284 results about "Biomarker (medicine)" patented technology

A system and method for an adjustable bio-stream self-selecting system. Through a plethora of inputs, the system associates therapeutic recipes and associated biomarker in a personalized approach to recommending an individual to a specific therapeutic program. Therapeutic programs operate in accordance with personalized inputs suggested by the user and through digital markers and biomarkers, which trigger new recommendations by “knowing” the individual. Each bio-stream contains information utilized within these biomarkers to trigger additional therapy recommendations. Because of the complexity of the plurality of inputs, these biomarkers are managed in a way that enables low latency detections, low bandwidth needs, low processing needs, and less battery needs. The pre-processing of these biomarkers helps additional therapy management and precision medicine across larger global population needs of the system.

The invention discloses an application of miR-378 in the preparation of a medicine or a kit for preventing or treating cardiac hypertrophy and myocardial fibrosis, and further discloses an application of the miR-378 as a heart failure biomarker. The miR-378 has a protection effect of resisting against myocardial remodeling on the heart through inhibiting cardiac hypertrophy and myocardial fibrosis, has potential prevention and treatment values on multiple heart diseases. The miR-378 is conducive to auxiliary diagnosis of the heart failure, meanwhile, due to expression difference in the blood of patients with mild and severe heart failures, the miR-378 is conducive to reflection of the disease state of the patients with heart failures, and provides a support for clinical doctors to quickly and accurately master the situations of the patients and timely take more personalized prevention and treatment schemes.

The invention discloses a multifunctional nano-composite having up-conversion luminescence, oxygen sensing and biological connectivity and a preparation method thereof, in particular relates to a multifunctional nano-composite with a core-shell structure formed by connecting a [Ru(phen)2phen-Si]Cl2 complex with NaYF4:Yb<3+> and Tm<3+> nano-particles by using a SiO2 shell and preparation thereof. The nano-composite and the method solve the problems of the single structure of composites and a complex preparation process in the conventional fields of biomedicine and biochemistry. The composite comprises the [Ru(phen)2phen-Si]Cl2 complex, SiO2, and the NaYF4:Yb<3+> and Tm<3+> nano-particles in a mass ratio of 40-100:1.1-3.3:13.4-53.4. Due to the functions of the multifunctional composite, the application of the multifunctional composite in the fields of the biomedicine, such as biomarkers, oxygen concentration measurement in organisms and the like, is enhanced.

The invention belongs to the technical field of biomedicine and relates to a micro RNA biomarker for predicting early non-metastatic colorectal cancer prognosis and a detection method. The early non-metastatic colorectal cancer refers to Dukes' A and Dukes' B glandular cancers. Particularly, the invention relates to a diagnostic kit for identifying molecular markers of one or more mammalian target cells for prognosis of different early non-metastatic colorectal cancers. The kit comprises multiple nucleic acid molecules, a miRNA sequence is encoded by each nucleic acid molecule, one or more in the multiple nucleic acid molecules have differential expressions in target cells and one or more control cells, and one or more nucleic acid molecules with differential expressions represent nucleic acid expression characteristics together, wherein the nucleic acid expression characteristics refer to indications for identifying prognosis of different early non-metastatic colorectal cancers. The invention further relates to a corresponding method for preventing or treating the disease by using the biomarker and detection method and a pharmaceutical composition.

The invention belongs to the technical field of biological medicine and relates to a detection reagent and kit for diagnosing liver cancer. The reagent is a long non-coding RNA (lncRNA) H19 detection reagent and used for detecting saliva samples. The kit using saliva as detection samples and used for diagnosing the liver cancer comprises protease and the lncRNA H19 detection reagent. The saliva detection reagent and kit has the advantages that the biomarker sensitive and specific in liver cancer diagnosing is found in the saliva for the first time, and great significance to early detection and treatment of the liver cancer, death rate lowering and China medical burden relieving is achieved.

The invention belongs to the field of medicines, and relates to an application of a method for degrading all carbohydrate chains in the blood to be monosaccharide and detecting the monosaccharide in cancer detection. A sample in the method for degrading the blood to obtain the monosaccharide and detecting the monosaccharide is the blood, and the cancer includes lung cancer, gastric cancer, ovarian cancer, penis cancer, esophagus cancer, oral cancer, biliary duct cancer, breast cancer, adenocarcinoma perampullaire, rectal cancer and bladder cancer. The method has the characteristics of simplicity and easiness in operation steps, easiness in popularization, short detection time, low requirement on the instrument, low detection cost, less consumption of blood and the like. The result displays that based on the content of eight monosaccharides in the blood, not only can a normal person and a cancer patient be distinguished, but also different cancers can be distinguished. The method for simplifying glycomics knowledge and applying in the detection of the biomarker of blood is first created in the world.

The invention provides a biomarker combination and a kit for predicting breast cancer. Primer design genes are chosen from four types of telomere genes with the most obvious methylation rate difference in breast cancer tissues and normal tissues. According to the promoter regions and coding regions of the four types of telomere genes, methylation primers and qPCR (Quantitative Polymerase Chain Reaction) primers of a target gene are respectively designed, and thereby a methylation primer combination and a qPCR primer combination are formed. Since the biomarker combination provided by the invention is designed according to the telomere genes with the most obvious methylation rate difference in the breast cancer tissues and the normal tissues, when whether a sample is breast cancer is assayed, the biomarker combination can specifically capture and amplify specific DNA fragments in the assayed sample, so that the sensitivity of assay is increased, and the biomarker combination has good noise immunity, flexibility and accuracy, and can be used in the early prediction of the breast cancer, the evaluation and assay of medicines for treatment and the detection of prognosis recurrence. The method for predicting the breast cancer provided by the invention has the advantages of quickness in operation, simplicity, convenience and good feasibility and prediction effect.

The invention belongs to the field of biotechnology and medicine and specifically relates to correlation and application of a CircRNA PVT1 (hsa _ circ_ 0001821) nucleic acid fragment and a CircRNA PVT1 translated peptide fragment PVT1-104aa in tumor growth prediction, metastasis prediction, prognosis evaluation and treatment. The CircRNAPVT1 and PVT1-104aa are used as drug targets for early diagnosis of tumors, treatment of tumors, alleviation or prevention of tumor metastasis and/or improvement of tumor prognosis. The tissue specificity and stability of CircRNA provided by the invention enable CircRNA to become a good biomarker, and tests prove that the CircRNA PVT1 nucleic acid fragment and the peptide fragment PVT1-104aa play a significant and stable role in tumor growth prediction, metastasis prediction, prognosis evaluation and treatment.

The invention relates to a serological biomarker miR-19a for detecting the coronary heart disease and application of the serological biomarker miR-19a, belonging to the fields of laboratory medicines, clinical medicines, biotechnology, biochemistry and molecular biology. The miRNA sequence is as follows: miR-19a: UGUGCAAAUCUAUGCAAAACUGA. The invention further discloses application of the miR-19a. The miR-19a is used for preparing a reagent product for screening the coronary heart disease or assisting coronary heart disease pathological authentication, biochemical detection and clinical diagnosis. The reagent product comprises a primer system and a primer probe system, wherein the primer system consists of cDNA amplification primers of the miR-19a; the primer probe system consists of the cDNA amplification primers of the miR-19a and a probe. The biomarker miR-19a molecule is closely related with the occurrence and the development of the coronary heart disease; and serving as the biomarker for predicating the occurrence of the coronary heart disease and judging the development degree of the coronary heart disease, compared with the existing normal pathological type diagnosis for an attack of the coronary heart disease and prognosis, the serological biomarker miR-19a can be used for predicating the early-stage morbidity and the malignancy degree of the coronary heart disease individually and accurately.

The invention discloses a recurrent spontaneous abortion biomarker and applications thereof, and belongs to the technical field of biomedicine. The circular RNA used for diagnosing recurrent spontaneous abortion is hsa_circRNA_100737, can be highly expressed in human RSA villi tissue in early pregnancy, can regulate the expression of IL-34 through miR-28-5p and can influence the proliferation, invasion and tube-forming functions of trophoblast through a miR-28-5p-IL-34 axis. The differential expression of the hsa_circRNA_100737 in normal early pregnancy and RSA villi tissue is taken as a breakthrough point to discuss the influences of the hsa_circRNA_100737 on the biological behavior of the trophoblast and mechanisms and to research whether the function of the hsa_circRNA_100737 of regulating the trophoblast can influence maternal-fetal immune tolerance, so that the pathogenesis of RSA can be hopefully analyzed, and new ideas can be provided for the prevention and treatment of diseasessuch as the RSA.

The invention discloses an erythrocyte cluster for enriching circulating tumor cells (CTCs) based on a size filtering method, and belongs to the technical field of biological medicine. By designing amicron-level CTCs targeting biomimetic material, erythrocytes are combined with a micro-sphere to obtain an erythrocyte cluster type biomimetic material; the surface of each erythrocyte is modified with polybrene, thereby eliminating original electrostatic repulsion between the erythrocytes, and then, dense full-layer coverage of the erythrocytes on the surface of the micro-sphere can be realized.Wrapping the micro-sphere with the erythrocytes can avoid non-specific adsorption of leukocytes on the surface of the microsphere; meanwhile, folic acid (FA) modifying the surface of erythrocyte cluster or an antibody which can specifically recognize and bind surface biomarkers of the CTCs can directly target the CTCs to achieve increase of sizes of the CTCs, and accordingly, leukocytes in a blood sample of a clinical patient can be finally removed in a manner of filtering, and the high-purity CTCs are obtained efficiently.

The invention belongs to the technical field of biology and diagnosis, and relates to a receptor of a definite, effective and visualized platelet reactivity biomarker P2Y12 and an application thereof for diagnosing and predicting the II-type diabetic vascular complication risk. The platelet activation biomarker P2Y12 can detect expression levels of platelet through fluorescent quantitative polymerase chain reaction (PCR), Western blot, enzyme linked immunosorbent assay (ELISA), flow cytometry, UV spectrophotometry-near infrared spectrometry, high performance liquid chromatography, colorimetry, a mass spectrum identification method and the like and detect content of P2Y12 in whole blood. The invention also provides a method of biomarker P2Y12 for diagnosing and predicting vascular complication of subjects as well as a medicine for treating II-type diabetic vascular complication and a screening method of the medicine. The invention further provides an intervene plane for individualizing P2Y12 inverse agonist and accurately treating the vascular complication of II-type diabetic patients.

The invention belongs to the field of medicine, and particularly relates to application of GALNT2 as a biomarker in the treatment and/or prognosis of glioma. GALNT2 promotes malignant progression of the glioma by affecting O-type glycosylation and phosphorylation of EGFR and affecting the downstream PI3K/Akt passage. Therefore, GALNT2 can serve as the novel biomarker and a potential target for future glioma treatment.

The invention belongs to the field of biomedicine and relates to a blood exosome molecular marker and application thereof in the preparation of liver cancer diagnostic products, in particular a bloodexosome (miR-519 and/or miR-521) molecular marker associated with liver cancer diagnosis and application thereof in the preparation of liver cancer diagnostic products, with miR-519a being CCUCUAGAGGGAAGCGCUUUCU and miR-521 being AACGCACUUCCCUUUAGAGUGU. The blood Exo-miR-519a and/or Exo-miR-521 is a novel biomarker, having good stability, causing minimal invasion, having good convenience of detection and good quantification precision; disease diagnostic sensitivity and specificity can be improved greatly; the development of the biomarker herein helps diagnose liver cancer and warn about metastasis risk, and references are provided for the research and development of other tumor like biomarkers.

The invention belongs to the technical field of tumor biological gene therapy, and relates to a bladder cancer diagnosis and treatment biomarker and a target spot, in particular to application of circ-SLC38A1 as a target spot in a bladder cancer cell inhibition medicine. The invention discloses an expression condition of circ-SLC38A1 in tumor tissues of a bladder cancer patient and a function of circ-SLC38A1 in bladder cancer cells. It is found for the first time that circ-SLC38A1 can be used as a bladder cancer diagnosis biomarker and a drug therapy target. Compared with normal control, circ-SLC38A1 is significantly up-regulated in tumor tissues of bladder cancer patients. The result of the invention shows that interference on circ-SLC38A1 can inhibit the migration and invasion ability ofbladder cancer cells, and it is shown that the circ-SLC38A1 plays a role of a cancer-promoting gene in the occurrence and development of bladder cancer, and provides a new target for clinical treatment of bladder cancer.

The invention relates to the technical field of bio-medicine, in particular to application of PINK1 serving as a diagnostic marker in construction of a lung squamous cell carcinoma prognosis prediction model. The biomarker PINK1 and other clinical indexes are used in a combined mode, and lung squamous cell carcinoma prognosis detection can be assisted. According to the invention, screening and construction are carried out after full transcriptome sequencing and machine learning of a lung squamous cell carcinoma specimen based on large-sample anti-tumor immuno-therapy, so that the prognosis condition of a lung squamous cell carcinoma patient can be efficiently and accurately predicted; and meanwhile, according to the correlation between the risk and different immune cell infiltration levels, immune-related pathways, key immune checkpoint inhibitor expression levels and the like, comprehensive evaluation of the tumor immune micro-environment is achieved, effective guidance is provided for clinicians to make a treatment decision on lung squamous cell carcinoma patients, invalid treatment is reduced, and therefore, the treatment cost and discomfort experience of the patients are reduced.

The invention belongs to the technical field of biological medicines, particularly relates to application of protein/gene IFI30 related to breast cancer occurrence and development, and particularly provides application of the protein/gene IFI30 related to breast cancer occurrence and development, especially application value of the protein/gene IFI30 as a breast cancer molecular typing marker andapplication of the protein/gene IFI30 in preparation of a breast cancer molecular typing kit. The invention also provides a method for screening potential drugs for treating breast cancer. Whether thecandidate is a potential drug for treating breast cancer or not is judged by adjusting the expression level of the biomarker.

The present invention relates to uses of nucleolin as a biomarker of liver cancer, comprising predicting, detecting, diagnosing or monitoring liver cancer, high risk of liver cancer, or high risk of vascular invasion of hepatoma cells in a subject, and assessing prognosis of a subject suffered from liver cancer by nucleolin expression level. The biomarkers for determining expression level of nucleolin, kit for determining liver cancer, high risk of liver cancer, or high risk of vascular invasion of hepatoma cells in a subject by expression level of nucleolin, and use of small interfering RNA or antibody specific for recognizing nucleolin in manufacturing medicine for treating liver cancer are also included in the present invention.