Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Blood exosome molecular marker and application thereof in preparation of liver cancer diagnostic products

A technology of molecular markers and exosomes, applied in the field of biomedicine, can solve problems such as relying on tissue biopsy, achieve convenient non-invasive diagnosis methods, improve sensitivity and specificity, and be easy to detect

Active Publication Date: 2019-08-16
ZHEJIANG UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, as a structure inside the nucleus, the detection of PNC depends on tissue biopsy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Blood exosome molecular marker and application thereof in preparation of liver cancer diagnostic products
  • Blood exosome molecular marker and application thereof in preparation of liver cancer diagnostic products
  • Blood exosome molecular marker and application thereof in preparation of liver cancer diagnostic products

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1 Preparation of exosomes

[0060] When the liver cancer cell lines Huh7 and HepG2, and the normal liver cell line HL-7702 were conventionally cultured to a density of about 40%, they were washed twice with PBS and then cultured in a culture system supplemented with exosome-free serum. After 48 hours, the cell supernatant was collected, and the exosomes were separated and prepared by ultracentrifugation. Centrifuge at 300g at 4°C for 10 minutes; take the supernatant and centrifuge again (4°C, 2000g, 10 minutes); take the supernatant and centrifuge again (4°C, 10,000g, 30 minutes). The precipitate was discarded, and the supernatant was centrifuged at 100,000g for 70 minutes; the collected precipitate was resuspended in PBS, and then centrifuged again (100,000g, 70 minutes), and the obtained precipitate was cell exosomes.

[0061] Collect anticoagulant and non-anticoagulant blood from patients or medical examiners, centrifuge at 2000 rpm for 10 minutes at 4°C, se...

Embodiment 2

[0062] Example 2 Identification of exosomes

[0063] The particle size of cell supernatant and plasma or serum exosomes was analyzed by NTA method (Nanoparticle Tracking Analysis: nanoparticle tracking analysis method). The particle size range is 35-135nm. The exosome markers on the surface were detected by Western Blot or magnetic bead method (flow cytometry). Western Blot detection showed that the isolated Huh7 cells and the plasma and serum exosomes of patients with liver cancer all expressed CD63, CD9 and CD81.

Embodiment 3

[0064] Example 3 Analysis of the expression level of exosome miR-519a

[0065] Collect exosomes from Huh7, HepG2, and HL-7702 cells, or exosomes from liver cancer patients and healthy controls, resuspend them in 200 μL of PBS, place them on ice, and add 200 μL of 2X Denaturing Solution from Thermo Fisher to mix. and then add 25 fmol of external reference Cel-miR-39. Then miRVana miRNA extraction kit from Thermo Fisher Company was used to separate and prepare miRNA. Then, the miRNA reverse transcription kit was used, and the reverse transcription primer of miR-519a (CAGCATAGGTCACGCTTATGGAGCCTGGGACGTGACCTATGCTGCAGAAA) was used for reverse transcription. The reaction program was: 15 minutes at 42°C, 5 seconds at 85°C. The PCR detection primer pair of miR-519a was then used for fluorescence quantitative PCR detection. The PCR system was: 2×SYBR Green Mix-10 μl; miR-519a upstream primer (GCCGGGCTCTAGAGGGAAGCGC) 5 μM-0.8 μl; miR-519a downstream universal primer ( GTCACGCTTATGGAGCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Particle sizeaaaaaaaaaa
Particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of biomedicine and relates to a blood exosome molecular marker and application thereof in the preparation of liver cancer diagnostic products, in particular a bloodexosome (miR-519 and / or miR-521) molecular marker associated with liver cancer diagnosis and application thereof in the preparation of liver cancer diagnostic products, with miR-519a being CCUCUAGAGGGAAGCGCUUUCU and miR-521 being AACGCACUUCCCUUUAGAGUGU. The blood Exo-miR-519a and / or Exo-miR-521 is a novel biomarker, having good stability, causing minimal invasion, having good convenience of detection and good quantification precision; disease diagnostic sensitivity and specificity can be improved greatly; the development of the biomarker herein helps diagnose liver cancer and warn about metastasis risk, and references are provided for the research and development of other tumor like biomarkers.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to blood exosome (miR-519 and / or miR-521) molecular markers related to the diagnosis of liver cancer and its application in the preparation of liver cancer diagnosis products. Background technique [0002] Liver cancer is one of the common malignant tumors in human beings, and its mortality rate has always been high, ranking third among all tumor-related causes of death. The main reasons are as follows: First, the base is huge. There are 500,000 to 1 million new cases worldwide every year, and about 700,000 people die of liver cancer, and the 5-year mortality rate exceeds 90%. More than half of the global liver cancer cases are in China, so liver cancer has a high incidence and high risk in my country. The recurrence rate of liver cancer patients after treatment is high, according to statistics, the recurrence rate is as high as 60-70% within 5 years after surgery. Among the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/118C12Q2600/158C12Q2600/178
Inventor 刘艳宁郑敏楼国华
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com