CV-A5 recombinant virus expressing photo-oxygen voltage fluorescent protein and its application
By inserting LOV genes into the VP1 and 2A protease genes of CV-A5 virus, a genetically stable CV-A5 recombinant virus was constructed, and the problem of genomic instability of CV-A5 virus was solved, efficient viral proliferation and antibody screening were achieved, and rapid progress in CV-A5 infection research was promoted.
Patent Information
- Application Number
- CN202211012539.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-23
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2042-08-23
AI Technical Summary
The prior art is difficult to stably express photooxygen-voltage fluorescent protein (LOV) in Coxsackie virus Group A 5 (CV-A5), resulting in instability of the recombinant virus genome and affecting the proliferation ability and virulence of the virus.
The LOV gene was inserted between the VP1 protein gene and the 2A protease gene of the CV-A5 virus to form a CV-A5 recombinant virus that can express LOV. The recombinant virus is constructed through homologous recombination and PCR amplification, and rescued in RD cells to ensure the genetic stability of the gene and the proliferation ability of the virus.
It has achieved that the CV-A5 recombinant virus remains genetically stable after 10 passages in RD cells, has the same proliferation ability as wild viruses, and can be used to quickly determine viral titers and high-throughput screening antibodies to study the pathogenic mechanism of CV-A5 infection.
Smart Images

Figure CN115786281B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of virus application, and in particular to a Coxsackievirus group A type 5 (CV-A5) recombinant virus expressing a light, oxygen or voltage sensing fluorescent protein (LOV) and an application thereof. Background Art
[0002] Coxsackievirus A5 (CV-A5) belongs to the Picornaviridae family, genus Enterovirus. Since its first report in 1950, CV-A5 has caused numerous outbreaks and epidemics in the Asia-Pacific region. CV-A5 infection primarily causes hand, foot, and mouth disease (HFMD), herpangina, and onychomycosis.
[0003] The CV-A5 genome is approximately 7.4 kb and encodes a polyprotein containing 2193 amino acids. The CV-A5 genome is a single-stranded, positive-strand RNA containing only one open reading frame (ORF). The CV-A5 virus particle is approximately 27 to 30 nm in diameter and has icosahedral symmetry. The polyprotein comprises structural and nonstructural proteins: VP4, VP2, VP3, and VP1; and 2A, 2B, 2C, 3A, 3B, 3C, and 3D. The 5' and 3' UTRs of approximately 745 nt and 83 nt, respectively, are located at the 5' and 3' ends of the genome, respectively.
[0004] Currently, HFMD caused by CV-A5 is primarily transmitted through fecal-oral, airborne droplet, and contact. Children under 5 years of age are the primary susceptible population, while other populations are primarily asymptomatic. CV-A5 is sporadically prevalent, and mutations and recombination have enhanced its transmissibility. Currently, there is no effective vaccine to prevent CV-A5 infection, and specific and effective antiviral drugs are also lacking in clinical practice. Therefore, further research on CV-A5 is needed.
[0005] Virus tracing is an important method for studying viruses. It mainly involves assembling recombinant viruses by labeling viral proteins with fluorescent proteins, or by releasing fluorescent markers in infected cells, which can be traced and visualized. This fluorescent labeling tracing technology can be monitored and used to study viruses in living cells or living animals.
[0006] In recent years, GFP has been successfully used to label a variety of viruses, including HIV, adeno-associated virus, and herpes virus. However, the genomes of RNA viruses cannot accommodate large foreign genes, typically no larger than 10% of the viral genome. Even if genes for other fluorescent proteins are successfully inserted into the viral genome, the RNA virus will delete the fluorescent protein gene during replication. Furthermore, the insertion of foreign genes destabilizes the RNA virus genome, hindering its own replication.
[0007] In addition, the only enteroviruses reported to have successfully inserted exogenous fluorescent protein genes are enterovirus 71 and CV-A16. The construction strategies for both are mostly to insert the exogenous fluorescent protein gene (eGFP) between the 5'UTR and VP4 protein gene and add a 2A cleavage sequence, or to add other viral self-cleavage sequences and fluorescent protein sequences between the 3D protein and 3'UTR sequences. As the virus replicates, the exogenous protein is cut off, thus not affecting the assembly of the virus. However, the insertion of inappropriate exogenous genes makes the genome of the recombinant virus carrying the fluorescent protein unstable, making it impossible to pass it through multiple generations. Summary of the Invention
[0008] Based on this, it is necessary to provide a Coxsackievirus group A type 5 (CV-A5) recombinant virus that can express light-oxygen voltage fluorescent protein (LOV) and its application, which has genetic stability and can simultaneously ensure proliferation ability and viral virulence.
[0009] The present invention adopts the following technical solutions:
[0010] The present invention provides a CV-A5 recombinant virus capable of expressing LOV. The recombinant virus is formed by inserting the LOV gene sequence such as SEQ ID NO.1 between the VP1 protein gene and the 2A protease gene of the parent virus CV-A5-M14-611 genome, and the full gene sequence is shown in SEQ ID NO.12.
[0011] The CV-A5 recombinant virus that can express LOV was deposited in the China Center for Type Culture Collection on June 27, 2022, with the deposit number CCTCC No. V202251. The deposit address is Wuhan University, Wuhan, China, and the classification name is human enterovirus CV-A5-M14-611-LOV.
[0012] The LOV-expressing CV-A5 recombinant virus can grow in RD cells.
[0013] The present invention also provides a method for constructing the above-mentioned CV-A5 recombinant virus capable of expressing LOV, comprising the following steps: using KOD high-fidelity polymerase (TOYOBO) to perform inverse PCR amplification of gene fragments of the pBR322 vector, the 5'UTR-VP1 region, the LOV region, and the 2A-3'UTR region, wherein adjacent fragments have 20 bp homology arms; mixing the PCR product with the vector, performing homologous recombination using an In-Fusion HDcloning kit (Takara), transforming into Escherichia coli, screening positive colonies, and sequencing and comparing the positive samples to obtain CV-A5-M14-611-LOV recombinant clones.
[0014] Furthermore, the construction method also includes the step of using RD cells to rescue the CV-A5-M14-611-LOV recombinant clone.
[0015] In some embodiments, the primer sequences used for screening positive colonies are shown as SEQ ID NO.10 and SEQ ID NO.11, respectively.
[0016] In some embodiments, the cloning primer sequences used in the PCR amplification are shown as SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.9, respectively.
[0017] The present invention also provides a method for testing the titer of the CV-A5 recombinant virus capable of expressing LOV, comprising the following steps: adding a cell suspension to a cell culture plate, adding a recombinant virus dilution solution, discarding the supernatant in sequence from the first day to the seventh day after virus inoculation, scanning and reading the fluorescence, setting the excitation wavelength to 520 nm, and calculating the virus titer.
[0018] The present invention also provides a method for detecting neutralizing antibodies or antibody titers in trace samples using the above-mentioned LOV-expressing CV-A5 recombinant virus, comprising the following steps: culturing cells in a cell well plate to a cell confluence of 60-90%, adding the recombinant virus and serum at different dilutions to the cell well plate, and after 48 hours of virus infection, discarding the supernatant and washing the cells once with PBS buffer; setting the excitation wavelength to 520 nm, measuring the fluorescence intensity of the sample in each detection well, and calculating the serum titer.
[0019] The above-mentioned LOV-expressing CV-A5 recombinant virus is used in screening antiviral drugs and studying the infection and pathogenic mechanism of CV-A5-infected cells or animals.
[0020] Compared with the prior art, the present invention has the following beneficial effects:
[0021] The present invention provides a recombinant virus of Coxsackievirus group A type 5 expressing the photo-oxidation voltage fluorescent protein (LOV) gene. This recombinant virus, after 10 passages in RD cells, has been confirmed to be genetically stable and possesses the same proliferation capacity and virulence as a wild-type virus strain. This fluorescently labeled recombinant virus can be used to establish rapid viral titer determination and rapid, high-throughput screening of human and murine anti-CV-A5 monoclonal therapeutic neutralizing antibodies using an IMMUNSPOT instrument. This can also be used to establish a high-throughput screening platform for antiviral drugs using an enzyme-linked immunosorbent assay (ELISA) and to study the infection or pathogenic mechanisms of CV-A5 in infected cells and animals. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 Diagram of the strategy for constructing the CV-A5-M14-611-LOV recombinant cloning.
[0023] Figure 2 Shown are the fluorescence expression of the P1 and P10 generations of the CV-A5-M14-611-LOV recombinant virus and its parental strain 611.
[0024] Figure 3 This is the genetic stability analysis of the CV-A5-M14-611-LOV recombinant virus.
[0025] Figure 4 This is the structural protein splicing analysis of the CV-A5-M14-611-LOV recombinant virus.
[0026] Figure 5 The fluorescence detection results under different degrees of cell damage are shown.
[0027] Figure 6 The titers of the P1-P10 generations of the CV-A5-M14-611-LOV recombinant virus were compared with those of the parental strain.
[0028] Figure 7 This is a comparison between the fluorescent method and the non-fluorescent conventional neutralization test method (conventional method).
[0029] Figure 8 Comparison of the construction strategies of two different fluorescent proteins at the same insertion position in Comparative Example 1; where "√" indicates the occurrence of CPE; "-": indicates no fluorescence was observed; "+": indicates a single or small amount of fluorescence was observed; "+++": indicates that a large number of fluorescent spots were observed. DETAILED DESCRIPTION
[0030] The present invention will be further described in detail below with reference to specific embodiments so that those skilled in the art can understand the present invention more clearly.
[0031] The following embodiments are only used to illustrate the present invention, but are not intended to limit the scope of the present invention. Based on the specific embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention.
[0032] In the examples of the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art; in the examples of the present invention, unless otherwise specified, the technical means used are conventional means well known to those skilled in the art.
[0033] The parental virus, CV-A5-M14-611 (abbreviated as 611), was obtained by repeated passage of CV-A5 in suckling mice of different ages and plaque purification. This parental information is disclosed in Patent 2020100975882 and the article Jin WP, Lu J, Zhang XY, et al. Efficacy of Coxsackievirus A5 Vaccine Candidates in an Actively Immunized Mouse Model. J Virol. 2021; 95(6): e01743-20. Model.
[0034] pBR322 vector: from NCBI database, sequence number is J01749.1.
[0035] The nucleotide sequence of the LOV gene is as follows:
[0036]
[0037] Among them, the above sequence A 15-nucleotide sequence corresponding to the 5 amino acids downstream of the 2A protease site of the synonymous mutation, It is an 18-nucleotide sequence corresponding to the 6 amino acids upstream of the 2A protease site of the synonymous mutation.
[0038] The middle sequence is the LOV region, which comes from the NCBI database with the sequence number KJ806995.1.
[0039] Example 1
[0040] like Figure 1 As shown, this embodiment provides a method for constructing a CV-A5-M14-611-LOV recombinant clone, comprising the following steps:
[0041] Based on full-length sequence analysis of the parental virus CV-A5-M14-611 (abbreviated as 611), the LOV gene (SEQ ID NO. 1) was selected to be inserted between the VP1 protein and the 2A protease gene in the viral genome. Fifteen nucleotides of the amino acid sequence GKFGQ (derived from the N-terminal amino acids of the 2A protein) with five synonymous mutations downstream of the 2A protease cleavage site (TSITTTGKFGQ) were added to the N-terminus of the LOV gene, while 18 nucleotides of the amino acid sequence TSITTT (derived from the C-terminal amino acids of the VP1 protein) with six synonymous mutations upstream of the 2A protease cleavage site were added to the C-terminus of the LOV gene. The 5' and 3' UTR regions of the virus were then ligated into the pBR322 vector in a head-to-tail fashion.
[0042] KOD high-fidelity polymerase (TOYOBO) was used to reversely amplify the pBR322 vector, 5'UTR-VP1 region, LOV region, and 2A-3'UTR region. There are four segments in total, corresponding to the A, B, C, and D segments in the PCR amplification, respectively. The adjacent segments have 20 bp homology arms. The amplification primers are shown in the table below:
[0043] Table of cloning primers for constructing recombinant viruses
[0044]
[0045]
[0046] The PCR product and vector were mixed at a molar ratio of 2:2:2:1. Homologous recombination was performed using the In-Fusion HD cloning kit (Takara) and chemically transformed into Escherichia coli. Positive colonies were screened using screening primers and sequenced to obtain CV-A5-M14-611-LOV recombinant clones.
[0047] The screening and identification primer sequences are as follows:
[0048] Screening and identification of cloning primers for insertion of LOV gene
[0049] Nomenclature of primers for screening recombinant cloning Sequence (5'—3') 22F ATGTATGTTCCACCCGGAGC(SEQ ID NO.10) 22R AACCAGTCCCAAATGCGTCA(SEQ ID NO.11)
[0050] This example further provides a method for rescuing the CV-A5-M14-611-LOV recombinant virus, comprising the following steps: extracting the CV-A5-M14-611-LOV recombinant plasmid using a plasmid kit, digesting the recombinant plasmid with MluI restriction endonuclease (NEB), and obtaining a linearized CV-A5-M14-611-LOV recombinant plasmid. Viral RNA was transcribed using a T7 in vitro transcription kit (Promega) and designated rCV-A5-M14-611-LOV. Following the instructions for Lipofectamine 3000 transfection reagent, rCV-A5-M14-611-LOV was transfected into RD cell culture plates (6-well plates) at a confluence of 60% using a transfection dose of 5 μg. The transfected 6-well plates were incubated at 37°C, 5% CO₂ for 48 hours until a CPE of 90% was achieved, and fluorescence expression was observed.
[0051] The harvested virus was named CV-A5-M14-611-LOV-P0.
[0052] The full nucleotide sequence of the recombinant viral gene obtained in this example is as follows:
[0053]
[0054]
[0055]
[0056]
[0057] Italic bold These are primer sequences, not exact viral sequences.
[0058] The complete amino acid sequence of the recombinant virus is as follows:.
[0059] MGAQVSTTKTGSHENGNIATGGSTINYTNINYYRDSYAAAATRQDFTQDPNKFTSPVLDALREVAPPLKSPSAEACGYSDRVAQLTVGNSTITTQEAANIIVGYGEWPEYCPDVDATAVDKPTRPDVSVNRFYTLSAKMWQKESKGWYWKFPDILTEKGVFGQNVQFHYLYRSGFCVHVQCNASKFHQGALLVALMPEHVVAGMGAGDKPSTAPHPDYKATQPGPDGAELQYPYVLDCGVPISQLLICPHQWINLRTNNCATIIMPYINSVPYDSAINHCNFTLFVIPVSPLNYDAGATAAIPITVTVAPLCAEFGGLRQAVSQGLPVEIKPGSYQFLTTDDEVSAPILPGFQPTPEIHIPGEVRNLLELCQVETILEINNTTDTHGMSRLLIPVSAQTAADKLCASFRVDPGRSGPWESTLLGQICRYYTQWSGSLEVTFMFTGSFMATGKMLIAYTPPGGEQPKTRDVAMLGTHVIWDFGLQSSVTLVIPWISNSHYRTVETGGIFDYYSTGIVTIWYQTNFVVPTGAPTSAYIIALGAAQKNFTLKLCRDTESVSQTAILQGDPIADIIEGAVTQTTNRAISGPIQPVTAANTQPSSHRLGTGQVPALQAAETGATSNATDESMIETRCVVNRHGVMETSVEHFFSRSGLAGILIIEDSGTSTKGYATWEIDVMGFVQLRRKLEMFTYMRFDAEFTFITAERNGKTSPILVQYMYVPPGAPVPTGRDTFQWQTATNPSVISKMTDPPAQVSVPFMSPASTYQWFYDGYPTFGEVPVTTNLNYGQCPNNKMGTFCIRMVSGVSTGKDVTVRIFMKLKHV
[0060]
[0061] The sequence of the CV-A5 recombinant virus expressing LOV is characterized as follows:
[0062] The genome length of the CV-A5-M14-611-LOV virus strain is 7768 nucleotide residues. The nucleotide positions of the non-coding regions 5'-UTR and 3'-UTR in the genome are 1-745 and 7688-7768, respectively. The 3'-UTR is followed by a poly A tail of undetermined length, and the encoded polyprotein is 2313 amino acid residues in length.
[0063] The amino acid sequences and positions of the CV-A5-M14-611-LOV viral protein and LOV protein are:
[0064] The VP4 protein is the amino acid sequence from position 1 to position 69 shown in SEQ ID NO. 13;
[0065] The VP2 protein is the amino acid sequence from position 70 to position 324 shown in SEQ ID NO. 13;
[0066] The VP3 protein is the amino acid sequence at positions 325-564 shown in SEQ ID NO. 13;
[0067] The VP1 protein is the amino acid sequence at positions 565-860 shown in SEQ ID NO. 13;
[0068] The LOV protein is the amino acid sequence 861-983 shown in SEQ ID NO. 13;
[0069] The 2A protein is the amino acid sequence from position 984 to position 1132 shown in SEQ ID NO. 13;
[0070] The 2B protein is the amino acid sequence 1133-1231 shown in SEQ ID NO. 13;
[0071] The 2C protein is the amino acid sequence from positions 1232 to 1560 shown in SEQ ID NO. 13;
[0072] The 3A protein is the amino acid sequence 1561-1646 shown in SEQ ID NO. 13;
[0073] The 3B protein is the amino acid sequence 1647-1668 shown in SEQ ID NO. 13;
[0074] The 3C protein is the amino acid sequence 1669-1851 shown in SEQ ID NO. 13;
[0075] The 3D protein is the amino acid sequence at positions 1852-2313 shown in SEQ ID NO.13.
[0076] Example 2
[0077] This example provides a genetic stability analysis of the genes of the CV-A5-M14-611-LOV recombinant virus. The analysis method includes the following steps:
[0078] (1) The virus harvested in Example 1 was named CV-A5-M14-611-LOV-P0 and serially passaged 10 times, and the viruses were named CV-A5-M14-611-LOV-P1 to CV-A5-M14-611-LOV-P10 (referred to as 611-LOV-P1 to 611-LOV-P10, respectively). The viruses were harvested, and the fluorescence was observed and photographed. The results are shown in FIG. Figure 2 .
[0079] Depend on Figure 2 As can be seen, no fluorescence was observed after infection of cells with the parental virus 611, while significant fluorescence was observed after infection of cells with 611-LOV-P1 and 611-LOV-P10, confirming that the CV-A5-M14-611-LOV recombinant virus can stably express the LOV protein and maintain genome stability for at least 10 generations.
[0080] (2) Viral RNA from 611-LOV-P1 and 611-LOV-P10 was extracted using a column-based viral RNA extraction and purification kit (Sanggong). After obtaining viral RNA, the viral RNA was converted into cDNA using a TaKaRa reverse transcription kit. Using the cDNA as a template, primers for identifying recombinant clones were used to identify the presence of LOV sequence insertions. The amplified PCR products were observed by electrophoresis and the sequences were determined.
[0081] The electrophoresis results are shown in Figure 3 :The results showed that the LOV gene of virus 611-LOV-P10 still existed stably in the viral genome.
[0082] In addition, sequencing results showed that the LOV gene was inserted at the correct position and sequence without mutation.
[0083] Example 3
[0084] This example is conducted on the viral protein of the CV-A5-M14-611-LOV recombinant virus, and the identification method includes the following steps:
[0085] 611-LOV-P1, 611-LOV-P10 and parental 611 were used to infect RD cells in a six-well plate. When CPE reached 90%, the cell supernatant was aspirated and the cells were lysed with SDS lysis buffer (Biyuntian). The lysed cells were aspirated and centrifuged at 10,000×g for 5 minutes. The supernatant was aspirated and the subsequent Western blotting experiment was performed. The primary antibody used in the Western blotting experiment was rabbit serum against the whole CV-A5 virus, with a dilution of 1:10,000; the secondary antibody was goat anti-rabbit antibody, with a dilution of 1:10,000. The experimental results are shown in Figure 4 The corresponding viral structural proteins of the 611-LOV-P10 generation were all cleaved normally, that is, the 2A protease successfully cleaved the N and C termini of the LOV protein, separating it from the VP1 protein and the 2A protein, that is, no protein chimeric recombinant virus was formed.
[0086] The above experimental tests show that during the continuous passage of 611-LOV recombinant virus on RD cells, the LOV protein expressed by the 10th generation virus has no obvious difference from that of the 1st generation, and there is no phenomenon of loss of LOV gene during virus passage and abnormal splicing of viral structural proteins.
[0087] Example 4
[0088] This example establishes a rapid method for determining the titer of the CV-A5-M14-611-LOV recombinant virus, comprising the following steps:
[0089] 2×10 5 A cell suspension of 100 cells / mL was added to a 96-well cell culture plate, and a 10-fold serial dilution of the virus was added the next day. From the first to the seventh day after virus inoculation, the supernatant was discarded in sequence, and the fluorescence was scanned and read using an IMMUNSPOT instrument with an excitation wavelength of 520 nm. The virus titer was recorded and the Karber method was used to measure the virus titration results at the same time to compare the two methods. The experimental results are shown in Figure 5 .
[0090] During the experiment, the virus titration results measured 2-3 days after virus inoculation were close to those of the Karber method, and the detection time was shortened. The results were determined 2-3 days after the test, which is 4-5 days earlier than the Karber method.
[0091] Example 5
[0092] This example compares the titer of the CV-A5-M14-611-LOV recombinant virus with that of the parent virus 611, and includes the following steps:
[0093] One day in advance, 1×10 5Add the cell suspension of 100 μL / well to a 96-well cell culture plate. The harvested 611-LOV-P1 to 611-LOV-P10 and the parental 611 virus were diluted 10-fold three times independently. The virus titer was calculated according to the Karber method. The results are shown in Figure 6 .
[0094] The results showed that there was no significant difference in the titer of the 611-LOV recombinant virus and the parental virus, and the presence of the LOV gene had no significant effect on the reproduction of the virus.
[0095] Example 6
[0096] This embodiment establishes a method for detecting neutralizing antibodies or antibody titers in trace samples. The specific operation is as follows: cells are cultured in a 96-well plate to a cell confluence of 60-90%, and a quantitative virus and 10 mouse serum samples of different dilutions are added to the cell well plate. After 48 hours of virus infection, the supernatant is discarded and the cells are washed once with PBS. Later, the IMMUNSPOT instrument is used for scanning, the excitation wavelength is set to 520nm, the exposure value is 3, and the instrument detects the fluorescence intensity of the sample wells one by one. The serum titer can be quickly calculated, and a non-fluorescent conventional neutralization test method (referred to as "conventional method", refer to Jin WP, Lu J, Zhang XY, et al. Efficacy of Coxsackievirus A5 Vaccine Candidates in an Actively Immunized Mouse Model. J Virol. 2021; 95 (6): e01743-20. Model) is set for comparison, and the results are shown in FIG. Figure 7 .
[0097] The results showed that using the statistical method t-test, the results of the fluorescence method and the conventional neutralization experimental method were not statistically significant, proving that the established fluorescence method can replace the conventional neutralization experiment, that is, the rapid micro-neutralization method established based on the CV-A5-611-LOV recombinant virus can increase the detection time of antibody titers, avoid errors caused by manual observation of CPE, and thus improve accuracy.
[0098] Comparative Example 1
[0099] Referring to the above test examples, this comparative example provides a comparative construction strategy study of fluorescent protein RFP and LOV gene at the same insertion position. The detailed construction strategy and results are as follows Figure 8 shown.
[0100] The results showed that inserting the red fluorescent protein (RFP) gene between VP1 and 2A protease did not produce a recombinant virus that stably expressed RFP. However, inserting the LOV gene between VP1 and 2A protease using the same strategy did stably express the LOV gene and observe fluorescence, resulting in a recombinant virus that can be used in detection experiments.
[0101] It is important to note that the above embodiments are intended only to further illustrate and describe the technical solutions of the present invention and are not intended to further limit the technical solutions of the present invention. The methods of the present invention are merely preferred implementations and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.
Claims
1. A CV-A5 recombinant virus capable of expressing LOV, characterized in that: The recombinant virus is formed by inserting the LOV gene of sequence SEQ ID NO.1 between the VP1 protein gene and the 2A protease gene of the parent virus genome, and the full gene sequence is shown in SEQ ID NO.
12.
2. The LOV-expressing CV-A5 recombinant virus according to claim 1, characterized in that: Its deposit number is CCTCC NO: V202251.
3. The LOV-expressing CV-A5 recombinant virus according to claim 1, characterized in that: The LOV-expressing CV-A5 recombinant virus can grow in RD cells.
4. A method for constructing a CV-A5 recombinant virus capable of expressing LOV according to any one of claims 1 to 3, characterized in that: The steps include: KOD high-fidelity polymerase was used for inverse PCR amplification of the gene fragments of the pBR322 vector, the 5′UTR-VP1 region, the LOV region, and the 2A-3′UTR region, with 20 bp homology arms adjacent to the fragments; The PCR product was mixed with the vector, homologous recombination was performed using the In-Fusion HD cloning kit, and the cells were transformed into Escherichia coli. Positive colonies were screened and sequenced to obtain the CV-A5-M14-611-LOV recombinant clone.
5. The construction method according to claim 4, characterized in that The method also includes a step of using RD cells to rescue the CV-A5-M14-611-LOV recombinant clone.
6. The construction method according to claim 4, characterized in that The primer sequences used for screening positive colonies are shown in SEQ ID NO.10 and SEQ ID NO.11 respectively.
7. The construction method according to claim 4, characterized in that: The cloning primer sequences used in the PCR amplification are shown as SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.9, respectively.
8. A method for testing the titer of the LOV-expressing CV-A5 recombinant virus according to any one of claims 1 to 3, characterized in that: The steps include: Add the cell suspension to the cell culture plate and add the recombinant virus dilution solution. From the first day to the seventh day after virus inoculation, discard the supernatant in sequence, scan and read the fluorescence, set the excitation wavelength to 520 nm, and calculate the virus titer.
9. A method for detecting neutralizing antibodies or antibody titers in trace samples using the LOV-expressing CV-A5 recombinant virus according to any one of claims 1 to 3, wherein the method is used for non-disease diagnosis and treatment purposes, characterized in that: The steps include: Cells were cultured in a cell plate to 60-90% cell confluence, and recombinant virus and serum at different dilutions were added to the cell plate. After 48 hours of virus infection, the supernatant was discarded and the cells were washed once with PBS buffer. The excitation wavelength was set to 520 nm, the fluorescence intensity of the sample in each test well was measured, and the serum titer was calculated.
10. Use of the LOV-expressing CV-A5 recombinant virus according to any one of claims 1 to 3 in screening antiviral drugs and studying the infection and pathogenic mechanism of CV-A5-infected cells or animals, wherein the use is for non-disease diagnosis and treatment purposes.