A method of screening for wheat having different resistance to sprouting in the ear

Abstract

The application discloses a method for screening wheat with different resistance to ear sprouting. The method comprises the following steps: detecting whether the genotype of AX-111258240 site of the wheat to be tested is TT homozygous or CC homozygous, and the ear sprouting resistance of the wheat with the genotype of AX-111258240 site being TT homozygous is greater than that of the wheat with the genotype of AX-111258240 site being CC homozygous; and the AX-111258240 site is the nucleotide at the 36th position from the 5' end of SEQ ID NO: 1 in the wheat genome. Experiments prove that the detection of the genotype of AX-111258240 site of the wheat can screen the ear sprouting resistance trait of the wheat, and has important application value in the process of molecular marker assisted breeding of the wheat.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a method for screening wheat with different resistance to spike sprouting. BACKGROUND

[0002] Wheat is an important food crop worldwide, and the sustainable production of wheat directly affects the quality of people's life and national food security. In recent years, with global warming and frequent extreme weather, the phenomenon of spike sprouting during the maturation to harvest period of wheat is becoming more and more frequent, which seriously reduces the yield of wheat and deteriorates the quality of grains, and has become a global hazard. Spike sprouting promotes the increase of internal grain hydrolytic enzyme activity, and the decomposition and consumption of stored substances, thereby causing the decrease of grain bulk density and thousand-grain weight, resulting in the reduction of wheat yield. At the same time, due to the degradation of protein, the SDS sedimentation value and gluten content after milling gradually decrease, and the appearance and taste of steamed bread, bread and other flour products processed by sprouted wheat flour are poor, which seriously affects the nutritional quality and processing quality. The direct economic loss of global wheat caused by spike sprouting is about 1 billion US dollars per year, and cultivating new wheat varieties with resistance to spike sprouting is the most economical and effective way to solve this problem.

[0003] Wheat pre-harvest sprouting (PHS) is a quantitative trait controlled by multiple genes. Identifying the location of PHS resistance genes and their genetic mechanisms is the basis for breeding new wheat varieties with PHS resistance. Linkage analysis can identify PHS resistance QTL loci based on parental genetic populations, and molecular markers tightly linked to PHS resistance QTL loci can be used for breeding. Through marker-assisted selection (MAS), we can purposefully accumulate genes to improve the resistance of varieties. The use of tightly linked molecular markers can help evaluate and identify crop germplasm resources and breeding generations at the genotype level, effectively shortening the duration of disease-resistant breeding. In the practice of molecular marker-assisted quality and disease-resistant breeding, a combination of phenotypic analysis, biochemical markers, and genetic markers is often used for identification. Currently, molecular markers used for genotyping include STS, SSR, SNP, and InDel. With the development of genomics and molecular biology, chip or resequencing can quickly obtain a large amount of SNP variation data. In recent years, wheat 90K, 660K, 50K, 55K, and 35K gene chips have developed rapidly and have been widely used in the genetic analysis of complex traits in wheat. Single nucleotide polymorphism (SNP) markers are widely present in the genome, with the advantages of a large number, high density, wide coverage, and high-throughput detection. With the rapid development of molecular biology techniques, SNP markers have been gradually applied to high-density genetic mapping, quantitative trait gene mapping, and germplasm genotype detection, effectively accelerating the process of molecular breeding. The SNP genotyping detection scheme based on KASP (Kompetitive Allele-Specific PCR) technology developed by LGC Genomics can replace the site-specific fluorescent probe with a universal fluorescent probe, effectively saving costs and efficiently applying to large-scale specific marker detection. The use of gene chip detection for SNP genotypes to explore target sites and develop KASP markers will contribute to efficient, low-cost, and precise MAS breeding of complex agronomic traits in wheat.

[0004] Zhongmai 578 is a new wheat variety with high quality, strong gluten, disease resistance, and stress resistance, developed by the Crop Science Institute and the Cotton Research Institute of the Chinese Academy of Agricultural Sciences. It has been approved in the Huanghuai South and North regions and ranks among the top new high-quality wheat varieties in China. It has a broad industrialization prospect and has become a major cultivar and important parent line in the Huanghuai wheat region. Zhongmai 578 is one of the best pre-harvest sprouting resistant varieties among white wheat varieties in China, but there have been no reports on its genetic resistance to pre-harvest sprouting. Identifying PHS resistance QTL and developing SNP markers tightly linked to them is of great significance for wheat breeding. SUMMARY

[0005] The object of the present application is to identify the wheat ear sprouting resistance.

[0006] The present application first protects the primer set, which can be composed of the upstream primer F1, the upstream primer F2 and the downstream primer R;

[0007] The upstream primer F1 can be composed of the fluorescent label sequence A and the DNA fragment shown in SEQ ID NO: 2 from the 22nd to the 42nd position from the 5' end;

[0008] The upstream primer F2 can be composed of the fluorescent label sequence B and the DNA fragment shown in SEQ ID NO: 3 from the 22nd to the 42nd position from the 5' end;

[0009] The nucleotide sequence of the downstream primer R can be as shown in SEQ ID NO: 4.

[0010] In the above primer set, the nucleotide sequence of the fluorescent label sequence A can be as shown in SEQ ID NO: 2 from the 1st to the 21st position from the 5' end. The nucleotide sequence of the fluorescent label sequence B can be as shown in SEQ ID NO: 3 from the 1st to the 21st position from the 5' end.

[0011] In the above, the nucleotide sequence shown in SEQ ID NO: 2 from the 1st to the 21st position from the 5' end is the FAM fluorescent label sequence, and the fluorescent signal is blue. The nucleotide sequence shown in SEQ ID NO: 3 from the 1st to the 21st position from the 5' end is the HEX fluorescent label sequence, and the fluorescent signal is red.

[0012] The present application also protects the application of any of the above-mentioned primer sets, which can be any of the following b1)-b3):

[0013] b1) identifying the ear sprouting resistance of the wheat to be tested;

[0014] b2) screening wheat varieties with high ear sprouting resistance;

[0015] b3) wheat breeding.

[0016] The present application also protects the application of the DNA fragment shown in SEQ ID NO: 1, which can be any of the following b1)-b4):

[0017] b1) identifying the ear sprouting resistance of the wheat to be tested;

[0018] b2) screening wheat varieties with high ear sprouting resistance;

[0019] b3) wheat breeding;

[0020] b4) as a molecular marker for identifying the ear sprouting resistance of the wheat to be tested.

[0021] b4) that is, the present application also protects the molecular marker shown in SEQ ID NO: 1.

[0022] The present application also protects a method for screening wheat with different resistance to sprouting, which can comprise the following steps: detecting whether the genotype of the wheat to be tested based on the AX-111258240 site is TT homozygous or CC homozygous, the resistance of the wheat to be tested based on the AX-111258240 site is TT homozygous is greater than the resistance of the wheat to be tested based on the AX-111258240 site is CC homozygous.

[0023] The AX-111258240 site is the nucleotide at position 36 from the 5' end of SEQ ID NO: 1 in the wheat genome.

[0024] In the above method, the step of detecting whether the genotype of the wheat to be tested based on the AX-111258240 site is TT homozygous or CC homozygous is as follows:

[0025] (a1) using the genomic DNA of the wheat to be tested as a template, using any of the primer sets described above to perform PCR amplification to obtain a PCR amplification product;

[0026] (a2) after step (a1) is completed, detecting the fluorescence signal of the PCR amplification product using an instrument, and obtaining the genotype of the wheat to be tested based on the AX-111258240 site according to the color of the fluorescence signal.

[0027] In the above method, the step of detecting whether the genotype of the wheat to be tested based on the AX-111258240 site is TT homozygous or CC homozygous is as follows:

[0028] (b1) using the genomic DNA of the wheat to be tested as a template, using any of the primer sets described above to perform PCR amplification to obtain a PCR amplification product;

[0029] (b2) sequencing the PCR amplification product obtained in step (b1);

[0030] (b3) obtaining the genotype of the wheat to be tested based on the AX-111258240 site according to the sequencing result obtained in step (b2).

[0031] The present application also protects a kit for identifying the resistance of wheat sprouting, which can comprise a substance for detecting the genotype of the wheat to be tested based on the AX-111258240 site.

[0032] The AX-111258240 site is the nucleotide at position 36 from the 5' end of SEQ ID NO: 1 in the wheat genome.

[0033] The kit can specifically consist of a substance for detecting the genotype of the wheat to be tested based on the AX-111258240 locus.

[0034] In the kit, the substance for detecting the genotype of the wheat to be tested based on the AX-111258240 locus can be any of the primer sets described above.

[0035] The preparation method of the kit also falls within the protection scope of the present application. The preparation method of the kit comprises the step of individually packaging each primer in any of the primer sets described above.

[0036] The present application also protects the use of any of the kits described above, which can be any of the following b1) to b3):

[0037] b1) identifying the pre-tested wheat for resistance to pre-harvest sprouting;

[0038] b2) screening wheat varieties with high resistance to pre-harvest sprouting;

[0039] b3) wheat breeding.

[0040] In the above, the > can specifically be > in statistics. The high resistance to pre-harvest sprouting can specifically be high resistance to pre-harvest sprouting in statistics.

[0041] Experiments have proved that, by using the method provided by the present application to detect whether the genotype of the wheat to be tested based on the AX-111258240 locus is TT homozygous or CC homozygous, the pre-harvest sprouting resistance of the wheat with the genotype of the AX-111258240 locus being TT homozygous is > the pre-harvest sprouting resistance of the wheat with the genotype of the AX-111258240 locus being CC homozygous; the AX-111258240 locus is the 36th nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome. It can be seen that, by detecting the genotype of the wheat based on the AX-111258240 locus, wheat pre-harvest sprouting resistance traits can be screened. The present application has important application value in the process of wheat molecular marker-assisted breeding. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 It is a genetic linkage map constructed from SNP markers in the 50K chip.

[0043] Figure 2 It is part of the detection results of the F5 RIL population of Zhongmai 578 / Jimai 22 in Example 1, Step Five.

[0044] Figure 3 It is part of the detection results of 89 wheat varieties in Example 2. DETAILED DESCRIPTION

[0045] The application will be further described in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0046] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0047] Jimei 22 (as described in the following document: High-yield and disease-resistant broad-adapted wheat new variety - Jimei 22. Li Haosheng, Liu Jianjun, Song Jianmin, Liu Aifeng, Cheng Dungong, Zhao Zhendong. Journal of Wheat and Barley, 2007(04):744) is a wheat variety developed by the Crop Research Institute of Shandong Academy of Agricultural Sciences in 1994, using self-bred line 935024 as the female parent and 35106 as the male parent, and bred through pedigree method. Jimei 22 has the characteristics of good comprehensive agronomic traits, high yield potential, good stability, and wide adaptability, and is a high-quality medium gluten wheat variety.

[0048] Zhongmai 578 (as described in the following document: Planting performance and cultivation techniques of Zhongmai 578 in Zhumadian area. Wang Haifeng, Zhao Weiqin, Ran Wuling, Wu Changcheng, Wang Jiarun, Wang Zijun, Wang Fang, China Seed Industry. 2020(10):99-101.) is a new high-quality strong gluten high-yield wheat variety developed by the Crop Science Institute and the Cotton Research Institute of Chinese Academy of Agricultural Sciences, with the advantages of early maturity, good yellowing, high-quality strong gluten, high yield and stability, resistance to broad adaptation, high and stable thousand-grain weight, and good grain commodity properties, and is a new generation variety for high-quality strong gluten wheat production in Zhumadian area of Henan Province.

[0049] Germination index (GI) is an indicator of seed vigor, which is obtained by recording the number of germinated seeds each day during the germination test, and then calculating the germination index. The higher the GI, the higher the seed vigor, i.e. the lower the resistance to panicle germination.

[0050] Example 1, discovery of AX-111258240 locus of panicle germination resistance gene and obtaining of primer set for identifying wheat panicle germination resistance

[0051] I. Analysis of field phenotype data and discovery of new panicle germination resistance QTL

[0052] 1. In 2019-2020, Zhongmai 578, Jimai 22 and 262 F5 RIL populations of Zhongmai 578 / Jimai 22 were planted in Xinxiang, Henan (34°53'N, 113°23'E; E1); in 2020-2021, Zhongmai 578, Jimai 22 and 262 F5 RIL populations of Zhongmai 578 / Jimai 22 were planted in Xinxiang, Henan (E2), Shangqiu, Henan (33°43'N, 114°49'E; E3), Luoyang, Henan (34°32'N, 112°16E; E4) and Gaoyi, Hebei (37°33'N, 114°26'E; E5); a total of five environments. All environments used a completely randomized block design, three replicates, 1 m row length, 30 grains / row, row spacing 20 cm, and other field management measures were carried out according to local wheat field management standards. Phenotypic identification was carried out in the laboratory. At the late wax ripening stage of wheat growth, 10 main stem ears (with ear lower nodes) of each material were cut, 5 ears were tied into one repeat, air-dried for 1 d, immediately stored in a -20°C refrigerator to maintain their dormancy, and after all materials were harvested, the ear germination experiment was carried out uniformly.

[0053] The ear germination experiment was as follows: first, the whole ear was soaked in distilled water for 10-12 h, then soaked in 0.1% sodium hypochlorite solution for 15 min, then washed with sterile water, wrapped with germination paper, and placed in a fresh-keeping bag for moisture, placed in an artificial climate incubator (temperature 20°C, light cycle 16h day / 8h night, relative humidity 80%) for 7d, then taken out, quickly dried in an electric thermostatic oven (150°C) to stop further germination, hand threshed, and the broken seed embryo was used as the identification standard. The GI of each material was recorded, and the average value of two replicates was the GI of the material (GI = number of broken seed embryos / total number of grains x 100%).

[0054] 2. After completing step 1, the Pearson correlation coefficient of GI (i.e. ear germination resistance) was calculated using the international SAS statistical software PROC CORR model, and the PROC MIXED command was used for variance analysis.

[0055] The results of variance analysis showed that there was a very significant difference in GI between different genes, the correlation coefficient of the five environments was between 0.52-075, the correlation was good, and the effectiveness of the phenotypic data was further determined.

[0056] 3. Construction of genetic linkage map

[0057] The wheat 50K chip (Bio-O) was used for genotyping Zhongmai 578, Jimai 22 and 262 F5 RIL populations of Zhongmai 578 / Jimai 22. The wheat 50K chip contains 55224 SNP markers, which are evenly distributed on 21 chromosomes. Before constructing the genetic linkage map, first remove the markers without polymorphism between parents, delete the markers with a deletion rate of more than 20% and a minimum allele frequency of less than 0.3. Next, 9354 high-quality polymorphic markers were used for analysis. After removing redundant markers by BIN function of Icimapping 4.2, 1501 markers were left, and linkage analysis was performed by JoinMap 4.0 software, and genetic linkage map was drawn by MapChart 2.32.

[0058] The genetic linkage map constructed by the SNP markers in the 50K chip is shown in Figure 1 .

[0059] 4. QTL positioning

[0060] QTL analysis was performed by the complete interval mapping method (ICIM) of IciMapping 4.2 software. The mapping parameters were set as a scanning step of 0.1 cM, a probability of stepwise regression markers entering of 0.001, and a 1000-time permutation test (P<0.05) to calculate the LOD (Logarithm of the odds) critical value. The QTL with a phenotypic variation rate of more than 10% was a major QTL, and the QTL repeatedly positioned in 3 or more environments was a stable QTL. The QTL was named according to the international genetics nomenclature.

[0061] Two relatively stable QTLs were positioned in the population, wherein QGI.caas-5A stably existed in 4 environments and expected mean, and QGI.caas-5A was a new spike sprouting resistance QTL.

[0062] II. Discovery of AX-111258240 site

[0063] The inventors of the present application have carried out a large amount of sequence analysis, comparison and pre-experiment, and found that the AX-111258240 SNP site upstream of QGI.caas-5A is not only close in physical position, but also has many difference sites among the 3 homologous chromosomes. The AX-111258240 SNP site is referred to as AX-111258240 site.

[0064] AX-111258240 locus is the 36th nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome, and the genotypes are CC homozygous, TT homozygous and TC heterozygous. SEQ ID NO: 1: TCATTTTGGCCTGTATCGTTGTCCCCATGTGGGCAYATACGTGATGTGTGCACTGCTTGCGCTGGCTTTGC (Y is C / T).

[0065] Since the genomic DNA is a double-stranded DNA molecule composed of two single-stranded DNA molecules in reverse complement, the DNA molecule encoding protein is generally named as the sense DNA molecule; the DNA molecule reverse complementary to the sense DNA molecule is named as the antisense DNA molecule. The genotypes of AX-111258240 locus are all the genotypes of sense DNA.

[0066] III. Obtaining of primer set for identifying wheat pre-harvest sprouting resistance

[0067] According to the nucleotide sequence of AX-111258240 locus and the nucleotide sequences before and after it, a primer set suitable for identifying wheat pre-harvest sprouting resistance by allele competitive specific PCR method is designed and synthesized. The primer set consists of 3 primer sequences of upstream primer F1, upstream primer F2 and downstream primer R, which are used to amplify the target sequence including AX-111258240 locus. The nucleotide sequences of each primer are shown in Table 1.

[0068] Table 1

[0069]

[0070] Note: single underline is FAM fluorescent tag sequence, double underline is HEX fluorescent tag sequence.

[0071] IV. Establishment of genotyping method of wheat based on AX-111258240 locus

[0072] 1. Obtaining of genomic DNA of wheat to be tested

[0073] The genomic DNA of wheat to be tested is extracted by CTAB method.

[0074] The quality and concentration of the genomic DNA of the wheat to be tested must meet the PCR requirements, and the standard is that agarose electrophoresis shows a single DNA band without obvious dispersion; the ultraviolet spectrophotometer Nanodrop 2100 (Thermo) detects that the A260 / A280 ratio is between 1.8-2.0 (the DNA sample is not contaminated with protein), the A260 / A230 ratio is between 1.8-2.0 (the DNA sample has low salt ion concentration), and there is no obvious light absorption at 270 nm (the DNA sample is not contaminated with phenol); the concentration of the genomic DNA of the wheat to be tested is 50-200 ng / μL.

[0075] 2. Competitive allele-specific PCR

[0076] (1) Using the genomic DNA of the wheat to be tested as the template, the primer set synthesized in step three is used for PCR amplification to obtain the PCR amplification product.

[0077] The reaction program is as follows: 94℃ pre-denaturation, 15 min; 94℃ denaturation for 20 s, 61℃-55℃ (selecting the touch down program, reducing 0.6℃ per cycle), 1 min, amplifying for 10 cycles; 94℃ denaturation for 20 s, 55℃ for 1 min, continuing to amplify for 26 cycles.

[0078] 3. After step 2 is completed, when the temperature of the PCR amplification product is reduced to below 40℃, the fluorescence value is read by scanning the FAM and HEX light beams of the enzyme marker instrument (the FAM fluorescence tag sequence is observed and read at the excitation light 485 nm and the emission light 520 nm wavelength, and the HEX fluorescence tag sequence is observed and read at the excitation light 528 nm and the emission light 560 nm wavelength), and the genotype of the wheat to be tested based on the AX-111258240 site is determined according to the color of the fluorescence signal. The specific judgment principle is as follows: if the wheat to be tested based on the AX-111258240 site shows a blue fluorescence signal, then the genotype of the wheat to be tested based on the AX-111258240 site is CC homozygous; if the wheat to be tested based on the AX-111258240 site shows a red fluorescence signal, then the genotype of the wheat to be tested based on the AX-111258240 site is TT homozygous; if the wheat to be tested based on the AX-111258240 site shows a green fluorescence signal, then the genotype of the wheat to be tested based on the AX-111258240 site is TC heterozygous.

[0079] It should be noted that if the fluorescence signal is weak after the PCR amplification is completed, which affects data analysis, additional cycles (94℃ denaturation for 20 s, 55℃ annealing and extension for 1 min, 5 cycles) can be added until the results are satisfactory.

[0080] V. Genotyping of Zhongmai 578, Jimai 22 and 262 F5 RILs of Zhongmai 578 / Jimai 22 based on AX-111258240 locus using the method of step IV

[0081] According to the method of step IV, the wheat to be tested is replaced by Zhongmai 578, Jimai 22 and 262 F5 RILs of Zhongmai 578 / Jimai 22 respectively, and the other steps remain unchanged, to obtain the genotypes of Zhongmai 578, Jimai 22 and 262 F5 RILs of Zhongmai 578 / Jimai 22 based on AX-111258240 locus. Part of the detection results are shown in Table 3. Figure 2 (NTC is blank control, i.e. no template).

[0082] The genotyping results above are compared with the genotyping results of Zhongmai 578, Jimai 22 and 262 F5 RILs of Zhongmai 578 / Jimai 22 in the wheat 50K chip. The results show that the genotyping of wheat based on AX-111258240 locus detected by the method provided in step IV is completely consistent with the genotyping results in the wheat 50K chip. It can be seen that the method provided in step IV for detecting the genotypes of wheat based on AX-111258240 locus has high accuracy.

[0083] Example 2, Correlation analysis and verification of the primer set synthesized in Example 1 for identifying the wheat pre-harvest sprouting resistance and the wheat pre-harvest sprouting resistance

[0084] The wheat to be tested is 89 wheat varieties in the Huanghuai wheat region, and the names of the 89 wheat varieties are shown in column 2 of Table 2.

[0085] Table 2. Genotypes of 89 wheat varieties based on AX-111258240 locus and sprouting index (GI)

[0086]

[0087]

[0088]

[0089]

[0090] Note: NA is not genotyped.

[0091] 1. Genotyping of 89 wheat varieties based on AX-111258240 locus

[0092] According to the method of step IV in Example 1, the wheat to be tested is replaced by 89 wheat varieties, and the other steps remain unchanged, to obtain the genotypes of 89 wheat varieties based on AX-111258240 locus. Part of the detection results are shown in Table 3.Figure 3 (NTC is blank control, i.e. no template).

[0093] The detection results are shown in the third column of Table 2.

[0094] 2. Detection of germination index

[0095] In 2014-2015, 89 wheat varieties were planted in Anyang, Henan Province, for identification of resistance to spike germination. A completely randomized block design was used, with three replicates, single row, row length 1.5 m, row width 0.25 m, 50 grains per row, and other field management measures were carried out according to the local wheat field management standards. Phenotypic identification was carried out indoors. At the late waxing stage of wheat growth, 10 main stem spikes (with spike lower nodes) of each material were cut, 5 spikes were tied for each replicate, air-dried for 1 d indoors, and immediately stored in a refrigerator at -20°C to maintain their dormancy. After all the materials were harvested, the spike germination experiment was carried out. The spike germination experiment was as follows: the whole spike was soaked in distilled water for 10-12 h, then soaked in 0.1% sodium hypochlorite solution for 15 min, then washed with sterile water, wrapped with germination paper, and placed in a fresh-keeping bag for moisture, and placed in an artificial climate incubator (temperature 20°C, light cycle 16 h day / 8 h night, relative humidity 80%) for 7 d, then taken out, quickly dried in an electric thermostatic oven (150°C) to stop further germination, hand-threshed, and the broken seed embryo was used as the identification standard. The GI of each material was recorded (GI = number of broken seed embryos / total number of grains x 100%). The average value of two replicates was the GI of the material.

[0096] The GI results of the 89 wheat varieties are shown in the fourth column of Table 2.

[0097] 3. Association analysis

[0098] The average GI of the two genotypes of wheat was calculated, and the t-test was performed using the international general SAS9.2 statistical software PROCTTEST model. The statistical results are shown in Table 3.

[0099] The results show that in the population of 89 wheat varieties in the Huanghuai wheat region, the GI of the wheat varieties with CC homozygous type is higher than that of the wheat varieties with TT homozygous type. The ">" is statistically higher than "(i.e. significantly higher than at the 0.05 level). Therefore, TT homozygous type is an excellent genotype for improving the resistance of wheat to spike germination.

[0100] Table 3. t-test of GI values of 89 wheat varieties

[0101]

[0102]

[0103] Note: * indicates P < 0.05; TT is TT homozygote, CC is CC homozygote.

[0104] The above results show that the wheat ear sprouting resistance trait can be screened by detecting the genotype of the wheat to be tested based on the AX-111258240 site, which has important application value in the process of molecular marker assisted breeding of wheat.

[0105] The application has been described in detail above. For those skilled in the art, the application can be implemented in a wider range under equivalent parameters, concentrations and conditions without departing from the purpose and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In general, according to the principle of the application, the application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. detecting wheat AX-111258240 application of a primer set for a locus for any one of the following b1) - b3): b1) identifying the resistance of the wheat to be tested to the pre-harvest sprouting; b2) screening the wheat varieties with high resistance to the pre-harvest sprouting; b3) breeding the wheat with high resistance to the pre-harvest sprouting; AX-111258240 the site is the nucleotide at position 36 from the 5' end of SEQ ID NO: 1 in the wheat genome; AX-111258240 Resistance of wheat to pre-harvest sprouting, the genotype of the locus being TT homozygous AX-111258240 Resistance of wheat to pre-harvest sprouting, the genotype of the locus being CC homozygous The primer set consists of an upstream primer F1, an upstream primer F2 and a downstream primer R; The sequence of the upstream primer F1 consists of a fluorescent label sequence A and the sequence shown in SEQ ID NO: 2 from 5' end 22 to 42 from 5' end in turn; The sequence of the upstream primer F2 consists of a fluorescent label sequence B and the sequence shown in SEQ ID NO: 3 from 5' end 22 to 42 from 5' end in turn; The nucleotide sequence of the downstream primer R is shown in SEQ ID NO:

4.

2. The use according to claim 1, wherein: The nucleotide sequence of the fluorescent label sequence A is shown in SEQ ID NO: 2 from 5' end 1 to 21; The nucleotide sequence of the fluorescent label sequence B is shown in SEQ ID NO: 3 from 5' end 1 to 21.

3. A method of selecting wheat having different resistance to pre-harvest sprouting comprising the steps of: detecting the genotype of the Zm00002d049a locus in the wheat to be tested AX- 111258240 whether the genotype of the Zm00002d049a locus is homozygous TT or homozygous CC, AX-111258240 the resistance of the wheat to pre-harvest sprouting if the genotype of the Zm00002d049a locus is homozygous TT AX-111258240 the resistance of the wheat to pre-harvest sprouting if the genotype of the Zm00002d049a locus is homozygous CC. AX-111258240 The site is the nucleotide 36 from the 5' end of SEQ ID NO: 1 in the wheat genome.

4. The method of claim 3, wherein: The detection of the wheat to be tested AX-111258240 The step of determining whether the genotype of the locus is homozygous TT or homozygous CC is as follows: (a1) using the primer set to amplify the genomic DNA of the wheat to be tested by PCR to obtain the PCR amplification product; (a2) after step (a1) is completed, the fluorescence signal of the PCR amplification product is detected by using an instrument, and the genotype of the wheat to be tested at the locus is obtained according to the color of the fluorescence signal; AX-111258240 site; The primer set consists of an upstream primer F1, an upstream primer F2 and a downstream primer R; The sequence of the upstream primer F1 consists of a fluorescent label sequence A and the sequence shown in SEQ ID NO: 2 from 5' end 22 to 42 from 5' end in turn; The sequence of the upstream primer F2 consists of a fluorescent label sequence B and the sequence shown in SEQ ID NO: 3 from 5' end 22 to 42 from 5' end in turn; The nucleotide sequence of the downstream primer R is shown in SEQ ID NO:

4.

5. The method of claim 3, wherein: The detection of the wheat to be tested AX-111258240 The step of determining whether the genotype of the locus is homozygous TT or homozygous CC is as follows: (b1) using the primer set to amplify the genomic DNA of the wheat to be tested by PCR to obtain the PCR amplification product; (b2) sequencing the PCR amplification product obtained in step (b1); (b3) obtaining the genotype of the wheat plant at the locus of interest from the sequencing results obtained in step (b2). AX-111258240 (b3) obtaining the genotype of the wheat plant at the locus of interest from the sequencing results obtained in step (b2). AX-111258240 (b3) obtaining the genotype of the wheat plant at the 6. The use of the kit for any one of the following b1) - b3): b1) identifying the resistance of the wheat to be tested to the pre-harvest sprouting; b2) screening the wheat varieties with high resistance to the pre-harvest sprouting; b3) breeding the wheat with high resistance to the pre-harvest sprouting; The kit comprises a substance for detecting the genotype of the wheat AX-111258240 locus to be tested; AX-111258240 the site is nucleotide 36 from the 5' end of SEQ ID NO: 1 in the wheat genome; AX-111258240 Resistance of wheat to pre-harvest sprouting, the genotype of the locus being TT homozygous AX-111258240 Resistance of wheat to pre-harvest sprouting, the genotype of the locus being CC homozygous The detection of the wheat to be tested AX-111258240 The substance for detecting the genotype of the locus is the primer set described in claim 1 or 2.

Images