Application of SLAMF9 in Tumor Immunotherapy

Abstract

The present application discloses the application of SLAMF9 in tumor immunotherapy. It has been found in the present application that inhibiting the expression of the SLAMF9 gene can improve the immunotherapeutic effect of anti-PD-L1 antibody and CTLA-4 inhibitor on melanoma. Therefore, the combined use of an SLAMF9 inhibitor product with an anti-PD-L1 antibody or a CTLA-4 inhibitor can promote the infiltration of CD8+ T cells in tumor tissues and improve the therapeutic effect of anti-PD-L1 antibody or CTLA-4 inhibitor on melanoma; detecting the expression level of the SLAMF9 gene can predict the sensitivity of tumor patients to immunotherapy using anti-PD-L1 antibody or CTLA-4 inhibitor.

Description

Technical Field

[0001] This application relates to the field of biomedicine, and particularly to the application of SLAMF9 in tumor immunotherapy. Background Art

[0002] Cancer is one of the most major diseases threatening human health. In recent years, the continuously developing immunotherapy has provided new strategies for cancer treatment and also brought significant survival benefits to clinical patients. As an immune checkpoint blocker that activates the body's immune system and improves the killing function of immune cells in the tumor microenvironment, it has been approved as a first-line treatment method for various solid tumors and hematological malignancies. The expression levels of PD1 / PD-L1, tumor mutation burden, and tumor-infiltrating lymphocytes (such as CD8, CD4, etc.) in tumor tissues are important biological indicators for immune checkpoint blockers to achieve good clinical anti-tumor effects. However, due to the complexity and heterogeneity of individual cancer immunity, the predictive ability of these biomarkers and the efficacy of the corresponding antibodies on tumor suppression are not satisfactory, and some tumor patients develop drug resistance to PD-1, PD-L1, and CTLA-4 immune checkpoint inhibitors. Therefore, discovering new immune checkpoints, developing new immune checkpoint inhibitors, and the combined use of multiple immune checkpoint inhibitors are the keys to improving anti-tumor effects. Summary of the Invention

[0003] The first object of this application is to provide the application of the SLAMF9 gene as a target in the development or screening of immune checkpoint inhibitors.

[0004] The second object of this application is to provide the application of SLAMF9 inhibitory products in the preparation of anti-tumor products.

[0005] The third object of this application is to provide the application of reagents for detecting the expression level or protein activity of SLAMF9 protein in the preparation of immune therapy detection reagents.

[0006] The fourth object of this application is to provide a kit for predicting the sensitivity of tumor patients to immunotherapy using anti-PD-L1 antibodies and CTLA-4 inhibitors.

[0007] The fifth object of this application is to provide a method for in vitro screening of tumor immunotherapy drugs.

[0008] The sixth object of this application is to provide a device for predicting the sensitivity of tumor patients to immunotherapy using anti-PD-L1 antibodies or CTLA-4 inhibitors.

[0009] The seventh object of this application is to provide a computer-readable storage medium.

[0010] The technical solutions provided by this application are specifically as follows:

[0011] The application of the SLAMF9 gene provided by the present application as a target in the development or screening of immune checkpoint inhibitors, where the immune checkpoint is PD-L1 or CTLA-4. In some embodiments provided by the present application, the immune checkpoint inhibitor is an anti-PD-L1 antibody or a CTLA-4 inhibitor. The inventors found that inhibiting or downregulating the expression of the SLAMF9 gene can improve the immunotherapeutic effects of anti-PD-L1 antibodies and CTLA-4 inhibitors. Therefore, using the SLAMF9 gene as a target can develop or screen immune checkpoint inhibitors with good therapeutic effects on the immune checkpoints PD-L1 or CTLA-4.

[0012] The application of the SLAMF9 inhibitory product provided by the present application in the preparation of an anti-tumor product, where the anti-tumor product includes at least one of an anti-PD-L1 antibody and a CTLA-4 inhibitor and the SLAMF9 inhibitory product, and the SLAMF9 inhibitory product is a product that inhibits the expression of the SLAMF9 gene to express the SLAMF9 protein or inhibits the activity of the SLAMF9 protein. Based on the discovery that inhibiting or downregulating the expression of the SLAMF9 gene can improve the immunotherapeutic effects of anti-PD-L1 antibodies and CTLA-4 inhibitors, combining the SLAMF9 inhibitory product with an anti-PD-L1 antibody or a CTLA-4 inhibitor can promote the infiltration of CD8+ T cells in tumor tissues and improve the therapeutic effects of anti-PD-L1 antibodies or CTLA-4 inhibitors on tumors.

[0013] Preferably, the subject for using the anti-tumor product is one or more of melanoma, lung cancer, and lymphoma.

[0014] On the basis of the above technical solution, the SLAMF9 inhibitory product includes one or more of a polynucleotide sequence, a plasmid, a virus, an inhibitory antibody against SLAMF9, a protein that inhibits the activity of the SLAMF9 protein, a polypeptide, an enzyme, and a small molecule compound.

[0015] On the basis of the above technical solution, the SLAMF9 inhibitory product can enter cells and is suitable for autonomous replication in cells.

[0016] On the basis of the above technical solution, the SLAMF9 inhibitory product is allowed to enter cells by one or more of the following methods: direct naked DNA injection method, liposome-encapsulated DNA direct injection method, gold-coated DNA gene gun bombardment method, replication-deficient bacteria carrying plasmid DNA method, replication-deficient adenovirus carrying the target DNA method, PEG-modified protein drug injection method, liposome-encapsulated protein intravenous injection method, and protein microsphere preparation subcutaneous injection method.

[0017] The application of the reagent for detecting the expression level or protein activity of SLAMF9 protein in the preparation of an immunotherapy inspection reagent, which is used to predict the sensitivity of tumor patients to immunotherapy using anti-PD-L1 antibody or CTLA-4 inhibitor. When the immunotherapy inspection reagent detects a low expression level or protein activity of SLAMF9 protein, it can be predicted that the tumor patient has a high sensitivity to immunotherapy using anti-PD-L1 antibody or CTLA-4 inhibitor.

[0018] The kit provided by the present application for predicting the sensitivity of tumor patients to immunotherapy using anti-PD-L1 antibody or CTLA-4 inhibitor includes a reagent for detecting the expression level or protein activity of SLAMF9 protein. When the kit detects a low expression level or protein activity of SLAMF9 protein, it can be predicted that the tumor patient has a high sensitivity to immunotherapy using anti-PD-L1 antibody or CTLA-4 inhibitor.

[0019] The method for in vitro screening of tumor immunotherapy drugs provided by the present application includes the following steps:

[0020] Using SLAMF9 protein or SLAMF9 gene as the drug action target, and selecting SLAMF9 protein activity inhibitor or SLAMF9 gene expression inhibitor as the candidate primary screening drugs;

[0021] Combining the candidate primary screening drugs with anti-PD-L1 antibody or CTLA-4 inhibitor, and screening out the drug combination with good tumor suppression effect.

[0022] The device provided by the present application for predicting the sensitivity of tumor patients to immunotherapy using anti-PD-L1 antibody or CTLA-4 inhibitor includes the following two modules:

[0023] An evaluation module, which evaluates the expression level or protein activity of SLAMF9 protein in the tumor tissue of the tumor patient; and

[0024] A prediction module, which predicts the sensitivity of cancer patients to immunotherapy using anti-PD-L1 antibody or CTLA-4 inhibitor based on the evaluation result of the evaluation module.

[0025] The computer-readable storage medium provided by the present application includes a program that can be executed by a processor to implement all steps of predicting the sensitivity of tumor patients to immunotherapy using anti-PD-L1 antibody or CTLA-4 inhibitor. The all steps include:

[0026] Evaluating the expression level or protein activity of SLAMF9 protein in the tumor tissue of the tumor patient; and

[0027] Predicting the sensitivity of cancer patients to immunotherapy using anti-PD-L1 antibodies or CTLA-4 inhibitors based on the evaluation results.

[0028] Specifically, to evaluate the SLAMF9 protein expression level or protein activity in the tumor tissue of cancer patients, the SLAMF9 protein expression level or protein activity in the tumor tissue of cancer patients is compared with the statistical results of the SLAMF9 protein expression level or protein activity in healthy individuals.

[0029] Compared with the prior art, the present application has the following beneficial effects:

[0030] The present application discovers that inhibiting or downregulating the expression of the SLAMF9 gene can improve the immunotherapy effect of anti-PD-L1 antibodies and CTLA-4 inhibitors, and provides an anti-tumor product comprising at least one of anti-PD-L1 antibodies and CTLA-4 inhibitors and a SLAMF9 inhibition product, which can solve the problem of high drug resistance of some patients to PD-1, PD-L1, and CTLA-4 immune checkpoint inhibitor therapies; detecting the SLAMF9 gene expression level or protein activity in patients can also predict the sensitivity of cancer patients to immunotherapy using anti-PD-L1 antibodies or CTLA-4 inhibitors, providing an important basis for selecting treatment methods for patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The drawings are used to provide an understanding of the technical solutions of the present application and constitute a part of the specification. Together with the embodiments of the present application, they are used to explain the technical solutions of the present application and do not constitute a limitation to the technical solutions of the present application.

[0032] Figure 1 Showing the effect of SLAMF9 knockdown on mouse melanoma, wherein:

[0033] Figure 1 A shows the comparison of SLAMF9 expression levels in anti-CTLA4-resistant and non-resistant groups of mouse melanoma; Figure 1 B shows the subcutaneous tumor formation pictures of the SLAMF9 knockdown group and the negative control group; Figure 1 C shows the subcutaneous tumor growth curves of the SLAMF9 knockdown group and the negative control group; Figure 1 D shows the comparison of subcutaneous tumor weights of the SLAMF9 knockdown group and the negative control group.

[0034] Figure 2 Showing the comparison of immune cell infiltration in melanoma between the SLAMF9 knockdown group and the negative control group. Among them: Figure 2 A shows the multiplex immunofluorescence images showing the infiltration of CD8 / CD3 / PD1-positive immune cells; Figure 2Figure B shows the analysis of the proportion of immune cell infiltration by QuPath software and the performance of statistical analysis.

[0035] Figure 3 In vivo experiments were shown to demonstrate the feasibility of SLAMF9 as an immune checkpoint. Figure 3 A and Figure 3 B respectively correspond to the survival status of mice in Group A and Group B after subcutaneous tumor formation on the third day, when they were injected with anti-PD-L1 antibody (Atezolizumab) ( Figure 3 A) or CTLA4 inhibitor ( Figure 3 B). Specific implementation manners

[0036] To make the objectives, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present application. Apparently, the described embodiments are some but not all of the embodiments of the present application. All other embodiments obtained by those of ordinary skill in the art based on the embodiments in the present application without creative efforts shall fall within the scope of protection of the present application.

[0037] The reagents and cell lines involved in the experiments in the present application were all purchased from domestic and foreign markets or prepared by themselves according to the formulas in the instructions. The experimental methods not specially described were all conventional methods known in the art.

[0038] Unless otherwise specified, the experimental methods, detection methods, and preparation methods disclosed in the present application all adopt the conventional techniques in the fields of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology and related fields in the technical field.

[0039] Cell line and culture: The B16F10 cell line and 293T cells were originally from ATCC and were provided by the Cell Bank of the Chinese Academy of Sciences;

[0040] The B16F10 cell line was cultured in DMEM medium containing 10% fetal bovine serum at 37 °C and 5% CO2.

[0041] Main reagents: DMEM medium, fetal bovine serum, puromycin, 4% paraformaldehyde, Triton lysis buffer (0.5%), phosphate buffered saline (PBS), primary antibody diluent, fluorescent secondary antibody, anti-quenching mounting medium.

[0042] Embodiment

[0043] (1) Construction of lentivirus carrying SLAMF9 knockdown sequence

[0044] The present application designed 3 interfering plasmids capable of targeting SLAMF9:

[0045] 5’CTTACTGGTTAAGAGCTTGTT’3 (see Sequence Listing Seq_1),

[0046] 5’GAGGAAGGTGTCTGTAATATA’3 (see Sequence Listing Seq_2),

[0047] 5’CCCTGCATATTAGCAATCTGA’3 (see Sequence Listing Seq_3).

[0048] The interference plasmid targeting SLAMF9 was co-cultured with the lentiviral Helper plasmid (Genechem, Shanghai, China) and 293T cells using the Lipo3000 kit (Invitrogen) to construct a lentivirus carrying the SLAMF9 knockdown sequence: Under the conditions of 37 °C and 5% CO2, the interference plasmid targeting SLAMF9, Optim MEM medium (Invitrogen), the lentiviral Helper plasmid, the Lipo3000 kit, and P3000 (Invitrogen) were transfected into 293T cells. After culturing for 8 hours, the medium was replaced with fresh medium. After 48 hours, the virus was collected and centrifuged to obtain the lentivirus Slamf9-SH RNA carrying the SLAMF9 knockdown sequence.

[0049] (2) Construction of a B16F10 cell line with stable low expression of SLAMF9:

[0050] SLAMF9 knockdown group (Slamf9-SH): The lentivirus Slamf9-SH RNA carrying the SLAMF9 knockdown sequence was added to B16F10 cells in the logarithmic growth phase with stable passage and co-cultured for 8 hours. Then, the cells were cultured in DMEM medium containing 10% fetal bovine serum for 36 hours. Finally, the B16F10 cells were screened with DMEM medium containing 2.5 μg / mL puromycin for 7 to 14 days.

[0051] Negative control group (Slamf9-NC): B16F10 cells in the logarithmic growth phase with stable passage were cultured in DMEM medium for 3 days and then screened with DMEM medium containing 2.5 μg / mL puromycin for 7 to 14 days.

[0052] Detection of the SLAMF9 knockdown effect in B16F10 cells: Cells in the logarithmic growth phase were collected, and the total RNA of the Slamf9-SH group and the Slamf9-NC group cells was collected. The expression level of SLAMF9 in each group of cells was detected by Q-PCR. The results showed that Slamf9-SH RNA could significantly inhibit the expression of SLAMF9 in B16F10 cells.

[0053] (3) Establishment of subcutaneous tumor model in C57BL / 6 mice:

[0054] Twenty-four C57BL / 6 mice were purchased in advance from Huafukang Experimental Animal Company (12 mice in each of the Slamf9-SH group and the Slamf9-NC group). The cells in step (2) were expanded in culture, and the cells in the Slamf9-SH group and the Slamf9-NC group in the logarithmic growth phase were collected. The cell concentration was adjusted to 1×10 7 / mL with PBS, and 100 μL of the cell suspension was injected subcutaneously into 8- to 10-week-old female C57BL / 6 mice. The size of the subcutaneous tumors in the mice was detected every 4 days; when the diameter of the subcutaneous tumors in some mice was close to 1.5 cm, all the mice were sacrificed by cervical dislocation, the tumor masses were dissected, and weighed. The results are as Figure 1 shown. Since 2 mice in the Slamf9-NC group died for unknown reasons in the early stage after tumor formation, and 5 mice in the Slamf9-SH group did not develop tumors, Figure 1 the number of tumors in each group shown in B was less than 12. Figure 1 The results shown indicate that after SLAMF9 knockdown, the growth rate of subcutaneous tumors in mice was significantly slowed down.

[0055] (4) Multiplex immunofluorescence detection of immune cell infiltration:

[0056] The tumors in step (3) were obtained, fixed with paraformaldehyde for 24 hours, embedded in paraffin, sectioned, and subjected to multiplex immunofluorescence staining (using anti-CD8 antibody with white fluorescence, anti-CD3 antibody with green fluorescence, and anti-PD-1 antibody with red fluorescence respectively). The expression of CD8, CD3, and PD-1 in the tumors of the SLAMF9 knockdown group and the negative control group was observed under a fluorescence microscope. The results are as Figure 2 shown. The results indicate that after SLAMF9 knockdown, the infiltration ratio of CD8-, CD3-, and PD-1-positive cells was significantly increased, and the increase in CD8 was the most significant.

[0057] (5) In vivo experiments:

[0058] To prove that SLAMF9 knockdown enhances the therapeutic effect of PD-L1 and CTLA-4 immune checkpoint inhibitors on tumors: Forty-eight C57BL / 6 mice were purchased in advance from Huafukang Experimental Animal Company and were evenly divided into two large groups. Each large group of mice was evenly divided into 4 groups, with 6 mice in each small group.

[0059] Table 1 Grouping of C57BL / 6 mice

[0060]

[0061] The SLAMF9 knockdown B16F10 cells and negative control cells in the logarithmic growth phase were obtained, and the cell concentration was diluted to 5×10 6 / mL; then inject 100 μL of the cell suspension subcutaneously into female C57BL / 6 mice aged 8 - 10 weeks (grouped according to the above molecular method); on the third day after subcutaneous tumor formation, inject 200 mg of anti-PD-L1 antibody (Atezolizumab) or 200 mg of CTLA-4 inhibitor (MDK 24720) into the mice intraperitoneally, observe the survival status of the mice, and the results are as Figure 3 shown, Figure 3 A shows the survival status of the mice in Group A; Figure 3 B shows the survival status of the mice in Group B. It was found that after SLAMF9 knockdown, the therapeutic effects of anti-PD-L1 antibody and CTLA-4 inhibitor on melanoma were significantly enhanced.

[0062] The above are only specific embodiments of the present application, enabling those skilled in the art to understand or implement the present application. Various modifications to these embodiments will be obvious to those skilled in the art. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to these embodiments shown herein, but will conform to the widest scope consistent with the principles and novel features claimed herein.

Claims

1. Use of a reagent for detecting the expression level of the SLAMF9 gene in the preparation of an immunotherapy assay reagent, characterized in that: The immunotherapy test reagent is used to predict the sensitivity of melanoma patients to immunotherapy using anti-PD-L1 antibodies or CTLA-4 inhibitors.

2. A kit for predicting the sensitivity of melanoma patients to immunotherapy using anti-PD-L1 antibody or CTLA-4 inhibitor, characterized in that: The kit includes reagents for detecting the expression level of the SLAMF9 gene.

3. A device for predicting the sensitivity of melanoma patients to immunotherapy using anti-PD-L1 antibody or CTLA-4 inhibitor, characterized in that, The device includes the following two modules: An evaluation module that evaluates the expression level of the SLAMF9 gene in the tumor tissue of the melanoma patient; and A prediction module that predicts the sensitivity of melanoma patients to immunotherapy using anti-PD-L1 antibodies or CTLA-4 inhibitors based on the evaluation results of the evaluation module.

4. A computer-readable storage medium, characterized in that, It includes a program that can be executed by a processor to implement all the steps of predicting the sensitivity of melanoma patients to immunotherapy using anti-PD-L1 antibodies or CTLA-4 inhibitors, and the all steps include: Evaluating the expression level of the SLAMF9 gene in the tumor tissue of the melanoma patient; and Predicting the sensitivity of melanoma patients to immunotherapy using anti-PD-L1 antibodies or CTLA-4 inhibitors based on the evaluation results.

Images