Application of miR-378 in inhibition of cardiac hypertrophy and myocardial fibrosis and diagnosis of heart failure
A myocardial fibrosis, 1.mir-378 technology, applied in the field of miR-378 to inhibit myocardial hypertrophy and myocardial fibrosis, can solve the problem of limited number of serum miRNAs, and achieve the effect of improving sensitivity and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 miR-378 can inhibit myocardial remodeling caused by pressure overload
[0037] C57B / L6 mice from 8 weeks to 10 weeks were established by aortic constriction method (TAC) to establish a mouse pressure overload myocardial remodeling model. After TAC, the mimics of chemically modified miR-378 and miR-378 were injected intravenously for three consecutive days. Inhibitor (80mg / kg).
[0038] Specifically, there are 8-10 animals in each group, the sequence of the mimic is 5'-ACUGGACUUGGAGUCAGAAGG-3' (antisense strand) 5'-UUCUGACUCCAAAGUCCAGUUU-3' (SEQ No.2), the mimic is modified on the antisense strand, 3 Cholesterol modification at the 'end, two thio-skeleton modifications at the 5'-end, four-thio-skeleton modification at the 3'-end, and full-chain methoxy modification. The miR-378 inhibitor sequence is 5'-CCUUCUGACUCCAAAGUCCAGU-3'(SEQ No.3), with cholesterol modification at the 3' end, two thio-skeleton modifications at the 5' end, four thio-skeleton modification...
Embodiment 2
[0040] Preparation of Example 2miR-378 Gene Knockout Mice
[0041] Construct the sgRNA vector, use the tool carrier pUC57-sgRNA (51132; Addgene, Cambridge, MA), the synthesized sgRNA single strand is combined into a small fragment by annealing and renaturation, and inserted into the BsaI linearized vector, the target target position sequence is 5' -GGCTCAGAGCTGAGCGGGAATGG-3' (SEQ No.4), the synthetic gRNA single strands are: M-mir378-be-gR-top:TAGGCTCAGAGCTGAGCGGGAA (SEQ No.5) and M-mir378-be-gR-dow:AAACTTCCCGCTCAGCTCTGAG( SEQ No.6). The constructed sgRNA vector is transcribed in vitro into injectable sgRNA.
[0042] The CAS9 vector was constructed, and the CAS9 expression plasmid was transcribed into injectable Cas9-RNA in vitro using T7Ultra kit (AM1345; Thermo Scientific, Waltham, MA) after linearization with PmeI.
[0043] Thirty 3-4 week-old C57BL / 6J mice were injected with hormones for superovulation, and about 250 fertilized eggs were injected (injected twice, 150 for...
Embodiment 3
[0057] Example 3 miR-378 knockout mice showed more severe myocardial hypertrophy and myocardial fibrosis in pressure overload stimulation than wild mice
[0058] The miR-378 gene knockout mice (KO) and wild type mice (WT) from 8 to 10 weeks were constructed by aortic constriction (TAC) to establish a mouse pressure overload myocardial remodeling model. After 2 weeks, echocardiography Cardiac function indicators include diastolic left ventricular posterior wall thickness, left ventricular diastolic diameter, ejection fraction, and heart-to-weight ratio; HE staining and collagen staining were performed by immunohistochemistry. The results showed that the degree of myocardial hypertrophy and fibrosis in miR-378 knockout mice was aggravated compared with that in wild-type mice (see Figure 7 , Figure 9 , Figure 10 ), and the cardiac function reflected by the ejection fraction was significantly decreased (see Figure 8 ).
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



