Application of LINC024724 as colorectal cancer diagnosis marker and treatment target

A colorectal cancer, long-chain non-coding technology, applied in the field of colorectal cancer diagnostic markers and therapeutic targets, can solve problems such as bleeding and infection, high cost, and radiation dose accumulation

Active Publication Date: 2021-02-26
THE SECOND HOSPITAL OF SHANDONG UNIV
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the clinical methods for the diagnosis of colorectal cancer are mainly rectoscopy and imaging examination. However, rectoscopy is an invasive examination, and there are risks of bleeding and infection.
There are problems such as radiation dose accumulation and high cost in judging lymph node metastasis by imaging examination

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of LINC024724 as colorectal cancer diagnosis marker and treatment target
  • Application of LINC024724 as colorectal cancer diagnosis marker and treatment target
  • Application of LINC024724 as colorectal cancer diagnosis marker and treatment target

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] This example provides the application of LINC02474 in the diagnosis of colorectal cancer based on the study of the expression of LINC02474 in colorectal cancer and its regulatory effect on the biological function of colorectal cancer.

[0041] The corresponding deoxyribonucleotide sequence of LINC02474 is shown below, which is derived from human chromosome 1, and its position is as follows: figure 1 shown.

[0042] >NR_149071.1 Homo sapiens long intergenic non-protein coding RNA 2474(LINC02474), long non-coding RNA

[0043] CCTCCTGCTCTTTGCTCCGTGAGAAAGATCCACCTACGACCTCAGGTCCTCAGACCGACTAGCCCAAGAAACATCTCACCAATTTCAAATCTGACCTTTGCAAGAGGGTCCGAGACATTTGCATCATCATTCAGTGAGACCTGTAAACACAGCATCTGCCTTTGACCACATCCATCTGGAAGAACCTGAGAGATAATCCATTTTATGAAATTTTCCCTACCCTGAAATGGGAGAATGAATCTAATTTGAAGCACTGAGAAGGATAAGGCATCCATTTGAAAAGGACTCCTATATTGCAACATGAATTCTGCTAAAATTGAAGCAAGAACAAACATCAAATTTATGATGAAGTTTGGGTAGAAGAACGATGAAATTAGTGACGCTTTATAAAAAGTTTATTGGGACAATACCCCAAATGAATCAGCAGTTTAAAAATGGATA。

[0044] I...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of biological medicines, and relates to a colorectal cancer diagnosis marker and a treatment target and application thereof. The invention firstly providesthat LINC02474 can be used as the colorectal cancer diagnosis marker and the treatment target, and provides a new thought for diagnosis and treatment of colorectal cancer. Researches show that compared with normal control, LINC02474 is remarkably up-regulated in tumor tissues of a patient with colorectal cancer, and the biomarker provided by the invention has relatively high accuracy. Results show that interfering LINC02474 can inhibit migration and invasion abilities of colorectal cancer cells, and prove that LINC02474 plays a role in promoting cancer genes in occurrence and development of colorectal cancer, provides a new thought for clinical treatment of colorectal cancer, and is expected to obtain a diagnosis and treatment scheme which is more acceptable to patients and is clinicallyfeasible.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and relates to a colorectal cancer diagnostic marker, a therapeutic target and an application thereof. Background technique [0002] Long non-coding RNA is a kind of highly conserved long-chain non-coding RNA molecule that does not encode protein itself and has a transcript length of more than 200 nt. It can be expressed in a tissue-specific or developmental stage-specific manner. Participate in the regulation of genes at multiple levels (epigenetic regulation, transcriptional regulation, and post-transcriptional regulation, etc.). In recent years, long noncoding RNAs have attracted the interest of biomedical researchers due to their wide range of biological functions, and their functions are being continuously analyzed. [0003] The biological functions of long non-coding RNAs are mainly divided into the following three categories: (1) the role of long non-coding RNAs in transcriptional r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/6851C12N15/11A61K31/713A61P35/00
CPCA61K31/713A61P35/00C12Q1/6851C12Q1/6886C12Q2600/118C12Q2600/158C12Q2600/166C12Q2600/178C12Q2521/107C12Q2531/113C12Q2545/101C12Q2563/107
Inventor 杜鲁涛王传新杜甜甜李娟王允山
Owner THE SECOND HOSPITAL OF SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap