, place it in the pre-prepared digestive solution (preparation ratio: 5ml 1640 culture medium + 50 μl 100 mg / ml collagenase IV + 3.5 μl 5mg / ml DNase I), and digest it in a shaker at 37 ℃ for 30 minutes at 90 rpm.

[0056] 2) After digestion, repeatedly blow away the cells, add 5 ml of PBS to stop digestion, then pass the cells through a 70 μm cell sieve and rinse the filter with 5 ml of PBS to remove any remaining cells.

[0057] 3) After centrifugation, add erythrocyte lysis buffer to resuspend the cells and perform erythrocyte lysis. Stop the lysis with PBS after 2 minutes.

[0058] 4) After centrifugation, resuspend the cells in PBS, count the cells, and take 1×106 cells from each tube and resuspend them in 100 μl PBS for subsequent experimental procedures.

[0059] (2) Flow cytometry labeling and staining 1) Set up blank tubes, single-stained tubes, control tubes, and sample tubes according to the experimental purpose and staining protocol, so as to facilitate voltage adjustment and compensation during subsequent flow cytometry.

[0060] 2) L / D staining: Add 1 μl of diluted live / dead dye to the corresponding single staining tube, control tube and sample tube respectively, and stain at room temperature for 30 minutes; 3) Fc blocking: Add 1 ml of flow cytometry buffer to all tubes, wash twice and resuspend, add 0.5 μl of CD16 / 32 antibody, mix thoroughly and incubate at room temperature in the dark for 15 minutes.

[0061] 4) Extracellular staining: Add the corresponding extracellular marker to each single staining tube and sample tube according to the antibody instructions, and incubate at 4 ℃ in the dark for 1 hour.

[0062] 5) Membrane disruption and fixation: After washing twice with 1 ml of flow cytometry buffer in each tube, prepare the membrane disruption and fixation solution according to the instructions and disrupt the membrane at 4 ℃ in the dark for 1 hour.

[0063] 6) Intracellular staining: Add 1 ml of the cell permeabilization wash buffer to each tube, wash twice, and then resuspend in 100 μl of the wash buffer. Add the required intracellular marker and incubate at 4 °C in the dark for 1 hour. If the intracellular marker is an indirect marker, the corresponding fluorescent secondary antibody should be added after cell washing, and the cells should be stained at room temperature for 1 hour.

[0064] 7) Detection on the instrument: Wash twice with the last 1 ml of membrane rupture wash buffer, resuspend in 200–300 μl of flow cytometry buffer and detect on the instrument.

[0065] The results showed that, compared with macrophages that did not phagocytose cryptococci (F4 / 80) + Tdtomato - Compared to macrophages that engulf fungi (F4 / 80) + Tdtomato + PDE4B expression levels mainly exhibited a bipolar pattern of strong positive and negative, while the number of cells with weak PDE4B positivity was significantly reduced. Figure 2 The expression levels of PDE4B differed significantly between the two cell populations, suggesting that PDE4B may be involved in the transport of fungi across the blood-brain barrier by Trojan cells.

[0066] Example 5: qPCR verification of the expression levels of PDE4A, PDE4B and PDE4D in BMDM 6 hours after Cryptococcus infection.

[0067] 1. Cell culture and infection (1) Primary macrophage BMDM culture: After euthanasia of mice, the femur and tibia were isolated. Under aseptic conditions, the two ends of the bones were cut open, and the bone marrow cavity was rinsed with sterile PBS. Bone marrow cells were then flushed into centrifuge tubes and filtered through a 70 μm cell filter. After centrifugation, the supernatant was discarded, and the cells were treated with erythrocyte lysis buffer to remove erythrocytes. Subsequently, the extracted cells were resuspended in DMEM complete medium containing 20 ng / mL macrophage colony-stimulating factor. During the culture process, half of the medium was replaced on day 3, and the entire medium was replaced on day 6. Cells were harvested on day 7 for subsequent experiments.

[0068] (2) Cell line culture: RAW264.7 cells (mouse mononuclear macrophage cells) were purchased from the ATCC cell bank and cultured in DMEM complete medium.

[0069] (3) Cryptococcus neoformans culture: 1) Remove the strain from liquid nitrogen and inoculate it into a fungal liquid culture medium. Incubate on a shaker (200 rpm, 30 °C) for 16-22 hours until the cells enter the stable growth phase for activation. Then, use an inoculation loop to inoculate the fungus onto the surface of Sabouraud dextrose agar medium and incubate at 30 °C until single colonies grow. After obtaining single colonies, pick one colony and transfer it to dextrose liquid medium. Repeat the activation steps to allow the fungus to grow stably.

[0070] 2) Use and handling of fungi: In in vivo or in vitro experiments, yeast cells are washed twice with sterile phosphate-buffered saline (PBS) and then diluted to the required concentration according to experimental needs.

[0071] 3) Infection: The infection multiplicity is 5. RNA is extracted 6 hours after infection, following the steps below.

[0072] 2. qPCR experiment (1) RNA extraction 1) Transfer the lysed sample to FastPure gDNA-Filter Columns III (FastPure gDNA-Filter Columns III is already in the collection tube), and centrifuge at 12,000 rpm (13,400 × g) for 30 sec. Discard FastPure gDNA-Filter Columns III and collect the filtrate.

[0073] 2) Add 0.5 times the volume of anhydrous ethanol to the filtrate (for liver tissue samples, add 1 times the volume of 50% ethanol) and mix thoroughly.

[0074] 3) Transfer all the mixture from step 2 to FastPure RNA Columns III (FastPure RNA Columns III has been placed in the collection tube), centrifuge at 12,000 rpm (13,400 × g) for 30 sec, and discard the filtrate.

[0075] 4) Add 700 μl of Buffer RW1 to FastPure RNA Columns Ⅲ, centrifuge at 12,000 rpm (13,400× g) for 30 sec, and discard the filtrate.

[0076] 5) Add 700 μl of Buffer RW2 (with anhydrous ethanol added) to FastPure RNA Columns Ⅲ, centrifuge at 12,000 rpm (13,400 × g) for 30 sec, and discard the filtrate.

[0077] 6) Add 500 μl of Buffer RW2 (with anhydrous ethanol added) to FastPure RNA Columns Ⅲ, centrifuge at 12,000 rpm (13,400 × g) for 2 min, and carefully remove the adsorption column from the collection tube to avoid contact with the filtrate and contamination.

[0078] 7) (Optional) If there is liquid residue on the adsorption column or if it comes into contact with the filtrate, discard the filtrate, put the FastPure RNA Columns III back into the collection tube, and centrifuge at 12,000 rpm (13,400 × g) for 1 min to prevent ethanol contamination.

[0079] 8) Carefully transfer the adsorption column to a new RNase-free Collection Tubes 1.5 ml centrifuge tube, add 50-200 μl of RNase-free ddH2O to the center of the adsorption column, let stand at room temperature for 1 min, centrifuge at 12,000 rpm (13,400 × g) for 1 min to elute RNA.

[0080] 9) The extracted total RNA can be used directly in downstream experiments or stored at -85 ~ -65℃.

[0081] (2) Reverse transcription 1) The reaction system is as follows: 2) The reaction procedure is as follows: The cDNA obtained after the reaction can be further used for qPCR detection or stored at -80 °C for later use.

[0082] (3) qPCR 1) Reaction system 10 μl: three replicates per sample.

[0083] 2) Reaction conditions: Phase 1: 95 °C, 30 seconds; Phase 2: 95 °C, 10 seconds; 60 °C, 34 seconds; repeat 40 times.

[0084] Phase 3: 95 °C, 10 seconds; 65 °C, 5 seconds; 95 °C, 10 seconds.

[0085] 3) The relative expression level of the target gene is represented by 2. -ΔΔCt Calculation by method.

[0086] Primer sequences used in the experiment were referenced from PrimerBank (https: / / pga.mgh.harvard.edu / primerbank). All primers were synthesized by Shanghai Sangon Biotech Co., Ltd. The primer sequences used in the experiment are as follows: Gene name sequence mouse PDE4B upstream primer TTCACGGTGGCTCATACATGC mouse PDE4B downstream primer CGCTGTCAAGATCGTAGAGGAA mouse PDE4A upstream primer GAACCGGGAACTCACACACC mouse PDE4A downstream primer GTACTCTGAGACCTGGTTTCCT mouse PDE4D upstream primer AACACTGCACTCCTGTAATGAAG mouse PDE4D downstream primer TGCTTGTTCCAACTGTCTGAAG mouse Arg1 upstream primer CTCCAAGCCAAAGTCCTTAGAG mouse Arg1 downstream primer AGGAGCTGTCATTAGGGACATC mouse NOS2 upstream primer GTTCTCAGCCCAACAATACAAGA mouse NOS2 downstream primer GTGGACGGGTCGATGTCAC mouse CCR2 upstream primer ATCCACGGCATACTATCAACATC mouse CCR2 downstream primer CAAGGCTCACCATCATCGTAG mouse CCR7 upstream primer GGTAGGTATCCGTCATGGTCTTG mouse CCR7 downstream primer TGTACGAGTCGGTGTGCTTC mouse CXCR4 upstream primer CTTCTGGGCAGTTGATGCCAT mouse CXCR4 downstream primer CTGTTGGTGGCGTGGACAAT mouse β-actin upstream primer GTGACGTTGACATCCGTAAAGA mouse β-actin downstream primer GCCGGACTCATCGTACTCC The results showed that the expression levels of PDE4A and PDE4D decreased, while the expression level of PDE4B was significantly upregulated. Figure 3 AC).

[0087] Example 6: Western blot analysis to verify the protein expression level of PDE4B in RAW264.7 / BMDM cells 12-24 hours after infection with Cryptococcus neoformans H99 / CAP59 / M-H991. 1. Cell culture and infection (1) Cell culture is the same as in Example 5.

[0088] (2) Cryptococcus neoformans culture H99 Tdtomato H99 GFP The culture conditions for strain CAP59 were the same as those for strain H99. The heat-inactivated strain (HKC) was obtained by inactivating strain H99 overnight at 50 °C. The melanized Cryptococcus melanogaster strain (M-H99) was cultured on caffeic acid agar medium containing ferric citrate and levodopa.

[0089] (3) Infection: The infection multiplicity is 10. RNA is extracted 12-24 hours after infection, following the steps in Example 5.

[0090] 2. WB (1) Extraction of total protein 1) Adherent cells: Discard the supernatant in the well plate, wash with PBS, add RIPA strong lysis buffer containing 1% PMSF, and lyse on ice for 10 minutes. Then, repeatedly pipette and collect the cells into EP tubes, sonicate at 20-25 kHz for 5 seconds, and repeat twice.

[0091] 2) After ultrasonic lysis, centrifuge the lysate at 12,000 rpm and 4 °C for 10 minutes. Take the supernatant and add sample loading buffer. Then heat denature it in a metal bath at 100 °C for 10 minutes. After cooling, it can be loaded.

[0092] (2) Preparation of SDS-PAGE adhesive 1) Select an appropriate gel concentration, i.e., 10%, based on the molecular weight of the target protein (PDE4B 70-83 kDa, β-actin 42 kDa).

[0093] 2) Prepare the separating gel according to the table below. Add the components in sequence between the glass plates, and fill the upper layer with deionized water.

[0094] 3) After the separating gel has completely solidified, discard the water on top.

[0095] 4) To prepare a 5% concentration stacking gel, add 4.1 ml deionized water, 1 ml 30% acrylamide, 0.75 ml 1.0 mol / L Tris-HCl (pH 6.8), 0.06 ml 10% SDS, 0.06 ml 10% APS, and 0.006 ml TEMED sequentially. Mix quickly, then pour the mixture onto the separating gel, inserting a comb to prevent air bubbles, until the stacking gel is completely solidified.

[0096] 5) When using, remove the comb and add the sample and marker separately for electrophoresis.

[0097] (3) Electrophoresis 1) Prepare 1× electrophoresis buffer according to the instructions.

[0098] 2) Insert the gel plate into the electrophoresis tank, add 1× electrophoresis buffer, remove the comb, add the protein sample, and add 2 μl of protein marker to each well on both sides of the gel plate.

[0099] 3) Set the electrophoresis conditions to a constant voltage of 80V and perform electrophoresis for 30 minutes until the marker bands separate. Then increase the voltage to 120V and continue electrophoresis for 90-120 minutes until the target protein bands are completely separated.

[0100] 4) Stop electrophoresis, turn off the power, and prepare for membrane transfer.

[0101] (4) Transfer membrane 1) Prepare the transfer buffer and add it to the corresponding container of the transfer instrument.

[0102] 2) Cut PVDF membranes to the appropriate size for later use. Activate them in methanol for 1 minute, then transfer them to the equilibrium solution and soak for 1 minute.

[0103] 3) Cut the gel to the appropriate size for loading, soak it in deionized water, and then prepare the electrotransfer clamp and sponge. Select the standard mode for the transfer operation.

[0104] (5) Closed After the transfer was completed, a 5% skim milk solution was prepared and the strip was sealed on a shaker at room temperature for 60 minutes.

[0105] (6) Antibody incubation 1) Immerse the membrane in the primary antibody solution of the target protein and incubate overnight on a shaker at 4°C.

[0106] 2) The next day, wash the membrane with TBST for 10 minutes, repeat 3 times.

[0107] 3) Dilute the secondary antibody to the recommended concentration and incubate on a shaker at room temperature for 1-2 hours.

[0108] 4) Wash with TBST 3 times, 5 minutes each time.

[0109] (7) Exposure 1) Prepare the ECL developer solution fresh and store it away from light. 2) Add exposure droplets onto the PVDF film and develop it using a chemiluminescence detector.

[0110] Western blotting also confirmed elevated PDE4B expression at the protein level, and further validation was achieved in the mouse macrophage line RAW264.7 and mouse bone marrow-derived macrophages (BMDM). Figure 3 DE. PDE4B expression could still be induced in macrophages when stimulated with non-capsulated strains (Cap59) and heat-inactivated strains (HKC). Figure 3 GH), indicating that capsular components are not essential for PDE4B upregulation. Even after heat inactivation, certain surface antigens or metabolites of Cryptococcus retain their ability to regulate macrophages. In contrast, PDE4B expression decreased when BMDM was stimulated with Cryptococcus neoformans that strongly expresses melanin. Figure 3 (I) This result suggests that melanin may be a key factor in inhibiting PDE4B.

[0111] Example 7: qPCR validation that inhibition of PDE4B promotes macrophage differentiation and migration 1. Cell culture and processing (1) Cell culture is the same as in Example 5.

[0112] (2) Treatment: After the BMDM culture is completed, add the corresponding inhibitors according to the experimental requirements. Rolipram (40 μM), Nerandomilast (100 μM), PKA inhibitor-H 89 2HCl (30 μM).

[0113] 2. qPCR experiment Same as Example 5.

[0114] The results showed that qPCR detection indicated a significant increase in Arg1 expression after PDE4B inhibition. Figure 4 AB), while NOS2 expression decreased ( Figure 4 C). This suggests that PDE4B inhibitors promote macrophage polarization towards the M2 morphology. Simultaneously, we examined the expression of macrophage-related chemokines after Cryptococcal infection. qPCR results showed that PDE4B inhibitor treatment significantly upregulated the expression of CCR7 and CXCR4 in macrophages, while simultaneously decreasing the expression level of CCR2. Figure 4 G, IJ, LM).

[0115] Example 8: Flow cytometry verification that inhibiting PDE4B promotes macrophage differentiation and migration 1. Cell culture and processing are the same as in Example 7.

[0116] 2. Flow cytometry (1) Preparation of single-cell suspension 1) Discard the culture medium and gently rinse the cells with PBS.

[0117] 2) Scrape the cells off with a cell scraper and collect them in an EP tube. Centrifuge at 500 g for 5 minutes. Resuspend in 200 μl of flow cytometry buffer.

[0118] (2) Flow cytometry labeling and staining Same as Example 4.

[0119] Flow cytometry also validated Arg1 at the protein level. Figure 4 DE. Flow cytometry also confirmed this result at the protein level. Figure 4 (F, H, K). Overall, inhibition of PDE4B not only promotes macrophage polarization towards the M2 type under Cryptococcal infection conditions, but also enhances their migration ability by upregulating the expression of related chemokines.

[0120] Example 9: qPCR validation of the regulatory pathway of PDE4B inhibitors 1. Cell culture and processing are the same as in Example 7.

[0121] 2. The qPCR experiment is the same as in Example 5.

[0122] The results showed that, after Nerandomilast treatment and PKA inhibition, the expression levels of Arg1, CCR7, and CXCR4 were significantly reduced. Furthermore, in the Vehicle + PKA inhibitor group, the expression of Arg1, CCR7, and CXCR4 was also significantly reduced. Figure 4 NP). These data indicate that PDE4B inhibitors can regulate macrophage polarization and chemokine expression through the cAMP-PKA pathway (NP). Figure 4 NP).

[0123] Example 10: Detection of Macrophage Phagocytic and Killing Function 1. Cell culture and processing are the same as in Example 5.

[0124] 2. Detection of fungal colony-forming units (CFU) (1) The fungal suspension was serially diluted (1:10, 1:100, 1:1000), and 10 μl of each dilution was evenly dropped onto an SDA solid culture plate. Six replicates were set up for each sample.

[0125] (2) Place the plate at 30 °C for 36 to 48 hours until clear colonies are visible. Avoid overgrowth that could lead to colony fusion. Then select a plate with an appropriate dilution and count the colony forming units (CFU) of each plate.

[0126] 3. Cryptococcus neoformans H99 was treated with different concentrations of the PDE4 inhibitor Rolipram, and its fungicidal ability was directly tested. Figure 5 A).

[0127] 4. In vitro killing ability test: After treating RAW264.7 cells with Rolipram (40 μM), Cryptococcus neoformans H99 was added at a ratio of 10:1. After stimulating for 3 hours, the culture medium was mixed by pipetting and serially diluted for fungal colony forming unit (CFU) detection.

[0128] 5. In vitro phagocytic capacity assay: After treating RAW264.7 cells with Rolipram (40 μM), Cryptococcus neoformans H99 was added at a ratio of 10:1 for 3 hours. After rinsing off the free bacteria in the well plate, 1 ml of deionized water was added to rupture the cells, and then fungal colony forming units (CFU) were detected.

[0129] The results showed that Rolipram did not affect the viability of Cryptococcus neoformans H99, and PDE4 inhibitors did not significantly alter the bactericidal ability of macrophages, but they did promote the phagocytic ability of macrophages. Figure 5 AC).

[0130] Example 11: Construction of an in vitro BBB model and observation by laser confocal microscopy 1. The culture and treatment of mouse bone marrow-derived macrophages were the same as in Example 5. The bEnd.3 cell line (mouse mononuclear macrophages) was purchased from the ATCC cell bank and cultured in DMEM complete medium.

[0131] 2. Construction of in vitro BBB model ( Figure 5 DE) 1) Coating the base membrane: 70 µl of matrix gel diluted 8 times was evenly spread on the filter membrane in the upper chamber of the 8 µm pore size Transwell compartment, and incubated at 37 °C for 3 hours to polymerize into a gel. The pipette tip and other consumables were pre-cooled in a 4 °C refrigerator, and air bubbles were avoided during the gel spreading process.

[0132] 2) Inoculation of endothelial cells into the upper chamber: After aspirating excess culture medium removed by the matrix gel, count 1×10⁻⁶ cells. 5 One bEnd.3 cell was resuspended in 200 µl of complete culture medium and seeded onto the upper surface of the chamber, and left to stand for 72 hours to allow it to aggregate into a monolayer.

[0133] 3) Inoculation of macrophages into the upper chamber (cells pre-starved for 4-6 hours): During endothelial cell culture, PDE4B... - / - After pretreatment of BMDM or macrophages with inhibitors for 24 hours, the medium was changed, and H99Tdtomato was added at a 1:3 ratio to induce phagocytosis. Unphagocytosed free bacteria were washed away 24 hours after infection. Five × 10⁴ macrophages were counted, resuspended in 200 µl of medium containing 5% FBS, and added to the upper chamber of the microplate. 600 µl of medium containing 20% ​​FBS was added to the lower chamber to attract macrophage migration. After co-culturing for 24 hours, the medium in the lower chamber was collected, and the number of fluorescent bacteria in the lower chamber was counted.

[0134] 4) Using a syringe needle, carefully remove the chamber membrane completely for immunofluorescence staining. First, fix the chamber membrane directly with 4% paraformaldehyde at room temperature for 30 minutes, wash three times with PBS, then permeabilize with 0.5% Triton X-100 (diluted in PBS) at room temperature for 15 minutes, wash three times with PBS, and then block with 5% fetal bovine serum (diluted in PBS) at room temperature for 1 hour. After discarding the blocking solution, incubate overnight at 4 °C with anti-F4 / 80 and anti-CD45 primary antibodies. The next day, wash with PBS for 5 minutes three times, then incubate with appropriate secondary antibody at room temperature for 1 hour. Finally, add DAPI for mounting and nuclear staining.

[0135] 5) Use a laser confocal microscope to observe the lower chamber surface of the chamber membrane and take pictures for statistical analysis; at the same time, count the number of fungi in the lower chamber culture wells.

[0136] The results showed that, compared with the control group (Vehicle), the number of Cryptococcus traversing the BBB model to reach the lower luminal surface of the chamber was significantly increased in the Rolipram or Nerandomilast groups, and the fungal count in the lower chamber was also significantly increased. Figure 5 FK), in PDE4B - / - This result was also verified simultaneously in BMDM. Figure 6 EF). This indicates that inhibiting PDE4B significantly enhances the migration and invasion capabilities of macrophages, indirectly promoting the migration of Cryptococcus. Furthermore, in macrophages treated with Nerandomilast, the addition of a CXCR4 inhibitor significantly reduced the number of fluorescent bacteria crossing the barrier (EF). Figure 5 (LM). This result indicates that PDE4B inhibitors mainly affect the migration of Cryptococcus by upregulating the expression of the chemokine CXCR4, thereby enhancing the invasive ability of macrophages.

[0137] Example 12: PDE4B deficiency exacerbates cryptococcal infection in the brain of mice 1. Cryptococcus neoformans tail vein infection model: 6-8 week old WT mice were administered the PDE4 inhibitor Rolipram (5 mg / kg) and the PDE4B inhibitor Nerandomilast (5 mg / kg) via intraperitoneal injection. 24 hours later, the mice were treated with Rolipram, Nerandomilast, and PDE4B, respectively. + / - and PDE4B - / - Mice were injected with 5×10 via the tail vein. 5 One Cryptococcus neoformans bacterium (resuspended in 100 μl PBS) was infected for 48 hours.

[0138] 2. Animal processing and brain tissue acquisition (1) Cardiac perfusion 1) Mice were anesthetized by intraperitoneal injection of sodium pentobarbital to ensure that they were in a state of deep anesthesia; 2) Place the anesthetized mouse on the operating table and fix its limbs. Use sterile scissors to make a longitudinal incision along the mouse's sternum to open the chest cavity and expose the heart. 3) Using sterile scissors, cut open the right atrial appendage of the heart and shorten the inferior vena cava. Insert a syringe into the apex of the heart and inject PBS into the mouse heart to slowly remove residual blood until the perfusion fluid flows out from the heart and other parts.

[0139] (2) Mouse brain tissue collection: The mouse was fixed in a prone position on the operating table, the head skin was cut open, the skull was separated, and the mouse brain tissue was carefully removed with forceps and placed in a 1.5 ml EP tube containing 1 ml sterile PBS for later use.

[0140] 3. Fungal colony forming unit (CFU) detection: same as in Example 10.

[0141] The results showed that Cryptococcal infection was significantly increased in the brain tissue of mice in the inhibitor treatment group (corresponding to...). Figure 6 AB).

[0142] After stimulating PDE4B- / - mice with BMDM for 3 hours using H99, the killing ability of macrophages against fungi was assessed by fungal colony counting (corresponding to...). Figure 6 C).

[0143] After stimulating PDE4B- / - BMDM with H99 for 3 hours, the free bacteria were rinsed off, and the phagocytic capacity of macrophages was tested (corresponding to...). Figure 6 D).

[0144] The number of macrophages phagocytosed with H99Tdtomato that invaded the lower luminal surface of the Transwell chamber and were captured by confocal imaging was counted (n=4 / group, each point represents 3-4 fields of view). Figure 6 E).

[0145] Representative images of two groups of macrophages invading the subcompartmental luminal surface in a Transwell in vitro BBB model, captured by confocal imaging (green: F4 / 80+ macrophages; red: H99Tdtomato; DAPI: nuclei). Original magnification: 200×; scale bar: 20 μm. (Corresponding to...) Figure 6 F) Simultaneous introduction of PDE4B + / - and PDE4B - / - In mice, compared with WT mice, knockout mice showed a significant increase in fungal load in brain tissue after infection with Cryptococcus neoformans (corresponding to...). Figure 6 GH).

[0146] Example 13: Clearing macrophages significantly improves fungal infection of brain parenchyma 1. In vivo macrophage clearance experiment: WT and PDE4B were administered 24 hours in advance. - / - Mice were injected intravenously with 200 μl of macrophage scavenging agents (CLs), and the in vivo clearance effect was verified by flow cytometry. Figure 6 I).

[0147] 2. Flow cytometry is the same as in Example 4.

[0148] 3. Fungal colony forming unit (CFU) detection: same as in Example 10.

[0149] The results showed that cryptococcal infection in brain tissue was significantly reduced after macrophage removal. Figure 6 JK).

[0150] Example 14: Adoptive transfer experiments of macrophages demonstrated that PDE4B-deficient macrophages are more likely to cross the blood-brain barrier. 1. Cell culture and processing are the same as in Example 5.

[0151] 2. Macrophage adoptive transfer experiment: (1) Cell preparation: Extract and culture WT and PDE4B cells. - / - Primary bone marrow macrophages (BMDM) from mice, after maturation on day 7, were then transferred to WT and PDE4B cells, respectively. - / - H99 was added at a 1:4 ratio to different wells of macrophage cells. GFP Or H99 Tdtomato To encourage macrophages to engulf fluorescent bacteria. After 24 hours, unengulfed free bacteria were rinsed off, and primary macrophages that had engulfed different fluorescent bacteria were collected, resuspended in PBS, and counted.

[0152] (2) Mouse preparation: WT mice were injected with 200 µl of macrophage scavenging agent via the tail vein in advance. 24 hours later, a group of WT mice were injected with 200 µl of cell mixture, including 1×10⁻⁶ cells. 6 A devouring H99 GFP WT BMDM and 1×10 6 A devouring H99 Tdtomato WT BMDM (i.e., 1×10 6 WT BMDM-H99 GFP + 1×10 6 WT BMDM - H99 Tdtomato Another group of WT mice were injected with a cell mixture containing PDE4B KO mouse BMDM (1×10⁻⁶). 6 WT BMDM-H99 GFP + 1×106 PDE4B - / - BMDM-H99 Tdtomato ), adoption transfer 48 h.

[0153] (3) Flow cytometry detection is the same as in Example 4 (Figure 6 L).

[0154] Macrophage adoptive transfer results showed that after injection of PDE4B - / - In the BMDM group, H99 was found in brain tissue. Tdtomato The significantly increased proportion suggests that PDE4B-deficient macrophages are more likely to cross the blood-brain barrier and deliver Cryptococcus into the brain parenchyma. Figure 6 M).

[0155] Example 15: PDE4B activation reduces Cryptococcus neoformans brain infection 1. Bacteremia model: 6-8 week old WT mice were administered the PDE4 agonist MR-L2 2.5 mg / kg (CAS: 2374703-19-0) via intraperitoneal injection. Three hours after administration, the mice were injected via tail vein with 5 × 10⁻⁶ mg / kg of the MR-L2 agonist. 5 One Cryptococcus neoformans bacterium (resuspended in 100 μl PBS) was infected for 48 hours (corresponding to schematic diagram 7A).

[0156] 2. Animal processing and brain tissue acquisition are the same as in Example 12.

[0157] 3. Fungal colony forming unit (CFU) detection: same as in Example 10.

[0158] The results showed that pre-activation of PDE4 significantly reduced the Cryptococcus neoformans load in mouse brain tissue and significantly decreased the CFU count. Figure 7 B).

[0159] Example 16: PDE4B activation improves mouse survival 1. The bacteremia model is the same as in Example 15.

[0160] 2. Survival experiment: The mice were set up as the MR-L2 experimental group, and another group of mice injected with solvent was set up as the control group (Vehicle). The number of mice that survived and died in the two groups were recorded every day.

[0161] The results showed that stimulating PDE4 could prolong the survival time of mice. Figure 7 C).

[0162] The above experiments demonstrate that phosphodiesterase PDE4B agonists (taking MR-L2 as an example) can reduce cryptococcal brain infection, thereby preventing and / or treating cryptococcal meningoencephalitis.

[0163] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Use of a drug targeting phosphodiesterase PDE4B for the manufacture of a drug for the prevention and / or treatment of cryptococcus neoformans meningoencephalitis, characterized in that, The drug that targets phosphodiesterase PDE4B is a phosphodiesterase PDE4B agonist.

2. The application according to claim 1, characterized in that, The drug that targets phosphodiesterase PDE4B is the PDE4B agonist MR-L2.

3. The application according to claim 2, characterized in that, The MR-L2 is a compound with CAS number 2374703-19-0.

4. The application according to claim 1, characterized in that, The drug that targets phosphodiesterase PDE4B also contains pharmaceutically acceptable excipients.