Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of miR-378 in inhibition of cardiac hypertrophy and myocardial fibrosis and diagnosis of heart failure

A myocardial fibrosis, 1.mir-378 technology, applied in the field of miR-378 to inhibit myocardial hypertrophy and myocardial fibrosis, can solve the problem of limited number of serum miRNAs, and achieve the effect of improving sensitivity and specificity

Inactive Publication Date: 2017-05-31
ZHONGSHAN HOSPITAL FUDAN UNIV
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the miRNA molecular diagnostic reagents developed in different stages of heart failure and heart failure are still in their infancy, and the number of serum miRNAs found to be related to heart failure is extremely limited. Disease prevention and treatment are very important

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miR-378 in inhibition of cardiac hypertrophy and myocardial fibrosis and diagnosis of heart failure
  • Application of miR-378 in inhibition of cardiac hypertrophy and myocardial fibrosis and diagnosis of heart failure
  • Application of miR-378 in inhibition of cardiac hypertrophy and myocardial fibrosis and diagnosis of heart failure

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 miR-378 can inhibit myocardial remodeling caused by pressure overload

[0037] C57B / L6 mice from 8 weeks to 10 weeks were established by aortic constriction method (TAC) to establish a mouse pressure overload myocardial remodeling model. After TAC, the mimics of chemically modified miR-378 and miR-378 were injected intravenously for three consecutive days. Inhibitor (80mg / kg).

[0038] Specifically, there are 8-10 animals in each group, the sequence of the mimic is 5'-ACUGGACUUGGAGUCAGAAGG-3' (antisense strand) 5'-UUCUGACUCCAAAGUCCAGUUU-3' (SEQ No.2), the mimic is modified on the antisense strand, 3 Cholesterol modification at the 'end, two thio-skeleton modifications at the 5'-end, four-thio-skeleton modification at the 3'-end, and full-chain methoxy modification. The miR-378 inhibitor sequence is 5'-CCUUCUGACUCCAAAGUCCAGU-3'(SEQ No.3), with cholesterol modification at the 3' end, two thio-skeleton modifications at the 5' end, four thio-skeleton modification...

Embodiment 2

[0040] Preparation of Example 2miR-378 Gene Knockout Mice

[0041] Construct the sgRNA vector, use the tool carrier pUC57-sgRNA (51132; Addgene, Cambridge, MA), the synthesized sgRNA single strand is combined into a small fragment by annealing and renaturation, and inserted into the BsaI linearized vector, the target target position sequence is 5' -GGCTCAGAGCTGAGCGGGAATGG-3' (SEQ No.4), the synthetic gRNA single strands are: M-mir378-be-gR-top:TAGGCTCAGAGCTGAGCGGGAA (SEQ No.5) and M-mir378-be-gR-dow:AAACTTCCCGCTCAGCTCTGAG( SEQ No.6). The constructed sgRNA vector is transcribed in vitro into injectable sgRNA.

[0042] The CAS9 vector was constructed, and the CAS9 expression plasmid was transcribed into injectable Cas9-RNA in vitro using T7Ultra kit (AM1345; Thermo Scientific, Waltham, MA) after linearization with PmeI.

[0043] Thirty 3-4 week-old C57BL / 6J mice were injected with hormones for superovulation, and about 250 fertilized eggs were injected (injected twice, 150 for...

Embodiment 3

[0057] Example 3 miR-378 knockout mice showed more severe myocardial hypertrophy and myocardial fibrosis in pressure overload stimulation than wild mice

[0058] The miR-378 gene knockout mice (KO) and wild type mice (WT) from 8 to 10 weeks were constructed by aortic constriction (TAC) to establish a mouse pressure overload myocardial remodeling model. After 2 weeks, echocardiography Cardiac function indicators include diastolic left ventricular posterior wall thickness, left ventricular diastolic diameter, ejection fraction, and heart-to-weight ratio; HE staining and collagen staining were performed by immunohistochemistry. The results showed that the degree of myocardial hypertrophy and fibrosis in miR-378 knockout mice was aggravated compared with that in wild-type mice (see Figure 7 , Figure 9 , Figure 10 ), and the cardiac function reflected by the ejection fraction was significantly decreased (see Figure 8 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of miR-378 in the preparation of a medicine or a kit for preventing or treating cardiac hypertrophy and myocardial fibrosis, and further discloses an application of the miR-378 as a heart failure biomarker. The miR-378 has a protection effect of resisting against myocardial remodeling on the heart through inhibiting cardiac hypertrophy and myocardial fibrosis, has potential prevention and treatment values on multiple heart diseases. The miR-378 is conducive to auxiliary diagnosis of the heart failure, meanwhile, due to expression difference in the blood of patients with mild and severe heart failures, the miR-378 is conducive to reflection of the disease state of the patients with heart failures, and provides a support for clinical doctors to quickly and accurately master the situations of the patients and timely take more personalized prevention and treatment schemes.

Description

technical field [0001] The present invention relates to the use of myocardial endogenous non-coding small RNA to protect the heart, in particular to the use of miR-378 to inhibit myocardial hypertrophy and myocardial fibrosis and to diagnose heart failure. Background technique [0002] Cardiovascular disease is the number one killer of human health today. In China, the prevalence of cardiovascular disease is on the rise. Myocardial remodeling is an independent risk factor leading to cardiovascular disease morbidity and mortality. Controlling the occurrence and development of myocardial remodeling is a key link in the prevention and treatment of heart failure, and it is one of the important tasks of medicine and biology in the prevention and treatment of cardiovascular diseases. [0003] Myocardial remodeling is a critical period for the evolution of cardiac function from compensatory to decompensated, and also a critical stage in the development of cardiac structure from re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00A61K31/713A61K47/54A61P9/00A61P9/04C12Q1/68
CPCA61K31/713C12Q1/6883C12Q2600/158C12Q2600/178
Inventor 苑洁邹云增张莉丁志文
Owner ZHONGSHAN HOSPITAL FUDAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More