Use of cyp19a1 protein in preparation of drugs for preventing and / or treating diabetes
By constructing a recombinant plasmid expressing the CYP19A1 protein and transforming it into probiotics, the problems of hypoglycemic side effects and low cure rates of complications in existing diabetes drugs were solved, achieving highly efficient blood glucose reduction and improvement of diabetic complications through oral administration.
Patent Information
- Application Number
- CN202111335703.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-11-11
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2041-11-11
AI Technical Summary
Existing diabetes medications have problems such as hypoglycemic side effects and low cure rates for complications, and most require lifelong medication. Biologics, especially small molecule peptides, have limited therapeutic effects.
A recombinant plasmid expressing the CYP19A1 protein was constructed and converted into probiotics to form recombinant probiotics, which were then administered orally for the treatment of diabetes and its complications.
It significantly reduced blood glucose levels in diabetic mice, improved diabetic complications such as diabetic nephropathy and cardiovascular disease, provided a new treatment option, avoided the hypoglycemic side effects of conventional drugs, and demonstrated significant therapeutic and preventive effects.
Smart Images

Figure CN115814067B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biopharmacy, and in particular to the use of CYP19A1 protein, recombinant plasmid expressing CYP19A1 protein, and recombinant probiotics expressing CYP19A1 protein in the preparation of a drug for preventing and / or treating diabetes. BACKGROUND
[0002] Diabetes is a metabolic disease characterized by high blood sugar, mainly caused by insulin secretion defects or impaired biological effects. According to the latest global diabetes map published by the International Diabetes Federation (IDF), the number of global diabetes patients reached 425 million by the end of 2017, and is expected to reach 629 million by 2045. The number of global diabetes patients is showing a sustained upward trend. Diabetes can be divided into two types, type 1 diabetes and type 2 diabetes, according to the age of onset, symptoms and treatment of patients. Type 1 diabetes is insulin-dependent diabetes, and the autoimmune reaction damages the beta cells of the islets of Langerhans, resulting in absolute lack of insulin secretion, which is mainly seen in children and adolescents, and must be treated with exogenous insulin. Type 2 diabetes is a non-insulin-dependent diabetes, and the beta cells of the islets of Langerhans are defective, resulting in relative lack of insulin secretion and insulin resistance, which is mainly seen in obese adults, and can be controlled by diet control or oral hypoglycemic drugs. The typical symptoms of diabetes are persistent hyperglycemia and long-term metabolic disorders, but persistent hyperglycemia and long-term metabolic disorders can cause damage to the whole body and organs, and produce a series of complex complications, such as diabetic nephropathy, cardiovascular disease, retinopathy, gestational diabetes, etc., which seriously endanger human health.
[0003] The main non-insulin drugs for treating type 2 diabetes and its complications in the clinic at present are biguanides, sulfonylureas, non-sulfonylurea insulin secretagogues, insulin sensitizers and alpha-glucosidase inhibitors. The common serious side effect of hypoglycemic drugs is hypoglycemia. Alpha-glucosidase inhibitors, biguanides and insulin sensitizers alone generally do not cause hypoglycemia, but hypoglycemia can still occur when they are used in combination with other drugs. In addition to this, patients may experience strong hunger, nausea, cold sweats, palpitations, and tremors of the hands and feet during medication. In addition, the existing hypoglycemic drugs have a very low cure rate for diabetic complications, and most patients need to take medication for life to control blood sugar. As can be seen from the above drugs, the drugs for treating type 2 diabetes include chemical drugs and biological drugs. For biological drugs, especially small molecule peptides for treating diabetes, researchers have done a lot of research. For example, patent (CN00115770.1) discloses a new polypeptide-human non-insulin-dependent diabetes-related protein 25, polynucleotides encoding the polypeptide and methods for producing the polypeptide by DNA recombination. And specifically disclosed the polypeptide can be used for treating a variety of diseases, such as type II diabetes, diabetic complications, and other types of diabetes, etc. Patent (PCT / KR2009 / 004827) discloses a GYG (Gly-Tyr-Gly) peptide and a silk peptide containing the peptide as an effective component for treating or preventing diabetes, and the silk peptide containing the peptide has activity for treating diabetes.
[0004] CYP19A1 is a gene encoding aromatase in the cytochrome P450 superfamily, which can catalyze the conversion of testosterone and androstenedione to estrone and estradiol in the body, and is a rate-limiting enzyme for estrogen biosynthesis. It is distributed in various tissues of the human body, such as placenta, ovarian granulosa cells, luteal cells, adipocytes, testes and adrenal tissues. Literature (10.14142 / j.cnki.cn21-1313 / r.2010.01.017) shows that aromatase acts on the last step of estrogen biosynthesis, so inhibiting the activity of aromatase does not interfere with the synthesis process of other steroids. High-selectivity aromatase inhibitors can improve efficacy while reducing the occurrence of adverse reactions, and can also enhance patient tolerance. As an excellent drug target, aromatase inhibitors are increasingly valued in the treatment of common diseases in postmenopausal women, and several aromatase inhibitors have entered the clinical research stage as adjuvant therapy for breast cancer. Patent (US15 / 769831) discloses that inhibiting CYP19A1 can treat cancer. However, the application of CYP19A1 in the treatment of diabetes has not been disclosed in the art.
[0005] The inventors accidentally found that CYP19A1 protein can be used for treating diabetes and its complications in the process of research; meanwhile, the inventors creatively constructed a recombinant plasmid and a recombinant probiotic expressing CYP19A1 protein, solved the technical problem that CYP19A1 protein drug is easy to degrade in oral administration, and made it have better compliance and more significant therapeutic effect on diabetes and its complications. SUMMARY
[0006] In view of the above technical problems, a primary object of the present application is to provide an application of CYP19A1 protein in preparing a drug for preventing and / or treating diabetes.
[0007] A second object of the present application is to provide an application of CYP19A1 protein in preparing a drug for preventing and / or treating complications of diabetes.
[0008] A third object of the present application is to provide a recombinant plasmid, which is constructed by inserting CYP19A1 gene into a plasmid and maintaining the biological function of the open reading frame coding gene of CYP19A1 protein, and the plasmid includes pET-28a, pEZZ18, pTA1529, pINIII-ompA, pUB110, pE194, pUCX05-bgaB, pHT304, pMK3, pPIC9, pPIC9K, pHIL-S1, pPICZ alpha, pYAM75P, PNZ8149-usp45.
[0009] Further, the recombinant plasmid is constructed by inserting CYP19A1 gene into pET-28a plasmid, and the gene sequence of the recombinant plasmid is shown in SEQ ID No. 3.
[0010] A fourth object of the present application is to provide a recombinant probiotic with a hypoglycemic effect, which is obtained by transforming the recombinant plasmid into probiotic or integrating the gene encoding CYP19A1 protein into probiotic.
[0011] Further, the probiotic includes Escherichia coli Nissle1917, probiotic Bacillus, lactococcus, butyric acid bacillus, lactobacillus, bifidobacterium, actinomycetes, and Pichia pastoris.
[0012] A fifth object of the present application is to provide an application of the recombinant probiotic in preparing a drug for preventing and / or treating diabetes.
[0013] Further, the diabetes is type 2 diabetes.
[0014] The sixth object of the present application is to provide the use of the recombinant probiotic bacteria in the preparation of probiotic tablets with hypoglycemic efficacy.
[0015] The seventh object of the present application is to provide the use of the recombinant probiotic bacteria in the preparation of a drug for preventing and / or treating diabetic complications.
[0016] Further, the diabetic complications are one or more of gestational diabetes, diabetic nephropathy, retinopathy, cataract, uveitis associated with diabetes, diabetic foot, diabetic cardiovascular complications, diabetic cerebrovascular disease, diabetic neuropathy and periodontitis.
[0017] Further, the drug is an oral preparation, specifically including any one of oral liquid, tablet, capsule, granule, powder, suspension, emulsion, pill, powder.
[0018] The beneficial effects of the present application are: ① the present application first discovers that CYP19A1 protein can be used for treating diabetes, and can be used for preparing a drug for treating diabetes; ② the present application constructs CYP19A1 gene recombinant plasmid pET-28a-CYP19A1, and obtains recombinant probiotic bacteria by transforming the plasmid into probiotic bacteria, and CYP19A1 gene is highly expressed in the obtained recombinant probiotic bacteria; ③ the recombinant probiotic bacteria with high expression of protein in the present application can significantly reduce the blood glucose of diabetic mice, indicating that the recombinant probiotic bacteria with high expression of protein in the present application can be used as a drug for treating or alleviating diabetes, ④ the recombinant probiotic bacteria with high expression of protein in the present application can significantly improve diabetic nephropathy and diabetic cardiovascular disease, indicating that the recombinant probiotic bacteria with high expression of protein in the present application can be used as a drug for treating or preventing diabetic complications, and provides a new choice for clinical treatment of diabetes and its complications. ⑤ the present application changes the conventional administration mode (intramuscular injection or intravenous injection) of protein drugs, and applies protein drugs to the treatment of diabetes and its complications in the form of oral administration, and the therapeutic effect of the drugs is not reduced, and the technical solution in the present application achieves remarkable effects. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 PCR reaction results of recombinant plasmid transformed into Escherichia coli Nissle1917 are shown in the figure;
[0020] Figure 2 Effect of recombinant probiotic bacteria expressing CYP19A1 protein on fasting blood glucose of diabetic mice;
[0021] Figure 3 Effect of recombinant probiotic bacteria expressing CYP19A1 protein on fasting body weight of diabetic mice;
[0022] Figure 4 Results of the glucose tolerance test of the recombinant probiotics expressing CYP19A1 protein on diabetic mice;
[0023] Figure 5 Results of the insulin resistance test of the recombinant probiotics expressing CYP19A1 protein on diabetic mice;
[0024] Figure 6 Results of the detection of the urine protein content in 24h urine of diabetic mice by the recombinant probiotics expressing CYP19A1 protein;
[0025] Figure 7 Results of the detection of the urine creatinine content in 24h urine of diabetic mice by the recombinant probiotics expressing CYP19A1 protein;
[0026] Figure 8 Results of the detection of the glycated hemoglobin content of diabetic mice by the recombinant probiotics expressing CYP19A1 protein.
[0027] Figure 9 Results of the detection of the total cholesterol content of diabetic mice by the recombinant probiotics expressing CYP19A1 protein.
[0028] Figure 10 Results of the detection of the triglyceride content of diabetic mice by the recombinant probiotics expressing CYP19A1 protein.
[0029] Figure 11 Results of the detection of the low-density lipoprotein cholesterol content of diabetic mice by the recombinant probiotics expressing CYP19A1 protein. DETAILED DESCRIPTION
[0030] In order to make the objectives, technical solutions and advantages of the present application clearer, the following examples are used to further illustrate the present application. It should be understood that the specific examples described herein are used to explain the present application, and are not used to limit the present application. The experimental methods in the following examples are conventional methods unless otherwise specified. The reagents and materials used in the following examples are commercially available unless otherwise specified.
[0031] The following examples are described in the following examples:
[0032] Escherichia coli DH5a was purchased from Beijing Quanshi Gold Biotechnology Co., Ltd.;
[0033] Escherichia coli Nissle1917 was purchased from Germany (trademark name Mutaflor);
[0034] Recombinant plasmid pET-28a-EGFP was purchased from Moli Plasmid Platform;
[0035] Anhydrous ethanol was purchased from Tianjin Damao Chemical Reagent Company;
[0036] β-lactose (70% β-lactose and 30% α-lactose) was purchased from Macleod Biosciences, Inc;
[0037] PCR primers were purchased from Suzhou Jinweizhi Biological Technology Co., Ltd;
[0038] The bacterial plasmid DNA extraction kit was purchased from AXYGEN company;
[0039] Prime STAR HS (Premix, 2X) and T4 DNA ligase were purchased from Takara company;
[0040] DNA endonuclease Hind III and Xba I were purchased from Beijing NEB company;
[0041] The formula of LB (Luria-Bertani) liquid medium was 1% tryptone, 0.5% yeast extract, and 0.5% NaCl; the formula of LB solid medium was 1% tryptone, 0.5% yeast extract, 0.5% NaCl, and 2% agar.
[0042] Metformin hydrochloride, whose chemical name is 1.1-dimethylbiguanide hydrochloride, is used for type 2 diabetes patients who are not satisfied with simple dietary control, especially obese and high insulinemia patients. The drug not only has a hypoglycemic effect, but also may have the effect of reducing body weight and high insulinemia. It can be effective for some patients with poor efficacy of sulfonylurea, and the effect is better when used with sulfonylurea, small intestine glycosidase inhibitor or thiazolidinedione hypoglycemic drug than when used alone. It can also be used for patients treated with insulin to reduce insulin dosage. However, metformin hydrochloride cannot cure type 2 diabetes, and has a large dosage, a long medication cycle, and a large side effect, and has no therapeutic effect on diabetic complications. In this patent, metformin hydrochloride is used as a positive drug.
[0043] Streptozotocin, also known as streptozocin, has the chemical name 2-deoxy-2-[[(methyl nitroso amino) carbonyl]-amino]-D-glucopyranose, and the molecular formula is C8H 15N3O7, molecular weight 265.22 100, light yellow crystalline powder, easily soluble in water, but its aqueous solution is extremely unstable at room temperature, can be decomposed into gas and volatilized after half an hour, so it needs to be prepared on demand. Soluble in lower alcohols and ketones, insoluble in polar organic solvents. Streptozotocin can damage the pancreatic beta cells of animals and reduce the secretion of insulin, so it can be used to induce animal models of diabetes. A large dose (150 mg / kg / day) of single injection can induce type 1 diabetes, and a small dose (40-60 mg / kg / day) of multiple injections (3-5 days) combined with high-fat diet feeding can induce type 2 diabetes.
[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of the claims belongs. All patents, patent applications, published materials referred to throughout the entire text are incorporated by reference in their entirety. When a trade name appears herein, it is intended to refer to the corresponding product or active ingredient thereof.
[0045] It should be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the subject matter claimed. In this application, it must be noted that, as in all patent applications, except where otherwise indicated, the description and claims herein use singular forms of terms to refer to one or more of the items in the list of candidates. It should also be noted that, unless otherwise specified, "or" as used herein is generally used as "and / or" in the sense that it means "either or both." Furthermore, the use of the term "including" as well as other forms such as "contain," "comprise," and "comprises" is not limiting.
[0046] In the following examples of the present application, the Chinese full name, English full name or abbreviation of the following terms may be used, but regardless of whether the Chinese full name, English full name or abbreviation is used, it represents the same compound or drug or reagent. Specific as follows:
[0047] Chinese-English translation of abbreviations
[0048]
[0049] Unless specific definitions are provided, the nomenclature and laboratory procedures in analytical chemistry, organic synthesis chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly employed in the art. Standard techniques can be used for chemical synthesis, chemical analysis, pharmaceutical formulation, and delivery and treatment of patients. Standard techniques can be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipofection). For example, reactions and purification techniques can be performed using kits available from commercial vendors, or according to methods well known in the art, or as described herein. Generally, the aforementioned techniques and procedures can be performed by conventional methods as is well known in the art and described in various general and more specific references which are cited and discussed throughout the present specification.
[0050] Reagents used in the present application
[0051]
[0052]
[0053] Materials used in the present application
[0054]
[0055] Example 1, Construction of recombinant plasmid expressing CYP19A1 and recombinant probiotics expressing CYP19A1
[0056] 1. Acquisition of CYP19A1 gene: The amino acid sequence of CYP19A1 gene is shown in SEQ ID No. 1, and the gene sequence is shown in SEQ ID No. 2.
[0057] 2. Construction of recombinant plasmid: The pET-28a-CYP19A1 plasmid was synthesized by Oubio Biotechnology Co., Ltd.
[0058] 3. Extraction of recombinant plasmid DNA: The strain successfully transformed with the recombinant plasmid was transferred to LB medium for scale-up culture, and the culture conditions were as follows: rotation speed 200 rpm, temperature 37°C. The plasmid was extracted using the plasmid extraction kit of AXYGEN company.
[0059] 4. Preparation of Escherichia coli Nissle 1917 chemically competent cells: Take the preserved Escherichia coli Nissle 1917 (Mutaflor) strain from the -80°C refrigerator, use a sterile gun head to pick a small amount of the preserved bacteria, streak on LB solid medium, and incubate overnight in a 37°C incubator: pick a moist, smooth single colony from the LB solid medium, put it into LB liquid medium, and incubate at 37°C for 12 h; when the OD600 value of the bacterial solution is 0.3-0.5, transfer the bacterial solution to a pre-cooled sterile centrifuge tube on ice, ice-bath for 30 min, centrifuge at 1520g for 10 min at 4°C; discard the supernatant, suspend the cells with 500 μL of pre-cooled CaCl2 solution (sterilized by filtration), centrifuge at 1520g for 10 min at 4°C; repeat the above step once; discard the supernatant, add 500 μL of pre-cooled CaCl2 solution (sterilized by filtration), and carefully suspend the cells to prepare the competent cell suspension; the prepared competent cell suspension is directly used for transformation experiments. Unused competent cells are added with an equal volume of sterilized 20% glycerol, mixed, and then aliquoted in 1.5 mL centrifuge tubes (100 μL per tube) and stored in a -80°C refrigerator.
[0060] 5. Transformation of recombinant plasmid into Escherichia coli Nissle 1917 strain: Take the Escherichia coli Nissle 1917 chemically competent cells from the -80°C refrigerator, and place them on an ice box for 10-20 min to thaw. Take 50 μL of the competent cells and add 5 μL of the plasmid, mix gently with fingers several times, and place the mixture on ice for 25 min; after heat shock at 42°C for 45 s, quickly place it back on ice for 2 min, add 0.5 mL of room temperature LB liquid medium (without antibiotics), and incubate at 37°C with 200 rpm shaking for 1 h, take 200 μL of the above bacterial solution, and spread it on a plate containing 15 μg / mL of kanamycin, and after the bacterial solution is completely absorbed by the medium, invert the culture dish, and incubate at 37°C for 12 h.
[0061] 6. Verification of successful heat shock transformation colonies: pick single colonies, amplify and culture in liquid medium containing 15 μg / mL of kanamycin, and then perform PCR verification.
[0062] The experimental results are shown in Table 1. Figure 1 The verified correct CYP19A1 protein-expressing recombinant Escherichia coli Nissle 1917 probiotic bacteria are obtained.
[0063] It should be noted that the method described in the present application is not the only limited method for constructing the recombinant probiotic bacteria expressing CYP19A1. Any recombinant plasmid expressing CYP19A1 can be constructed by conventional technical means, and the recombinant plasmid expressing CYP19A1 can be transformed into Escherichia coli Nissle1917 strain or other probiotic bacteria by conventional transformation operation, so as to screen the recombinant probiotic bacteria expressing CYP19A1.
[0064] Example II, therapeutic effect of the recombinant probiotic bacteria expressing CYP19A1 on diabetic mice
[0065] 1. Establishment of C57BL / 6N mouse diabetes model and grouping
[0066] 1.1 Model establishment
[0067] 60 C57BL / 6N mice were randomly divided into three groups:
[0068] Normal feed group: SD, 6. After feeding with normal feed for four weeks, the mice were continuously injected with equal volume of citric acid buffer solution for five days, and then the normal feed was continued until the end of modeling;
[0069] High-fat feed + STZ group: Model, 54. After feeding with high-fat feed for four weeks, the mice were injected with STZ solution at a dose of 45 mg / kg intraperitoneally (fasting for 12 hours before injection of STZ, injection was performed at the same time period of 7:30 pm-9:00 pm, and the mice could be fed with high-fat feed after fasting for 2 hours after injection of STZ), once a day, continuously for five days, and the newly prepared STZ solution was injected within 30 minutes to prevent STZ from being ineffective. After injection of STZ solution, the mice were monitored for body weight and blood glucose changes every week, and the mice were fed with high-fat feed for four weeks and then with normal feed for one week. If the blood glucose remained basically unchanged (blood glucose≥15.0 mmol / L), it was considered that the type 2 diabetes model was stable and the modeling was successful, and 36 mice were selected as type 2 diabetes model mice.
[0070] 1.2 Grouping
[0071] After the formal start of the experiment, all mice were fed with normal feed, and were divided into 7 groups, 6 mice in each group, as follows:
[0072] a. Model group (Model): 0.2 mL of normal saline was administered intragastrically daily, which was the negative control group;
[0073] b. Model + metformin group (Model + Metformin): 200 mg / kg / day was administered intragastrically, which was the positive control group;
[0074] c. Model + EcN-EGFP group (Model + EcN-EGFP): 0.2 mL of recombinant Escherichia coli Nissle 1917 probiotic liquid containing pET-28a-EGFP was administered by gavage;
[0075] d. Model + EcN-CYP19A1 group (Model + EcN-CYP19A1): 0.2 mL of recombinant Escherichia coli Nissle 1917 probiotic liquid containing pET-28a-CYP19A1 was administered by gavage;
[0076] e. Model + EcN group (Model + EcN): 0.2 mL of Escherichia coli Nissle 1917 probiotic liquid was administered by gavage;
[0077] f. Model + β-lactose group (Model + β-lactose): 0.2 mL of a solution of 11 mg / mL β-lactose in physiological saline was administered by gavage;
[0078] g. Standard diet group (SD): equal volumes of physiological saline were administered by gavage daily;
[0079] All groups of mice were administered for 10 weeks. During the administration period, the growth status of the mice (including coat color, motor ability, etc.) was monitored daily, and blood glucose and body weight were measured once a week.
[0080] 2. Detection index
[0081] 2.1 Body weight and fasting blood glucose (FBG) monitoring
[0082] Starting from the 0th week of administration, after 12 h of fasting without water restriction, the fasting blood glucose and body weight were measured at the same time period (7:30 pm-9:00 pm) every week. The tail was cut to an appropriate length to take blood, and the blood glucose content was measured by a blood glucose meter. The blood glucose value was read and recorded.
[0083] 2.2 24 h urine volume, urine protein, urine creatinine, and urea nitrogen detection
[0084] At the 9th week of administration, the 24 h urine volume, urine protein, urine creatinine, and urea nitrogen content of the mice were measured. The measurement was performed according to the corresponding determination kit instructions.
[0085] 2.3 Intraperitoneal glucose tolerance test (IPGTT) and intraperitoneal insulin tolerance test (IPITT)
[0086] At the 10th week of administration, the insulin tolerance test was performed. After the mice in each group were fasted for 6 h without water, the blood glucose content was measured by a blood glucose meter as the blood glucose value at 0 min (BG0), then 0.3 U / kg of insulin was injected intraperitoneally, and the blood glucose values at 15, 30, 60 and 120 min (BG15, BG30, BG60 and BG120) after injection were measured. The IPITT curve was plotted by Graphpad prism 8 software, and the area under the curve during the blood sampling period of 0-120 min was calculated.
[0087] At the 10th week of administration, the glucose tolerance test was performed. The mice in each group were fasted for 12 h without water, the blood glucose content was measured by a blood glucose meter as the blood glucose value at 0 min, 1 g / kg of glucose was injected intraperitoneally, and then the blood glucose values at 15, 30, 60 and 120 min after injection were measured. The IPGTT curve was plotted by Graphpad prism 8 software, and the area under the curve during the blood sampling period of 0-120 min was calculated.
[0088] 2.4 Detection of glycated hemoglobin
[0089] At the end of the 10th week of administration, all mice were dissected and blood was collected by enucleation. Before blood collection, to prevent blood clotting, centrifuge tubes were soaked in an EDTA-Na2 (15 mg / mL) solution overnight, then placed in a constant temperature oven at 55°C for 5 h for standby. About 500 μL of blood was taken from each mouse; the blood samples were allowed to stand at 4°C for 48 h, then centrifuged at 700-1,000 g for 10 min at 4°C, and the plasma (upper layer) and red blood cells (lower layer) were collected, respectively. The plasma and red blood cells were stored and treated separately for detection by relevant kits. The red blood cells were mixed with double distilled water at a ratio of 1:1.5, mixed thoroughly with a vortex mixer for 1 min, and the resulting hemolyzed blood was stored at -20°C and could be stored for 70 days. The prepared hemolyzed blood was used to measure the content of glycated hemoglobin.
[0090] 2.6 Detection of total cholesterol, triglyceride and low-density lipoprotein cholesterol.
[0091] The collected plasma samples were used to detect the contents of total cholesterol, triglyceride and low-density lipoprotein cholesterol. The detection was performed according to the instructions of the corresponding detection kits.
[0092] 2.7 Preparation of specimens
[0093] After dissection of the mice, pancreatic, liver, and kidney tissues were collected, placed on ice, and rinsed thoroughly with physiological saline. The tissues were then fixed in 4% paraformaldehyde solution (>24h) and stored at 4°C for later use. After dehydration with graded alcohols, routine paraffin embedding and sectioning were performed. Hematoxylin-eosin (HE) staining and mounting were followed by microscopic observation and image capture (200x magnification).
[0094] 3. Data Processing
[0095] Experimental data were analyzed using SPSS 23.0 software. Data are expressed as (x±s). One-way ANOVA and LSD-t method were used for comparisons between groups. p<0.05 was considered statistically significant.
[0096] 4. Experimental Results
[0097] The effect of recombinant probiotics expressing CYP19A1 on fasting blood glucose in diabetic mice is as follows: Figure 2 As shown, the Modelvs.SD group, ### P<0.001 indicates that the type 2 diabetic mouse model was successfully established, and the fasting blood glucose of the Model group mice remained at around 17 mmol / L for 10 weeks. The blood glucose of the Model+EcN-CYP19A1 group was significantly lower than that of the Model group (**P<0.01, *P<0.05), indicating that the recombinant probiotic expressing CYP19A1 described in this invention has significant hypoglycemic activity.
[0098] The effect of recombinant probiotics expressing CYP19A1 on fasting body weight in diabetic mice is as follows: Figure 3 As shown, the recombinant probiotics expressing CYP19A1 had no significant effect on the fasting weight of mice, and the figure shows that the weight of diabetic mice was significantly lower than that of normal mice.
[0099] Results of glucose tolerance test in diabetic mice by recombinant probiotics expressing CYP19A1 Figure 4 As shown, after intraperitoneal injection of glucose, the blood glucose levels of mice in the Model+EcN-CYP19A1 group at 15 min, 30 min, 60 min, and 120 min were significantly lower than those in the Model and Model+metformin groups (**P<0.01, ***P<0.001). The area under the glucose tolerance test (AUC) of the Model+EcN-CYP19A1 group was significantly lower than that of the Model group. The glucose tolerance test results demonstrate that the recombinant probiotic expressing CYP19A1 described in this invention can improve the glucose metabolism capacity of diabetic mice, and its therapeutic effect is superior to that of the clinically positive drug metformin.
[0100] The insulin resistance test results of the recombinant probiotics expressing CYP19A1 on the diabetic mice are shown in the following table 1. Figure 5 As shown in the following table 1, after intraperitoneal injection of insulin, the blood glucose values of the mice in the Model+EcN-CYP19A1 group at 15 min, 30 min, 60 min and 120 min are significantly different from those in the Model group, and are not significantly different from those in the Model+metformin group, and the area under the curve (AUC) of the insulin resistance test of the mice in the Model+EcN-CYP19A1 group is significantly lower than that in the Model group. The insulin resistance test results show that the recombinant probiotics expressing CYP19A1 can improve the insulin sensitivity of the diabetic mice, can enhance the function of islet cells, and can reduce the insulin resistance.
[0101] The detection results of the recombinant probiotics expressing CYP19A1 on the urine protein content in the 24h urine of the diabetic mice are shown in the following table 2. Figure 6 As shown in the following table 2, Model vs. SD group, ## P<0.01, indicating that the kidney function of the diabetic mice is reduced, i.e. the reabsorption of urine protein is weakened; the urine protein content of the mice in the Model+EcN-CYP19A1 group is significantly different from that in the Model group (*P<0.05), indicating that the recombinant probiotics expressing CYP19A1 can improve the reabsorption of urine protein by the kidney and improve the kidney function, and the effect is better than that of metformin.
[0102] The detection results of the recombinant probiotics expressing CYP19A1 on the urine creatinine content in the 24h urine of the diabetic mice are shown in the following table 3. Figure 7 As shown in the following table 3, Model vs. SD group, # P<0.05, indicating that the filtration of urine creatinine by the diabetic mice is reduced, i.e. the kidney function is reduced; the urine creatinine content of the mice in the Model+EcN-CYP19A1 group is significantly lower than that in the Model group, *p<0.05, indicating that the recombinant probiotics expressing CYP19A1 can improve the filtration of urine creatinine by the kidney and improve the kidney function.
[0103] In summary, Figure 6 and Figure 7 It can be seen that the recombinant probiotics expressing CYP19A1 have obvious effects of improving the kidney function, can reduce the urine protein and urine creatinine contents of the diabetic mice, can reduce the blood glucose while protecting the kidney, and the protective effect on the kidney is obviously better than that of metformin.
[0104] The detection results of the recombinant probiotics expressing CYP19A1 on the glycated hemoglobin of the diabetic mice are shown in the following table 4. Figure 8 As shown in the following table 4, glycated hemoglobin is an important indicator for evaluating diabetes, Model vs. SD group,### P<0.001, indicating that the type 2 diabetic mice were successfully encapsulated. The content of glycosylated hemoglobin in the Model+EcN-CYP19A1 group was significantly lower than that in the Model group, ***P<0.001, indicating that the recombinant probiotic bacteria expressing CYP19A1 can reduce the content of glycosylated hemoglobin and improve the symptoms of diabetes.
[0105] The detection results of the recombinant probiotic bacteria expressing CYP19A1 on total cholesterol in diabetes are shown in Table 5. Figure 9 ## P<0.01, indicating that the content of total cholesterol in diabetic mice will increase, and the content of total cholesterol in the Model+EcN-CYP19A1 group is significantly lower than that in the Model group (*P<0.05), indicating that the recombinant probiotic bacteria expressing CYP19A1 can reduce the content of total cholesterol in diabetic mice.
[0106] The detection results of the recombinant probiotic bacteria expressing CYP19A1 on triglyceride in diabetes are shown in Table 6. Figure 10 ### P<0.01, indicating that the content of triglyceride in diabetic mice will increase, and the content of triglyceride in the Model+EcN-CYP19A1 group is significantly lower than that in the Model group (*P<0.05), indicating that the recombinant probiotic bacteria expressing CYP19A1 can reduce the content of triglyceride in diabetic mice.
[0107] The detection results of the recombinant probiotic bacteria expressing CYP19A1 on low-density lipoprotein cholesterol in diabetes are shown in Table 7. Figure 11 ### P<0.001, indicating that the content of low-density lipoprotein cholesterol in diabetic mice will increase, and the content of low-density lipoprotein cholesterol in the Model+EcN-CYP19A1 group is significantly lower than that in the Model group (*P<0.05), indicating that the recombinant probiotic bacteria expressing CYP19A1 can reduce the content of low-density lipoprotein cholesterol in diabetic mice.
[0108] In summary, Figure 9 , Figure 10 and Figure 11 It can be seen that the recombinant probiotic bacteria expressing CYP19A1 of the present application has obvious effect of improving cardiovascular disease, can prevent the occurrence of cardiovascular disease, can reduce the risk of cardiovascular disease while reducing blood glucose, and its protective effect is obviously better than that of metformin.
[0109] In summary, the recombinant probiotics expressing CYP19A1 can reduce the blood sugar of type 2 diabetic mice, improve sugar metabolism, improve insulin sensitivity, and have good therapeutic and preventive effects on diabetic nephropathy and cardiovascular complications, which is specifically embodied in reducing the contents of urine protein, urine creatinine, total cholesterol, triglyceride and low-density lipoprotein cholesterol of type 2 diabetic mice. The recombinant probiotics expressing CYP19A1 are a biological drug, and have a good clinical application prospect. SEQUENCE LISTING <110> LANZHOU UNIVERSITY <120> Application of CYP19A1 protein in preparation of drugs for preventing and / or treating diabetes <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 503 <212> PRT <213> people <400> 1 Met Val Leu Gly Met Leu Ala Pro Ile His Thr Ala Ile Thr Ser Ile 1 5 10 15 Val Pro Gly Ala Met Pro Ala Ala Thr Met Pro Val Leu Leu Leu Thr 20 25 30 Gly Leu Pro Leu Leu Val Thr Ala Thr Gly Gly Thr Ser Ser Ile Pro 35 40 45 Gly Pro Gly Thr Cys Met Gly Ile Gly Pro Leu Ile Ser His Gly Ala 50 55 60 Pro Leu Thr Met Gly Ile Gly Ser Ala Cys Ala Thr Thr Ala Ala Val 65 70 75 80 Thr Gly Gly Pro Met Ala Val Thr Ile Ser Gly Gly Gly Thr Leu Ile 85 90 95 Ile Ser Leu Ser Ser Ser Met Pro His Ile Met Leu His Ala His Thr 100 105 110 Ser Ser Ala Pro Gly Ser Leu Leu Gly Leu Gly Cys Ile Gly Met His 115 120 125 Gly Leu Gly Ile Ile Pro Ala Ala Ala Pro Gly Leu Thr Leu Thr Thr 130 135 140 Ala Pro Pro Pro Met Leu Ala Leu Ser Gly Pro Gly Leu Val Ala Met 145 150 155 160 Val Thr Val Cys Ala Gly Ser Leu Leu Thr His Leu Ala Ala Leu Gly 165 170 175 Gly Val Thr Ala Gly Ser Gly Thr Val Ala Val Leu Thr Leu Leu Ala 180 185 190 Ala Val Met Leu Ala Thr Ser Ala Thr Leu Pro Leu Ala Ile Pro Leu 195 200 205 Ala Gly Ser Ala Ile Val Val Leu Ile Gly Gly Thr Pro Ala Ala Thr 210 215 220 Gly Ala Leu Leu Ile Leu Pro Ala Ile Pro Pro Leu Ile Ser Thr Leu 225 230 235 240 Thr Leu Leu Thr Gly Leu Ser Val Leu Ala Leu Leu Ala Ala Ile Gly 245 250 255 Val Leu Ile Ala Gly Leu Ala Ala Ala Ile Ser Thr Gly Gly Leu Leu 260 265 270 Gly Gly Cys Met Ala Pro Ala Thr Gly Leu Ile Leu Ala Gly Leu Ala 275 280 285 Gly Ala Leu Thr Ala Gly Ala Val Ala Gly Cys Ile Leu Gly Met Leu 290 295 300 Ile Ala Ala Pro Ala Thr Met Ser Val Ser Leu Pro Pro Met Leu Pro 305 310 315 320 Leu Ile Ala Leu His Pro Ala Val Gly Gly Ala Ile Ile Leu Gly Ile 325 330 335 Gly Thr Val Ile Gly Gly Ala Ala Ile Leu Ile Ala Ala Ile Gly Leu 340 345 350 Leu Leu Val Met Gly Ala Pro Ile Thr Gly Ser Met Ala Thr Gly Pro 355 360 365 Val Val Ala Leu Val Met Ala Leu Ala Leu Gly Ala Ala Val Ile Ala 370 375 380 Gly Thr Pro Val Leu Leu Gly Thr Ala Ile Ile Leu Ala Ile Gly Ala 385 390 395 400 Met His Ala Leu Gly Pro Pro Pro Leu Pro Ala Gly Pro Thr Leu Gly 405 410 415 Ala Pro Ala Leu Ala Val Pro Thr Ala Thr Pro Gly Pro Pro Gly Pro 420 425 430 Gly Pro Ala Gly Cys Ala Gly Leu Thr Ile Ala Met Val Met Met Leu 435 440 445 Ala Ile Leu Val Thr Leu Leu Ala Ala Pro His Val Leu Thr Leu Gly 450 455 460 Gly Gly Cys Val Gly Ser Ile Gly Leu Ile His Ala Leu Ser Leu His 465 470 475 480 Pro Ala Gly Thr Leu Ala Met Leu Gly Met Ile Pro Thr Pro Ala Ala 485 490 495 Ser Ala Ala Cys Leu Gly His 500 <210> 2 <211> 1512 <212> DNA <213> people <400> 2 atggttttgg aaatgctgaa cccgatacat tataacatca ccagcatcgt gcctgaagcc 60 atgcctgctg ccaccatgcc agtcctgctc ctcactggcc tttttctctt ggtgtggaat 120 tatgagggca catcctcaat accaggtcct ggctactgca tgggaattgg acccctcatc 180 tcccacggca gattcctgtg gatggggatc ggcagtgcct gcaactacta caaccgggta 240 tatggagaat tcatgcgagt ctggatctct ggagaggaaa cactcattat cagcaagtcc 300 tcaagtatgt tccacataat gaagcacaat cattacagct ctcgattcgg cagcaaactt 360 gggctgcagt gcatcggtat gcatgagaaa ggcatcatat ttaacaacaa tccagagctc 420 tggaaaacaa ctcgaccctt ctttatgaaa gctctgtcag gccccggcct tgttcgtatg 480 gtcacagtct gtgctgaatc cctcaaaaca catctggaca ggttggagga ggtgaccaat 540 gaatcgggct atgtggacgt gttgaccctt ctgcgtcgtg tcatgctgga cacctctaac 600 acgctcttct tgaggatccc tttggacgaa agtgctatcg tggttaaaat ccaaggttat 660 tttgatgcat ggcaagctct cctcatcaaa ccagacatct tctttaagat ttcttggcta 720 tacaaaaagt atgagaagtc tgtcaaggat ttgaaagatg ccatagaagt tctgatagca 780 gaaaaaagac gcaggatttc cacagaagag aaactggaag aatgtatgga ctttgccact 840 gagttgattt tagcagagaa acgtggtgac ctgacaagag agaatgtgaa ccagtgcata 900 ttggaaatgc tgatcgcagc tcctgacacc atgtctgtct ctttgttctt catgctattt 960 ctcattgcaa agcaccctaa tgttgaagag gcaataataa aggaaatcca gactgttatt 1020 ggtgagagag acataaagat tgatgatata caaaaattaa aagtgatgga aaacttcatt 1080 tatgagagca tgcggtacca gcctgtcgtg gacttggtca tgcgcaaagc cttagaagat 1140 gatgtaatcg atggctaccc agtgaaaaag gggacaaaca ttatcctgaa tattggaagg 1200 atgcacagac tcgagttttt ccccaaaccc aatgaattta ctcttgaaaa ttttgcaaag 1260 aatgttcctt ataggtactt tcagccattt ggctttgggc cccgtggctg tgcaggaaag 1320 tacatcgcca tggtgatgat gaaagccatc ctcgttacac ttctgagacg attccacgtg 1380 aagacattgc aaggacagtg tgttgagagc atacagaaga tacacgactt gtccttgcac 1440 ccagatgaga ctaaaaacat gctggaaatg atctttaccc caagaaactc agacaggtgt 1500 ctggaacact ag 1512 <210> 3 <211> 6718 <212> DNA <213> Artificial Sequence <400> 3 aaggagaaaa ctcaccgagg cagttccata ggatggcaag atcctggtat cggtctgcga 60 ttccgactcg tccaacatca atacaaccta ttaatttccc ctcgtcaaaa ataaggttat 120 caagtgagaa atcaccatga gtgacgactg aatccggtga gaatggcaaa agtatggttt 180 tggaaatgct gaacccgata cattataaca tcaccagcat cgtgcctgaa gccatgcctg 240 ctgccaccat gccagtcctg ctcctcactg gcctttttct cttggtgtgg aattatgagg 300 gcacatcctc aataccaggt cctggctact gcatgggaat tggacccctc atctcccacg 360 gcagattcct gtggatgggg atcggcagtg cctgcaacta ctacaaccgg gtatatggag 420 aattcatgcg agtctggatc tctggagagg aaacactcat tatcagcaag tcctcaagta 480 tgttccacat aatgaagcac aatcattaca gctctcgatt cggcagcaaa cttgggctgc 540 agtgcatcgg tatgcatgag aaaggcatca tatttaacaa caatccagag ctctggaaaa 600 caactcgacc cttctttatg aaagctctgt caggccccgg ccttgttcgt atggtcacag 660 tctgtgctga atccctcaaa acacatctgg acaggttgga ggaggtgacc aatgaatcgg 720 gctatgtgga cgtgttgacc cttctgcgtc gtgtcatgct ggacacctct aacacgctct 780 tcttgaggat ccctttggac gaaagtgcta tcgtggttaa aatccaaggt tattttgatg 840 catggcaagc tctcctcatc aaaccagaca tcttctttaa gatttcttgg ctatacaaaa 900 agtatgagaa gtctgtcaag gatttgaaag atgccataga agttctgata gcagaaaaaa 960 gacgcaggat ttccacagaa gagaaactgg aagaatgtat ggactttgcc actgagttga 1020 ttttagcaga gaaacgtggt gacctgacaa gagagaatgt gaaccagtgc atattggaaa 1080 tgctgatcgc agctcctgac accatgtctg tctctttgtt cttcatgcta tttctcattg 1140 caaagcaccc taatgttgaa gaggcaataa taaaggaaat ccagactgtt attggtgaga 1200 gagacataaa gattgatgat atacaaaaat taaaagtgat ggaaaacttc atttatgaga 1260 gcatgcggta ccagcctgtc gtggacttgg tcatgcgcaa agccttagaa gatgatgtaa 1320 tcgatggcta cccagtgaaa aaggggacaa acattatcct gaatattgga aggatgcaca 1380 gactcgagtt tttcccaaa cccaatgaat ttactcttga aaattttgca aagaatgttc 1440 cttataggta ctttcagcca tttggctttg ggccccgtgg ctgtgcagga aagtacatcg 1500 ccatggtgat gatgaaagcc atcctcgtta cacttctgag acgattccac gtgaagacat 1560 tgcaaggaca gtgtgttgag agcatacaga agatacacga cttgtccttg cacccagatg 1620 agactaaaa catgctggaa atgatcttta ccccaagaaa ctcagacagg tgtctggaac 1680 actagcggcg caggaacact gccagcgcat caacaatatt ttcacctgaa tcaggatatt 1740 cttcttaatac ctggaatgct gttttccgg ggatcgcagt ggtgagtaac catgcatcat 1800 caggagtacg gataaaatgc ttgatggtcg gaagaggcat aaattccgtc agccagttta 1860 gtctgaccat ctcatctgta acatcattgg caacgctacc tttgccatgt ttcagaaaca 1920 actctggcgc atcgggcttc ccatacaatc gatagattgt cgcacctgat tgcccgacat 1980 tatcgcgagc ccatttatac ccatataaat cagcatccat gttggaattt aatcgcggcc 2040 tagagcaaga cgtttcccgt tgaatatggc tcataacacc ccttgtatta ctgtttatgt 2100 aagcagacag ttttattgtt catgaccaaa atcccttaac gtgagttttc gttccactga 2160 gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag atcctttttt tctgcgcgta 2220 atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa 2280 gagctaccaa ctctttttcc gaaggtaact ggcttcagca gagcgcagat accaaatact 2340 gtccttctag tgtagccgta gttaggccac cacttcaaga actctgtagc accgcctaca 2400 tacctcgctc tgctaatcct gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt 2460 accgggttgg actcaagacg atagttaccg gataaggcgc agcggtcggg ctgaacgggg 2520 ggttcgtgca cacagcccag cttggagcga acgacctaca ccgaactgag atacctacag 2580 cgtgagctat gagaaagcgc cacgcttccc gaagggagaa aggcggacag gtatccggta 2640 agcggcaggg tcggaacagg agagcgcacg agggagcttc cagggggaaa cgcctggtat 2700 ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt gtgatgctcg 2760 tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc 2820 ttttgctggc cttttgctca catgttcttt cctgcgttat cccctgattc tgtggataac 2880 cgtattaccg cctttgagtg agctgatacc gctcgccgca gccgaacgac cgagcgcagc 2940 gagtcagtga gcgaggaagc ggaagagcgc ctgatgcggt attttctcct tacgcatctg 3000 tgcggtattt cacaccgcaa tggtgcactc tcagtacaat ctgctctgat gccgcatagt 3060 taagccagta tacactccgc tatcgctacg tgactgggtc atggctgcgc cccgacaccc 3120 gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg cttacagaca 3180 agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat caccgaaacg 3240 cgcgaggcag ctgcggtaaa gctcatcagc gtggtcgtga agcgattcac agatgtctgc 3300 ctgttcatcc gcgtccagct cgttgagttt ctccagaagc gttaatgtct ggcttctgat 3360 aaagcgggcc atgttaaggg cggttttttc ctgtttggtc actgatgcct ccgtgtaagg 3420 gggatttctg ttcatggggg taatgatacc gatgaaacga gagaggatgc tcacgatacg 3480 ggttactgat gatgaacatg cccggttact ggaacgttgt gagggtaaac aactggcggt 3540 atggatgcgg cgggaccaga gaaaaatcac tcagggtcaa tgccagcgct tcgttaatac 3600 agatgtaggt gttccacagg gtagccagca gcatcctgcg atgcagatcc ggaacataat 3660 ggtgcagggc gctgacttcc gcgtttccag actttacgaa acacggaaac cgaagaccat 3720 tcatgttgtt gctcaggtcg cagacgtttt gcagcagcag tcgcttcacg ttcgctcgcg 3780 tatcggtgat tcattctgct aaccagtaag gcaaccccgc cagcctagcc gggtcctcaa 3840 cgacaggagc acgatcatgc gcacccgtgg ggccgccatg ccggcgataa tggcctgctt 3900 ctcgccgaaa cgtttggtgg cgggaccagt gacgaaggct tgagcgaggg cgtgcaagat 3960 tccgaatacc gcaagcgaca ggccgatcat cgtcgcgctc cagcgaaagc ggtcctcgcc 4020 gaaaatgacc cagagcgctg ccggcacctg tcctacgagt tgcatgataa agaagacagt 4080 cataagtgcg gcgacgatag tcatgccccg cgcccaccgg aaggagctga ctgggttgaa 4140 ggctctcaag ggcatcggtc gagatcccgg tgcctaatga gtgagctaac ttacattaat 4200 tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg tcgtgccagc tgcattaatg 4260 aatcggccaa cgcgcgggga gaggcggttt gcgtattggg cgccagggtg gtttttcttt 4320 tcaccagtga gacgggcaac agctgattgc ccttcaccgc ctggccctga gagagttgca 4380 gcaagcggtc cacgctggtt tgccccagca ggcgaaaatc ctgtttgatg gtggttaacg 4440 gcgggatata acatgagctg tcttcggtat cgtcgtatcc cactaccgag atatccgcac 4500 caacgcgcag cccggactcg gtaatggcgc gcattgcgcc cagcgccatc tgatcgttgg 4560 caaccagcat cgcagtggga acgatgccct cattcagcat ttgcatggtt tgttgaaaac 4620 cggacatggc actccagtcg ccttcccgtt ccgctatcgg ctgaatttga ttgcgagtga 4680 gatatttatg ccagccagcc agacgcagac gcgccgagac agaacttaat gggcccgcta 4740 acagcgcgat ttgctggtga cccaatgcga ccagatgctc cacgcccagt cgcgtaccgt 4800 cttcatggga gaaaataata ctgttgatgg gtgtctggtc agagacatca agaaataacg 4860 ccggaacatt agtgcaggca gcttccacag caatggcatc ctggtcatcc agcggatagt 4920 taatgatcag cccactgacg cgttgcgcga gaagattgtg caccgccgct ttacaggctt 4980 CGACGCCGCT TCCTTCTACC ATCGACACCA CCACGCTGGC ACCCAGTTGA TC GGC GC GA 5040 ATTTAATCGC CGACAATTTG CGACGGCGCG TGCAGGGCCA GACTGGAGGT GGCAACGC 5100 CAATCAGCAAC GACTGTTTG CCCGCCAGTT GTTGTGCCAC GCGGTTGGGA ATGTAATTC A 5160 GCTCCGCCAT CGCCGCTTCC ACTTTTTCCC GC GTTTTC GC AGAAACGTGG CTGGCCTGGT 5220 TCACCACGCG GGAAACGGTC TGATAAGAGA CACC GGC AT ACTCTGCGAC ATC GTATAACG 5280 TTACTGGTTT CACATTCA CC ACCCTGAATT GACTCTCTTC CGGGCGCTAT CATGCCATAC 5340 C GC GAAAGGTT TTGC GCCATT CGATGGTGT CC GGG ATCTC GACGCTCTCC CTTATGC GAC 5400 TCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCAAGG 5460 AATGGTGCA TGCAAGGA GATGGCGCCC AACAGTCCCCCGGCCACGGGGCCTGCCACCAT A 5520 CCCACGCCGA AACAAGCGCT CATGAGCCCG AAGTGGCGAG CCCGATCTTC CCCATCGGTG 5580 ATGTCGGCGA TATAGCGCCC AGCAACC GACCTGTGGCGCCG GTGATGCCGGCCACGATG 5640 C GTCCGGCGT AGAGGATCGA GATCTCGATC CC GCGAAATTA ATACGACTC ACTATAGGGG 5700 aattgtgagc ggataacaat tcccctctag aaataatttt gtttaacttt aagaaggaga 5760 tataccatgg gcagcagcca tcatcatcat catcacagca gcggcctggt gccgcgcggc 5820 agccatatgg ctagcatgac tggtggacag caaatgggtc gcggatccga attcgagctc 5880 cgtcgacaag cttgcggccg cactcgagca ccaccaccac caccaccact gagatccggc 5940 tgctaacaaa gcccgaaagg aagctgagtt ggctgctgcc accgctgagc aataactagc 6000 ataacccctt ggggcctcta aacgggtctt gaggggtttt ttgctgaaag gaggaactat 6060 atccggattg gcgaatggga cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg 6120 gttacgcgca gcgtgaccgc tacacttgcc agcgccctag cgcccgctcc tttcgctttc 6180 ttcccttcct ttctcgccac gttcgccggc tttccccgtc aagctctaaa tcgggggctc 6240 cctttagggt tccgatttag tgctttacgg cacctcgacc ccaaaaaact tgattagggt 6300 gatggttcac gtagtgggcc atcgccctga tagacggttt ttcgcccttt gacgttggag 6360 tccacgttct ttaatagtgg actcttgttc caaactggaa caacactcaa ccctatctcg 6420 gtctattctt ttgatttata agggatttg ccgatttcgg cctattggtt aaaaaatgag 6480 ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat taacgcttac aatttaggtg 6540 gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt attttctaa atacattcaa 6600 atatgtatcc gctcatgaat taattcttag aaaaactcat cgagcatcaa atgaaactgc 6660 aatttattca tatcaggatt atcaatacca tatttttgaa aaagccgttt ctgtaatg 6718
Claims
1. Use of a recombinant probiotic expressing CYP19A1 protein for the preparation of a medicament for the prevention and / or treatment of type 2 diabetes, characterized in that, The nucleotide sequence of the CYP19A1 protein is shown as SEQ ID NO.
2.
2. Use according to claim 1, wherein The medicine is an oral preparation, specifically including any one of oral liquid, tablet, capsule, granule, suspension, emulsion, pill, powder.
Citation Information
Patent Citations
New polypeptide human non-insulin dependent diabetes related protein 25 and polynucleotides for encoding same
CN1324831A
Pharmacophores, compounds and methods having application in the treatment of cancer through inhibition of CYP17a1 and CYP19a1
US20200247794A1
Construction of eukaryon expression plasmid for expressing human aromatizing enzyme gene and application thereof
CN101921806A