Liver cancer diagnosing reagent and kit using saliva as detection samples

A detection reagent and saliva detection technology, applied in the field of biomedicine

Pending Publication Date: 2015-12-09
THE THIRD AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, whether salivary lncRNA can be used as a biomarker to assist in the diagnosis of liver cancer has not yet been reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Liver cancer diagnosing reagent and kit using saliva as detection samples
  • Liver cancer diagnosing reagent and kit using saliva as detection samples
  • Liver cancer diagnosing reagent and kit using saliva as detection samples

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Saliva collection

[0038] Before saliva collection, the research individual should fast, drink, smoke, and clean the mouth for more than 2 hours.

[0039] In order to increase the amount of saliva collected, a sterile cotton swab was moistened with a 2% citric acid solution, and then the cotton swab was placed on the posterior side wall of one side of the individual’s tongue for about 5 seconds. After saliva was spit out, the cotton swab was placed on the other side. The posterior wall of the tongue. Collect repeatedly like this. The saliva collection volume needs to be more than 5ml, and the collection tube uses a 50ml sterile enzyme-free centrifuge tube. Centrifuge at 4°C at 3000g for 15min to take the supernatant from the upper layer to a 1.5ml Eppendoff tube, then centrifuge at 4°C at 12000g for 10min, then discard the precipitate and take the supernatant. All specimens were stored at -80℃ after processing.

Embodiment 2

[0040] Example 2 Extraction of total RNA from saliva

[0041] 1. Divide 1ml of saliva into two 1.5ml non-enzyme EP tubes equally, that is, each EP tube contains 500μl of saliva, then add 15μl of proteinase K (20mg / ml) to each EP tube and mix well , Incubate overnight in a 65 ℃ water bath. Because saliva contains more proteins such as digestive enzymes, which affect the subsequent extraction of salivary RNA, this method can remove the influence of salivary proteins on the experiment.

[0042] 2. Add 0.5ml of acid phenol and chloroform mixture (the main components are hydrochloric acid, phenol and chloroform) to the above saliva mixture in each of the two EP tubes.

[0043] Configuration of acid phenol chloroform

[0044] 2.1 The ratio of phenol to chloroform is 5:1

[0045] 2.2 Adjust the pH value with concentrated hydrochloric acid, the pH value is set at about 4.5, this pH value is most conducive to the extraction of RNA. Mix well.

[0046] 3. Shake well for 30 to 60 seconds after ad...

Embodiment 3

[0058] Example 3 Saliva lncRNAH19 reverse transcription and expression detection

[0059] 1. Reverse transcription reaction of saliva H19

[0060] Take 2μL RNA for reverse transcription. After reacting at 65°C for 5 min, immediately ice bath for 2 min.

[0061] Add 2μl 5×RTBuffer, 0.5μl EnzymeMix, 0.5μl PrimerMix (all Toyobo products, catalog number FSK-100) and 5μl DEPC-treated nuclease-free water to the above 2μL RNA, and then continue reverse transcription at 37℃ for 15min. ,98℃5min,4℃∞.

[0062] 2. Saliva RNAH19 expression detection (qPCR reaction)

[0063] Take 3μL of the reverse transcription product as a template, and use SYBRPremixExTaqⅡ Kit (TaKaRa Company, Item No. RB820A) for RT-qPCR detection. Add 9μL of 5×SYBRPremixBuffer, 0.8μL of upstream primer, 0.8μL of downstream primer, and 6.4 to 20μL reaction system. μL Enzyme-free water treated with DEPC.

[0064] Upstream primer sequence SEQIDNO.1: TGCTGCACTTTACAACCACTG

[0065] Downstream primer sequence SEQIDNO.2: ATGGTGTCTTTGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological medicine and relates to a detection reagent and kit for diagnosing liver cancer. The reagent is a long non-coding RNA (lncRNA) H19 detection reagent and used for detecting saliva samples. The kit using saliva as detection samples and used for diagnosing the liver cancer comprises protease and the lncRNA H19 detection reagent. The saliva detection reagent and kit has the advantages that the biomarker sensitive and specific in liver cancer diagnosing is found in the saliva for the first time, and great significance to early detection and treatment of the liver cancer, death rate lowering and China medical burden relieving is achieved.

Description

Technical field [0001] The invention belongs to the field of biomedicine, and relates to a reagent and a kit for diagnosing liver cancer. Background technique [0002] my country is a big country with liver cancer, and the incidence and mortality of liver cancer account for more than half of the world. The accurate diagnosis of liver cancer has important practical significance. [0003] Currently, the biomarker commonly used internationally to screen for liver cancer is serum AFP (alpha-fetoprotein). But the sensitivity is only 39% to 65%, and the specificity is only 76% to 94%. Because of its poor sensitivity and specificity in detecting liver cancer, the US treatment guidelines do not recommend serum AFP for the diagnosis of liver cancer. Both Chinese and European treatment guidelines point out that the AFP level of a normal individual should be less than 20ng / ml, and greater than 400ng / ml can indicate the diagnosis of liver cancer. And 20 to 400ng / ml is the "grey area" of di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/10
CPCC12Q1/6886C12Q1/6806C12Q2600/178
Inventor吴斌
OwnerTHE THIRD AFFILIATED HOSPITAL OF SUN YAT SEN UNIV