Use of multiple methylation sites in combination in the manufacture of a product for detecting, predicting or monitoring tumor progression
By jointly detecting multiple methylation sites of the SFRP2 and SDC2 genes, the problem of unstable sensitivity and specificity of SFRP2 gene methylation detection in existing technologies has been solved, achieving efficient and low-cost detection for early tumor screening.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANGHAI HEALZONE BIOTECHNOLOGY CO LTD
- Filing Date
- 2023-01-10
- Publication Date
- 2026-04-21
AI Technical Summary
In existing technologies, the sensitivity and specificity of SFRP2 gene methylation detection are unstable, making it difficult to effectively use for early tumor screening.
This study combines multiple specific methylation sites of the SFRP2 and SDC2 genes as biomarkers, and uses specific primer pairs and probes to detect methylation levels, providing reagents, kits, and detection systems for early tumor screening.
It significantly improves the sensitivity and specificity of detection, reduces detection costs, and enables rapid early screening of tumors.
Smart Images

Figure CN115820864B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene diagnostic technology, and in particular to the application of polymethylation sites in the preparation of products for detecting, predicting or monitoring tumor development. Background Technology
[0002] In recent years, DNA methylation has been considered one of the most promising tumor markers. DNA methylation refers to the alteration of DNA function by the covalent binding of a methyl group at the 5-carbon position of cytosine under the action of DNA methyltransferases. Numerous studies have confirmed that DNA methylation participates in the regulation of the entire process of tumorigenesis and development. In normal cells, the promoter regions of tumor suppressor genes are in a hypomethylated state, and downstream DNA normally expresses tumor suppressor proteins. However, in tumor cells, the promoter regions are hypermethylated, inhibiting the normal expression of tumor suppressor genes. Therefore, it is generally believed that changes in DNA methylation often precede tumor development or are the earliest detectable tumor-related marker.
[0003] SFRP2 methylation has been confirmed to be associated with colorectal cancer and has the potential to be a colorectal cancer marker; however, its clinical diagnostic efficacy varies. For example, (1) the sensitivity and specificity of SFRP2 gene detection vary significantly when different methods are used. In the reported results, the detection sensitivity and specificity of the hybridization method were 61.1% and 77.7%, respectively, while the corresponding sensitivity and specificity of the fluorescence method were 86.3% and 77.3%, respectively. (2) There are significant differences in the sensitivity and specificity of SFRP2 methylation for colorectal cancer diagnosis in different studies, with a large range of fluctuation. Some studies reported that the sensitivity of SFRP2 methylation for colorectal cancer detection was 77% to 90% and the specificity was 77%, while other studies showed that the sensitivity of SFRP2 promoter region methylation for colorectal cancer detection was 57% and the specificity was 90%.
[0004] The main reason for the above differences in sensitivity and specificity is that the existing detection technology actually detects the overall methylation level of a region on the SFRP2 gene. However, with the deepening of methylation research, more and more studies have found that the clinical specificity of DNA methylation in different regions of the gene varies greatly. Even within the same segment, a single methylation site can show significant biological significance. At the same time, multi-gene, multi-site detection can further improve the sensitivity and specificity of detection.
[0005] In view of this, the present invention is proposed. Summary of the Invention
[0006] The purpose of this invention is to combine multiple methylation sites derived from the SFRP2 and SDC2 genes as biomarkers for assessing tumor development, thereby addressing the technical problems of insufficient regional detection specificity and sensitivity, as well as instability, in the prior art.
[0007] Another objective of this invention is to provide reagents, kits, and detection systems for detecting the methylation status of multiple sites derived from the SFRP2 and SDC2 genes, based on the above applications, for the purpose of achieving early and rapid screening of tumors.
[0008] To solve the above-mentioned technical problems and achieve the above-mentioned objectives, the present invention provides the following technical solutions:
[0009] In a first aspect, the present invention provides the application of polymethylation sites in the preparation of products for detecting, predicting or monitoring tumor development, wherein the polymethylation sites include a first source methylation site and a second source methylation site, wherein the first source methylation site is at least one methylation site derived from the SFRP2 gene, and the second source methylation site is at least one methylation site derived from the SDC2 gene.
[0010] In an optional embodiment, the first source methylation site is selected from at least one of (A) SFRP2 gene-specific site chr4:153781309, (B) SFRP2 gene-specific site chr4:153789201, (C) SFRP2 gene-specific site chr4:153789431, (D) SFRP2 gene-specific site chr4:153788844, or (E) SFRP2 gene-specific site chr4:153788604.
[0011] The preferred option is (A)SFRP2 gene specific site chr4:153781309.
[0012] In an optional embodiment, the second source methylation site is selected from at least one of (a) the SDC2 gene-specific site chr8:96493501, (b) the SDC2 gene-specific site chr8:96493590, (c) the SDC2 gene-specific site chr8:96494113, or (d) the SDC2 gene-specific site chr8:96494187.
[0013] In a second aspect, the present invention provides a tumor diagnostic reagent comprising a specific primer pair and a probe for detecting the methylation level of the polymethylation sites described in any of the foregoing embodiments.
[0014] Preferably, the reagent further includes a reverse primer.
[0015] In an optional embodiment, the methylation site includes at least one of (A) SFRP2 gene-specific site chr4:153781309, (B) SFRP2 gene-specific site chr4:153789201, (C) SFRP2 gene-specific site chr4:153789431, (D) SFRP2 gene-specific site chr4:153788844 or (E) SFRP2 gene-specific site chr4:153788604, and at least one of (a) SDC2 gene-specific site chr8:96493501, (b) SDC2 gene-specific site chr8:96493590, (c) SDC2 gene-specific site chr8:96494113 or (d) SDC2 gene-specific site chr8:96494187.
[0016] In an optional embodiment, the nucleotide sequence of the forward primer in the primer pair for detecting a specific site of the (A)SFRP2 gene chr4:153781309 contains at least the continuous base sequence TCCTTAGGTGAAAACAGCTAT (SEQ ID No. 29), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GTTTGCATCCCCAGCA (SEQ ID No. 30).
[0017] The nucleotide sequence of the forward primer in the (B)SFRP2 gene specific site chr4:153789201 primer pair contains at least the continuous base sequence GGGAGGAGCCAATGAAGGGTAAT (SEQ ID No. 4), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GCAAAACCAGACCCAGA (SEQ ID No. 31).
[0018] The nucleotide sequence of the forward primer in the (C)SFRP2 gene specific site chr4:153789431 primer pair contains at least the continuous base sequence CCAGCAGAAACTTCGGACTGG (SEQ ID No. 7), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GTGCCGCCGGGG (SEQ ID No. 32).
[0019] The nucleotide sequence of the forward primer in the (D)SFRP2 gene specific site chr4:153788844 primer pair contains at least the continuous base sequence CGGCCGCCTCGCCCTTC (SEQ ID No. 10), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GCGACCCCGAGGG (SEQ ID No. 33).
[0020] The nucleotide sequence of the forward primer in the chr4:153788604 primer pair for detecting a specific site of the (E)SFRP2 gene contains at least the continuous base sequence CGAGCACAGGAACTTCTTGGTGTC (SEQ ID No. 13), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GCTTGGATCCCGCT (SEQ ID No. 34).
[0021] The nucleotide sequence of the forward primer in the primer pair chr8:96493501 for detecting a specific site of the SDC2 gene contains at least the continuous base sequence GGGAAGAAA AGAGCATAGAGGAG (SEQ ID No. 16), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GTTTTCTCAGTCCTTT (SEQ ID No. 35).
[0022] The nucleotide sequence of the forward primer in the primer pair chr8:96493590 for detecting a specific site of the SDC2 gene in (b) contains at least the continuous base sequence GGCGGCAGTGTGACTC (SEQ ID No. 19), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GTGTAATCCTGTAGGAA (SEQ ID No. 36).
[0023] The nucleotide sequence of the forward primer in the primer pair chr8:96494113 for detecting a specific site of the (c)SDC2 gene contains at least the continuous base sequence CAGCGATTGCGGCTCAGGCT (SEQ ID No. 22), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GCCCCCGAGCCCCGCA (SEQ ID No. 37).
[0024] The nucleotide sequence of the forward primer in the (d)SDC2 gene specific site chr8:96494187 primer pair contains at least the continuous base sequence CCCCGAGCCTGAGCC (SEQ ID No. 25), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GCACACGAATCCGGAGCCCGAGC (SEQ ID No. 38).
[0025] In an optional embodiment, the forward primer in the primer pair for detecting methylation at a specific site chr4:153781309 of the (A)SFRP2 gene has the nucleotide sequence shown in SEQ ID No. 1, the capture primer has the nucleotide sequence shown in SEQ ID No. 2, and the probe has the nucleotide sequence shown in SEQ ID No. 3;
[0026] The forward primer in the primer pair for detecting methylation at a specific site chr4:153789201 of the (B)SFRP2 gene has the nucleotide sequence shown in SEQ ID No. 4, the capture primer has the nucleotide sequence shown in SEQ ID No. 5, and the probe has the nucleotide sequence shown in SEQ ID No. 6.
[0027] The forward primer in the primer pair for detecting methylation at a specific site chr4:153789431 of the (C)SFRP2 gene has the nucleotide sequence shown in SEQ ID No. 7, the capture primer has the nucleotide sequence shown in SEQ ID No. 8, and the probe has the nucleotide sequence shown in SEQ ID No. 9.
[0028] The forward primer in the primer pair for detecting methylation at a specific site chr4:153788844 of the (D)SFRP2 gene has the nucleotide sequence shown in SEQ ID No. 10, the capture primer has the nucleotide sequence shown in SEQ ID No. 11, and the probe has the nucleotide sequence shown in SEQ ID No. 12.
[0029] The forward primer in the primer pair for detecting methylation at a specific site chr4:153788604 of the (E)SFRP2 gene has the nucleotide sequence shown in SEQ ID No. 13, the capture primer has the nucleotide sequence shown in SEQ ID No. 14, and the probe has the nucleotide sequence shown in SEQ ID No. 15.
[0030] The forward primer in the primer pair for detecting methylation at a specific site chr8:96493501 of the SDC2 gene has the nucleotide sequence shown in SEQ ID No. 16, the capture primer has the nucleotide sequence shown in SEQ ID No. 17, and the probe has the nucleotide sequence shown in SEQ ID No. 18;
[0031] The forward primer in the primer pair for detecting the methylation of a specific site chr8:96493590 in the SDC2 gene (b) has the nucleotide sequence shown in SEQ ID No. 19, the capture primer has the nucleotide sequence shown in SEQ ID No. 20, and the probe has the nucleotide sequence shown in SEQ ID No. 21;
[0032] The forward primer in the primer pair for detecting methylation at a specific site chr8:96494113 of the (c)SDC2 gene has the nucleotide sequence shown in SEQ ID No. 22, the capture primer has the nucleotide sequence shown in SEQ ID No. 23, and the probe has the nucleotide sequence shown in SEQ ID No. 24;
[0033] The forward primer in the primer pair for detecting methylation at a specific site chr8:96494187 of the (d)SDC2 gene has the nucleotide sequence shown in SEQ ID No. 25, the capture primer has the nucleotide sequence shown in SEQ ID No. 26, and the probe has the nucleotide sequence shown in SEQ ID No. 27.
[0034] In an optional embodiment, the probe sequence is labeled with at least one fluorescent group; the fluorescent group is selected from FAM, VIC, CY5, HEX, JOE, ROX, TAMRA, TET, TexasRed or CY3.
[0035] Thirdly, the present invention provides a tumor diagnostic kit, the kit comprising the reagents and optional consumables described in any of the foregoing embodiments.
[0036] Fourthly, the present invention provides a system for detecting, predicting, or monitoring tumor development, the system comprising:
[0037] The detection module is used to detect the gene methylation status of known samples and test samples using the reagents or kits described in any of the foregoing embodiments;
[0038] The comparison module is used to determine the judgment reference data based on the methylation status data of known samples. It compares the gene methylation status of the sample to be tested obtained by the detection module with the judgment reference data and outputs the assessment result of tumor development based on the degree of similarity between the two.
[0039] The reference data were derived from at least one of the following subject populations: (a) non-tumor patients, (b) tumor patients;
[0040] The test samples were derived from the feces, tissues, or bodily fluids of the test subjects;
[0041] Preferably, the tumor includes an advanced adenoma.
[0042] Optionally, the tumor includes colorectal cancer.
[0043] Optionally, the tumor includes advanced colorectal adenoma.
[0044] This invention is the first to combine site-specific methylation detection of the SFRP2 gene with site-specific methylation detection of the SDC2 gene as a biomarker for the preparation of products for detecting, predicting or monitoring tumor development. Compared with the prior art, this invention (1) uses a set of primers and probes that correspond to only one methylation site, avoiding the instability of specificity and sensitivity that occurs in the prior art; (2) this invention combines the methylation sites of the SFRP2 gene and the SDC2 gene for detection, which significantly improves the detection sensitivity and specificity.
[0045] This invention also provides reagents, kits, and systems for cancer diagnosis, used to detect methylation including the site chr4:153781309. The aforementioned reagents, kits, and systems are for the detection of site-specific methylation of the SFRP2 gene. Compared with existing methods for detecting SFRP2 gene fragments, they eliminate the need for methylation conversion, significantly improving detection efficiency while reducing detection costs. Attached Figure Description
[0046] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0047] Figure 1 The ROC curve for the joint detection of polymethylation sites in Example 1 of the present invention is shown.
[0048] Figure 2 The ROC curve for the joint detection of polymethylation sites in Example 2 of the experimental examples of this invention;
[0049] Figure 3 The ROC curve for the joint detection of polymethylation sites in Example 3 of the experimental examples of this invention;
[0050] Figure 4 The ROC curve for the combined detection of polymethylation sites in Example 4 of the present invention is shown.
[0051] Figure 5 This is the ROC curve for the combined detection of polymethylation sites in the experimental examples of this invention. Detailed Implementation
[0052] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. The components of the embodiments of the present invention described and shown in the accompanying drawings can generally be arranged and designed in various different configurations.
[0053] Therefore, the following detailed description of the embodiments of the invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the invention without inventive effort are within the scope of protection of the invention.
[0054] It should be noted that similar labels and letters in the following figures indicate similar items. Therefore, once an item is defined in one figure, it does not need to be further defined and explained in subsequent figures.
[0055] The full-length region of the SFRP2 gene is chr4:153780360~153789700, and the full-length region of the SDC2 gene is chr8:96493169~96495331. The gene database is from: UCSC Genome Browser on Human Dec.2013(GRCh38 / hg38)Assembly.
[0056] In one specific embodiment, in a first aspect, the present invention provides the application of polymethylation sites in combination as biomarkers in the preparation of products for detecting, predicting or monitoring tumor development, wherein the polymethylation sites include a first source methylation site and a second source methylation site, wherein the first source methylation site is at least one methylation site derived from the SFRP2 gene, and the second source methylation site is at least one methylation site derived from the SDC2 gene.
[0057] It should be noted that the multiple methylation sites described in this invention are detected using their respective primer sets and probes, rather than using a single set of primers and probes to detect the methylation of multiple methylation sites in a gene.
[0058] In an optional embodiment, the first source methylation site is selected from at least one of (A) SFRP2 gene-specific site chr4:153781309, (B) SFRP2 gene-specific site chr4:153789201, (C) SFRP2 gene-specific site chr4:153789431, (D) SFRP2 gene-specific site chr4:153788844, or (E) SFRP2 gene-specific site chr4:153788604.
[0059] The preferred option is (A)SFRP2 gene specific site chr4:153781309.
[0060] In an optional embodiment, the second source methylation site is selected from at least one of (a) the SDC2 gene-specific site chr8:96493501, (b) the SDC2 gene-specific site chr8:96493590, (c) the SDC2 gene-specific site chr8:96494113, or (d) the SDC2 gene-specific site chr8:96494187.
[0061] In a second aspect, the present invention provides a tumor diagnostic reagent comprising a specific primer pair and a probe for detecting the methylation level of the polymethylation sites described in any of the foregoing embodiments.
[0062] Preferably, the reagent further includes a reverse primer.
[0063] It is understood that, for a specific methylation site, the specific primer pair can amplify a gene region containing that methylation site. Therefore, those skilled in the art can design and select probes within the amplified region for the purpose of detecting that specific methylation site. Similarly, for reverse primers, those skilled in the art can also conventionally design and select them according to the needs of detecting the SFRP2 and SDC2 genes. In one specific embodiment, the nucleotide sequence of the reverse primer used in this invention is GCCTGTCAGCCAACGGTATTCATC (SEQ ID No. 28).
[0064] In an optional embodiment, the methylation site includes at least one of (A) SFRP2 gene-specific site chr4:153781309, (B) SFRP2 gene-specific site chr4:153789201, (C) SFRP2 gene-specific site chr4:153789431, (D) SFRP2 gene-specific site chr4:153788844 or (E) SFRP2 gene-specific site chr4:153788604, and at least one of (a) SDC2 gene-specific site chr8:96493501, (b) SDC2 gene-specific site chr8:96493590, (c) SDC2 gene-specific site chr8:96494113 or (d) SDC2 gene-specific site chr8:96494187.
[0065] In an optional embodiment, the nucleotide sequence of the forward primer in the primer pair for detecting a specific site of the (A)SFRP2 gene chr4:153781309 contains at least the continuous base sequence TCCTTAGGTGAAAACAGCTAT (SEQ ID No. 29), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GTTTGCATCCCCAGCA (SEQ ID No. 30).
[0066] The nucleotide sequence of the forward primer in the (B)SFRP2 gene specific site chr4:153789201 primer pair contains at least the continuous base sequence GGGAGGAGCCAATGAAGGGTAAT (SEQ ID No. 4), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GCAAAACCAGACCCAGA (SEQ ID No. 31).
[0067] The nucleotide sequence of the forward primer in the (C)SFRP2 gene specific site chr4:153789431 primer pair contains at least the continuous base sequence CCAGCAGAAACTTCGGACTGG (SEQ ID No. 7), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GTGCCGCCGGGG (SEQ ID No. 32).
[0068] The nucleotide sequence of the forward primer in the (D)SFRP2 gene specific site chr4:153788844 primer pair contains at least the continuous base sequence CGGCCGCCTCGCCCTTC (SEQ ID No. 10), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GCGACCCCGAGGG (SEQ ID No. 33).
[0069] The nucleotide sequence of the forward primer in the chr4:153788604 primer pair for detecting a specific site of the (E)SFRP2 gene contains at least the continuous base sequence CGAGCACAGGAACTTCTTGGTGTC (SEQ ID No. 13), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GCTTGGATCCCGCT (SEQ ID No. 34).
[0070] The nucleotide sequence of the forward primer in the primer pair chr8:96493501 for detecting a specific site of the SDC2 gene contains at least the continuous base sequence GGGAAGAAA AGAGCATAGAGGAG (SEQ ID No. 16), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GTTTTCTCAGTCCTTT (SEQ ID No. 35).
[0071] The nucleotide sequence of the forward primer in the primer pair chr8:96493590 for detecting a specific site of the SDC2 gene in (b) contains at least the continuous base sequence GGCGGCAGTGTGACTC (SEQ ID No. 19), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GTGTAATCCTGTAGGAA (SEQ ID No. 36).
[0072] The nucleotide sequence of the forward primer in the primer pair chr8:96494113 for detecting a specific site of the (c)SDC2 gene contains at least the continuous base sequence CAGCGATTGCGGCTCAGGCT (SEQ ID No. 22), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GCCCCCGAGCCCCGCA (SEQ ID No. 37).
[0073] The nucleotide sequence of the forward primer in the (d)SDC2 gene specific site chr8:96494187 primer pair contains at least the continuous base sequence CCCCGAGCCTGAGCC (SEQ ID No. 25), and the nucleotide sequence of the capture primer contains at least the continuous base sequence GCACACGAATCCGGAGCCCGAGC (SEQ ID No. 38).
[0074] In an optional embodiment, the nucleotide sequence of the forward primer in the primer pair for detecting methylation at a specific site chr4:153781309 of the (A)SFRP2 gene is shown in SEQ ID No. 1 (TTTCCTTTAGGTGAAAACAGCTAT), and the nucleotide sequence of the capture primer is shown in SEQ ID No. 2.
[0075] (GCCTGTCAGCCAACGGTATTCATCTTTGTTTGCATCCCCAGCATTCTACAAGATTCGGGTGGG CT), the nucleotide sequence of the probe is shown in SEQ ID No.3 (CCACTCCTGTGGCCTT).
[0076] The forward primer in the primer pair for detecting methylation at a specific site chr4:153789201 of the (B)SFRP2 gene has the nucleotide sequence shown in SEQ ID No. 4 (GGGAGGAGCCAATGAAGGGTAAT), the capture primer has the nucleotide sequence shown in SEQ ID No. 5 (GCCTGTCAGCCAACGGTATTCATCTTTGCAAAACCAGACCCAGATTATGCAAATCTGGAGGG TGGGG), and the probe has the nucleotide sequence shown in SEQ ID No. 6 (CGAGGAGGGCTGGTC).
[0077] The forward primer in the primer pair for detecting methylation at a specific site chr4:153789431 of the (C)SFRP2 gene has the nucleotide sequence shown in SEQ ID No. 7 (CCAGCAGAAACTTCGGACTGG), the capture primer has the nucleotide sequence shown in SEQ ID No. 8 (GCCTGTCAGCCAACGGTATTCATCTTTGTGCCGCCGGGGCCTCTCCCACTCATGCCTGGCA), and the probe has the nucleotide sequence shown in SEQ ID No. 9 (CCCGGGCTTGTTTTGC).
[0078] The forward primer in the primer pair for detecting methylation at a specific site chr4:153788844 of the (D)SFRP2 gene has the nucleotide sequence shown in SEQ ID No. 10 (CGGCCGCCTCGCCCTTC), the capture primer has the nucleotide sequence shown in SEQ ID No. 11 (GCCTGTCAGCCAACGGTATTCATCTTTGCGACCCCGAGGGGGCCCGGGACAAGCTCGAACTC), and the probe has the nucleotide sequence shown in SEQ ID No. 12 (CTCCGCTCCCTCTGC).
[0079] The forward primer of the primer pair for detecting methylation at a specific site chr4:153788604 in the (E)SFRP2 gene has the nucleotide sequence shown in SEQ ID No. 13 (CGAGCACAGGAACTTCTTGGTGTC), the capture primer has the nucleotide sequence shown in SEQ ID No. 14 (GCCTGTCAGCCAACGGTATTCATCTTTGCTTGGATCCCGCTGTCATCGAGGCAGACGG), and the probe has the nucleotide sequence shown in SEQ ID No. 15 (CATGAAGCAGTGCCACC).
[0080] The forward primer in the primer pair for detecting the methylation of the specific site chr8:96493501 of the SDC2 gene has the nucleotide sequence shown in SEQ ID No. 16 (GGGAAGAAAAGAGCATAGAGGAG), the capture primer has the nucleotide sequence shown in SEQ ID No. 17 (GCCTGTCAGCCAACGGTATTCATCTTTGTTTTCTCAGTCCTTTGAAGGGA AAGAGAAAAGACAACG), and the probe has the nucleotide sequence shown in SEQ ID No. 18 (CTTCCTTTCTCTCCCCAC).
[0081] The forward primer in the primer pair for detecting the methylation of the specific site chr8:96493590 of the SDC2 gene (b) has the nucleotide sequence shown in SEQ ID No. 19 (GGCGGCAGTGTGACTC), the capture primer has the nucleotide sequence shown in SEQ ID No. 20 (GCCTGTCAGCCAACGGTATTCATCTTTGTGTAATCCTGTAGGAATTGGGCGACTGGGGAGA), and the probe has the nucleotide sequence shown in SEQ ID No. 21 (CCAGATAAACCCGGGAGA).
[0082] The forward primer in the primer pair for detecting methylation at a specific site chr8:96494113 of the (c)SDC2 gene has the nucleotide sequence shown in SEQ ID No. 22 (CAGCGATTGCGGCTCAGGCT), the capture primer has the nucleotide sequence shown in SEQ ID No. 23 (GCCTGTCAGCCAACGGTATTCATCtttGCCCCCGAGCCCCGCACACGAATCCGGAGCAGAGTAC), and the probe has the nucleotide sequence shown in SEQ ID No. 24 (CCCGAGTCCCCGAGC).
[0083] The forward primer in the primer pair for detecting methylation at a specific site chr8:96494187 of the (d)SDC2 gene has the nucleotide sequence shown in SEQ ID No. 25 (CCCCGAGCCTGAGCC), the capture primer has the nucleotide sequence shown in SEQ ID No. 26 (GCCTGTCAGCCAACGGTATTCATCTTTGCACACGAATCCGGAGCCCGAGCCCCGAGCCCG), and the probe has the nucleotide sequence shown in SEQ ID No. 27 (CAATCGCTGCGGTACTC).
[0084] In an optional embodiment, the probe sequence is labeled with at least one fluorescent group; the fluorescent group is selected from FAM, VIC, CY5, HEX, JOE, ROX, TAMRA, TET, TexasRed or CY3.
[0085] Thirdly, the present invention provides a tumor diagnostic kit, the kit comprising the reagents and optional consumables described in any of the foregoing embodiments.
[0086] It should be understood that the optional consumables in the above-mentioned reagent kit are essential consumable materials packaged with the reagent kit to ensure the smooth implementation of the reagent kit test, including but not limited to liquid dispensing devices, reaction containers, cleaning devices, and mixing devices. Those skilled in the art can make adaptive updates and selections based on improvements to the reagent kit consumables. Unless they have a decisive impact on the test results, the above-mentioned adaptive selections should be understood as being within the scope of protection of this invention.
[0087] Fourthly, the present invention provides a system for detecting, predicting, or monitoring tumor development, the system comprising:
[0088] The detection module is used to detect the gene methylation status of known samples and test samples using the reagents or kits described in any of the foregoing embodiments;
[0089] The comparison module is used to determine the judgment reference data based on the methylation status data of known samples. It compares the gene methylation status of the sample to be tested obtained by the detection module with the judgment reference data and outputs the assessment result of tumor development based on the degree of similarity between the two.
[0090] The reference data were derived from at least one of the following subject populations: (a) non-tumor patients, (b) tumor patients;
[0091] The test samples were derived from the feces, tissues, or bodily fluids of the test subjects;
[0092] Preferably, the tumor includes an advanced adenoma.
[0093] Optionally, the tumor includes colorectal cancer.
[0094] Optionally, the tumor includes advanced colorectal adenoma.
[0095] It should be noted that those skilled in the art can select the method for determining the closeness between the detection data and the reference data described in this invention according to different actual needs. The actual needs include detection speed, detection throughput, or detection accuracy, etc. The determination method may be to compare the methylation evaluation parameters (including but not limited to the ΔCt value of the amplification curve) corresponding to the detection data and the reference data to obtain the matching degree between the detection data and the reference data; or it may be to build a prediction model based on the reference data and use the prediction model to analyze the detection data.
[0096] The following detailed description of some embodiments of the present invention is provided in conjunction with the accompanying drawings. Unless otherwise specified, the following embodiments and features can be combined with each other.
[0097] Example 1
[0098] This embodiment provides a set of primer pairs and probes for detecting methylation at a specific site chr4:153781309 of the SFRP2 gene and methylation at a specific site chr8:96494187 of the SDC2 gene. The nucleotide sequence of the forward primer for detecting methylation at the specific site chr4:153781309 of the SFRP2 gene is TTTCCTTTAGGTGAAAACAGCTAT, the nucleotide sequence of the capture primer is GCCTGTCAGCCAACGGTATTCATCTTTGTTTGCATCCCCAGCATTCTACAAGATTCGGGTGGGCT, and the nucleotide sequence of the probe is CCACTCCTGTGGCCTT. The 5' end of the probe is modified with a FAM fluorescent group. The nucleotide sequence of the forward primer for detecting methylation at a specific site chr8:96494187 of the SDC2 gene is CCCCGAGCCTGAGCC, the nucleotide sequence of the capture primer is GCCTGTCAGCCAACGGTATTCATCTTTGCACACGAATCCGGAGCCCGAGCCCCGAGCCCG, the nucleotide sequence of the probe is CAATCGCTGCGGTACTC, the 5' end of the probe is modified with a FAM fluorescent group, and the nucleotide sequence of the reverse primer is GCCTGTCAGCCAACGGTATTCATC.
[0099] It should be noted that the probe described in this embodiment can also be selected in other ways, as long as its target site is located in the amplification region chr4:153781219~153781309 and chr8:96494118~96494187 respectively. The modified fluorescent group can also be VIC, CY5, HEX, JOE, ROX, TAMRA, TET, TexasRed or CY3.
[0100] Example 2
[0101] Based on Example 1, this embodiment further includes a primer pair and a probe for detecting methylation at a specific site chr8:96494113 of the SDC2 gene. The nucleotide sequence of the forward primer is CAGCGATTGCGGCTCAGGCT, the nucleotide sequence of the capture primer is GCCTGTCAGCCAACGGTATTCATCtttGCCCCCGAGCCCCGCACACGAATCCGGAGCAGAGTAC, and the nucleotide sequence of the probe is CCCGAGTCCCCGAGC. The 5' end of the probe is modified with a FAM fluorescent group.
[0102] Example 3
[0103] Based on Example 2, this embodiment further includes a primer pair and a probe for detecting methylation at a specific site chr8:96493501 of the SDC2 gene. The nucleotide sequence of the forward primer is GGGAAGAAAAGAGCATAGAGGAG, the nucleotide sequence of the capture primer is GCCTGTCAGCCAACGGTATTCATCtttGTTTTCTCAGTCCTTTGAAGGGA AAGAGAAAAGACAACG, and the nucleotide sequence of the probe is CTTCCTTTCTCTCCCCAC. The 5' end of the probe is modified with a FAM fluorescent group.
[0104] Example 4
[0105] Based on Example 3, this embodiment further includes a primer pair and a probe for detecting methylation at a specific site chr8:96493590 of the SDC2 gene. The nucleotide sequence of the forward primer is GGCGGCAGTGTGACTC, the nucleotide sequence of the capture primer is GCCTGTCAGCCAACGGTATTCATCTTTGTGTAATCCTGTAGGAATTGGGCGACTGGGGAGA, and the nucleotide sequence of the probe is CCAGATAAACCCGGGAGA. The 5' end of the probe is modified with a FAM fluorescent group.
[0106] Example 5
[0107] Based on Example 4, this embodiment replaces the primer pair and probe for detecting methylation at a specific site chr4:153781309 of the SFRP2 gene with the primer pair and probe for detecting methylation at a specific site chr4:153789201 of the SFRP2 gene. The nucleotide sequence of the forward primer is GGGAGGAGCCAATGAAGGGTAAT, the nucleotide sequence of the capture primer is GCCTGTCAGCCAACGGTATTCATCTTTGCAAAACCAGACCCAGATTATGCAAATCTGGAGGGTGGGG, and the nucleotide sequence of the probe is CGAGGAGGGCTGGTC.
[0108] Example 6
[0109] Based on Example 4, this embodiment further includes primer pairs and probes for detecting methylation at specific sites chr4:153789201, chr4:153789431, chr4:153788844, and chr4:153788604 of the SFRP2 gene. The nucleotide sequence of the forward primer of the primer pair for detecting the specific site chr4:153789201 of the SFRP2 gene is GGGAGGAGCCAATGAAGGGTAAT, the nucleotide sequence of the capture primer is GCCTGTCAGCCAACGGTATTCATCTTTGCAAAACCAGACCCAGATTATGCAAATCTGGAGGGTGGGG, and the nucleotide sequence of the probe is CGAGGAGGGCTGGTC. The 5' end of the probe is modified with a FAM fluorescent group.
[0110] The nucleotide sequence of the forward primer of the SFRP2 gene specific site chr4:153789431 primer pair is CCAGCAGAAACTTCGGACTGG, the nucleotide sequence of the capture primer is GCCTGTCAGCCAACGGTATTCATCTTTGTGCCGCCGGGGCCTCTCCCACTCATGCCTGGCA, and the nucleotide sequence of the probe is CCCGGGCTTGTTTTGC. The 5' end of the probe is modified with a FAM fluorescent group.
[0111] The nucleotide sequence of the forward primer of the SFRP2 gene specific site chr4:153788844 primer pair is CGGCCGCCTCGCCCTTC, the nucleotide sequence of the capture primer is GCCTGTCAGCCAACGGTATTCATCTTTGCGACCCCGAGGGGGCCCGGGACAAGCTCGAACTC, and the nucleotide sequence of the probe is CTCCGCTCCCTCTGC. The 5' end of the probe is modified with a FAM fluorescent group.
[0112] The nucleotide sequence of the forward primer of the SFRP2 gene specific site chr4:153788604 primer pair is CGAGCACAGGAACTTCTTGGTGTC, the nucleotide sequence of the capture primer is GCCTGTCAGCCAACGGTATTCATCTTTGCTTGGATCCCGCTGTCATCGAGGCAGACGG, and the nucleotide sequence of the probe is CATGAAGCAGTGCCACC. The 5' end of the probe is modified with a FAM fluorescent group.
[0113] Comparative Example
[0114] Compared with Example 1, this comparative example only changed the detection sites in Example 1 to two other sites. The changed sites and the corresponding primer sets and probes are as follows:
[0115] Primer pairs and probes were used to detect methylation at a specific site chr4:153789431 in the SFRP2 gene. The nucleotide sequence of the forward primer was CCAGCAGAAACTTCGGACTGG, the nucleotide sequence of the capture primer was GCCTGTCAGCCAACGGTATTCATCTTTGTGCCGCCGGGGCCTCTCCCACTCATGCCTGGCA, and the nucleotide sequence of the probe was CCCGGGCTTGTTTTGC.
[0116] Primer pairs and probes were used to detect methylation at a specific site chr8:96494113 in the SDC2 gene. The nucleotide sequence of the forward primer was CAGCGATTGCGGCTCAGGCT, the nucleotide sequence of the capture primer was GCCTGTCAGCCAACGGTATTCATCtttGCCCCCGAGCCCCGCACACGAATCCGGAGCAGAGTAC, and the nucleotide sequence of the probe was CCCGAGTCCCCGAGC.
[0117] Experimental Example 1
[0118] The primer sets and probes provided in Examples 1-4 and the comparative examples were used for early screening of colorectal cancer according to the following methods:
[0119] 1. Extraction of human DNA from feces:
[0120] Human DNA from feces can be obtained by any method. In this example, a soil and fecal genomic DNA extraction kit (catalog number: TD601) from Beijing Tianmo Technology Development Co., Ltd. is used. The specific operation is as follows:
[0121] (1) Take 2g of fresh fecal sample into a fecal collection tube. The collection tube is pre-filled with 10ml of preservation solution (Beijing Tianmo Technology Development Co., Ltd., product number: TR110). Mix thoroughly. Take 600μL of the mixture into a lysis tube and vortex at maximum speed for more than 5 minutes to mix. Place the lysis tube in a centrifuge and centrifuge at ≥10000×g for 1 minute.
[0122] (2) Add 400 μL of the obtained supernatant to column F of column 3. Column F of column 3 is placed in a collection tube. Centrifuge at 8000×g for 1 minute, discard the filter column, add 1200 μL of genomic DNA lysis buffer to the collection tube of the previous step and mix thoroughly. Place column 2 in a new collection tube, take 700 μL of the mixture and add it to column 2. Centrifuge at 10000×g for 1 minute and discard the waste liquid in the collection tube.
[0123] (3) Repeat step (2) until all the mixture is used up.
[0124] (4) Place column 2 into a new collection tube, add 200 μl of genomic DNA washing buffer 1 to column 2, centrifuge at ≥10000×g for 1 minute, add 500 μl of genomic DNA washing buffer 2 to column 2, and centrifuge at ≥10000×g for 1 minute.
[0125] (5) Repeat step (4), discard the waste liquid in the collection tube, and put column No. 2 back into the collection tube. Centrifuge at ≥10000×g for 2 minutes to remove as much washing liquid as possible to avoid residual ethanol in the washing liquid inhibiting the downstream reaction. Transfer column No. 2 to a clean 1.5ml centrifuge tube and add 120μl of genomic DNA elution buffer directly onto the column matrix. Incubate at room temperature for 2-5 minutes, and centrifuge at ≥10000×g for 1 minute to elute genomic DNA. Put the inhibitor removal column into a collection tube, add 600μl of inhibitor removal buffer, and centrifuge at ≥8000×g for 3 minutes.
[0126] (6) Place the eluted genomic DNA into the prepared inhibitor removal column, which is placed in a clean 1.5 ml centrifuge tube and centrifuged at 16000 x g for 3 minutes.
[0127] (7) Repeat step (6) to obtain genomic DNA for subsequent methylation detection experiments.
[0128] 2. Enzyme digestion reaction
[0129] Enzyme digestion reaction system:
[0130] composition concentration Single-hole reaction dosage Taq enzyme buffer 1X 1μL Gla I 12.5U 0.25μL 200mM Trehalose 20mM 1μL DNA 4μL water 3.75μL
[0131] After thorough mixing and momentary incubation, place in a constant temperature incubator at 30℃ for 20 min, 65℃ for 30 min, and store at 4℃; the product after reaction is the template for methylation detection.
[0132] 3. Methylation detection:
[0133] PCR reaction system:
[0134]
[0135]
[0136]
[0137] (1) Take out PCR reaction solution 1, PCR reaction solution 2, primers and positive control, thaw them, shake for 30s, and centrifuge for 30s to prevent reagent residue from remaining in the tube cap.
[0138] (2) Preparation of reaction solution: Calculate the number of reaction solution tubes to be dispensed based on the number of samples to be amplified and detected.
[0139] composition main components PCR reaction solution 1 1.8μL Primers 9.6μL PCR reaction solution 2 0.6μL
[0140] (3) Dispensing: Dispense the prepared reaction solution into reaction tubes / reaction plates at a rate of 12 μL / tube.
[0141] (4) Sample addition: Add 8 μL each of the prepared negative control NC, enzyme digestion product, and positive control PC to each reaction tube containing the pre-allocated reaction solution in sequence. After adding the samples, cap the tubes or seal them with a membrane, centrifuge briefly for 30 seconds, and immediately perform the PCR amplification reaction.
[0142] Set up and run the PCR amplification program according to the table below.
[0143] PCR amplification procedure:
[0144]
[0145] Result judgment:
[0146] After the positive control, negative control, and internal control are deemed satisfactory, the sample test results can be judged according to the following evaluation model. The weighting coefficients for different sites in each embodiment and comparative example are as follows:
[0147] site CT value chr8:96494187 <![CDATA[X1]]> chr8:96494113 <![CDATA[X2]]> chr8:96493590 <![CDATA[X3]]> chr8:96493501 <![CDATA[X4]]> chr4:153781309 <![CDATA[X5]]> chr4:153789431 <![CDATA[X6]]>
[0148] Example 1 <![CDATA[Y=-0.525×X1-0.775×X5+42.732]]> Example 2 <![CDATA[Y=-0.718×X1+0.270×X2-0.865×X5+43.306]]> Example 3 <![CDATA[Y=-0.669×X1+0.388×X2-0.180×X4-0.994×X5+48.130]]> Example 4 <![CDATA[Y=-0.682×X1+0.387×X 2+ 0.039×X3-0.189×X4-1.002×X5+47.990]]> Comparative Example <![CDATA[Y=-515×X2+0.133×X6+12.748]]>
[0149] The study included 108 fecal samples from patients with known clinical diagnoses, comprising 71 samples from colorectal cancer patients and 37 normal samples. DNA extraction, enzyme digestion, and methylation detection were performed. The p-value was calculated using the logistic regression formula: p = 1 / (1 + Exp^((-1) × Y)).
[0150] The test results and P-values are shown in the table below:
[0151]
[0152]
[0153]
[0154] The criteria for interpreting the diagnostic results are as follows:
[0155]
[0156] Different embodiments and comparative examples are based on the diagnostic results of fecal samples, as well as the detection sensitivity and specificity, as follows:
[0157]
[0158]
[0159]
[0160]
[0161]
[0162] Example Sensitivity Specificity AUC Example 1 97.2% 94.6% 0.975 Example 2 94.4% 91.9% 0.981 Example 3 94.4% 91.9% 0.982 Example 4 94.4% 91.9% 0.982 Comparative Example 91.5% 73.0% 0.921
[0163] The ROC curve analysis results are as follows: Figure 1 As shown in the table above, the diagnostic results and Figure 1 As can be seen, the combined detection reagents for polymethylation sites derived from the SFRP2 and SDC2 genes provided in Examples 1-4 of this invention have achieved a sensitivity and specificity of over 90% for colorectal cancer diagnosis, representing a significant improvement over existing detection methods.
[0164] Experiment Example 2
[0165] This experiment included 31 patients with advanced adenomas, 1 patient with unstaged colorectal cancer, 18 patients with stage I colorectal cancer, 30 patients with stage II colorectal cancer, 30 patients with stage III colorectal cancer, and 30 patients with stage IV colorectal cancer. The detection method described in Example 1 was used, employing the primer set and probe for the detection site chr4:153781309 as described in Example 1 for single-point detection. This was compared with combined detection using the combined site described in Example 1 to examine the difference in detection rates between single-point and combined detection for colorectal cancer samples at different clinical stages. The results are as follows:
[0166] The single-point detection result for site chr4:153781309 is as follows:
[0167]
[0168] The detection results for the combined chr4:153781309 and chr8:96494187 loci are as follows:
[0169]
[0170] It can be seen that the combined detection of two points is significantly better than that of single-point detection in different clinical stages, especially in the detection of advanced adenomas.
[0171] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. Application of reagents for detecting polymethylation sites in the preparation of tumor diagnostic products, wherein the polymethylation sites include a first-source methylation site and a second-source methylation site, the first-source methylation site being a methylation site derived from the SFRP2 gene (chr4:153781309), and the second-source methylation site being a methylation site derived from the SDC2 gene (chr8:96494187); the gene library is from: UCSC Genome Browser on Human Dec. 2013 (GRCh38 / hg38) Assembly; The tumor is colorectal cancer; The reagent contains specific primer pairs, probes, reverse primers, and Gla I enzymes for detecting the methylation level of the polymethylation sites; The nucleotide sequence of the forward primer in the primer pair for detecting methylation at a specific site chr4:153781309 of the SFRP2 gene is shown in SEQ ID No. 1, the nucleotide sequence of the capture primer is shown in SEQ ID No. 2, and the nucleotide sequence of the probe is shown in SEQ ID No.
3. The nucleotide sequence of the forward primer in the primer pair for detecting methylation at a specific site chr8:96494187 of the SDC2 gene is shown in SEQ ID No. 25, the nucleotide sequence of the capture primer is shown in SEQ ID No. 26, and the nucleotide sequence of the probe is shown in SEQ ID No.
27. The nucleotide sequence of the reverse primer is shown in SEQ ID No.
28.
2. A system for tumor diagnosis, characterized in that, The system includes: The detection module is used to detect the methylation status of specific sites in genes of known samples and samples to be tested using reagents; The comparison module is used to determine the judgment reference data based on the methylation status data of known samples. It compares the methylation status of specific sites of genes in the test sample obtained by the detection module with the judgment reference data, and outputs the assessment result of tumor diagnosis based on the degree of similarity between the two. The reference data were obtained from the following subjects: (a) non-tumor patients, (b) tumor patients; The test samples were derived from the feces of the test subjects; The tumor is colorectal cancer; The reagent comprises a specific primer pair, a probe, a reverse primer, and a Gla I enzyme for detecting the methylation level of the polymethylation site of claim 1; The nucleotide sequence of the forward primer in the primer pair for detecting methylation at a specific site chr4:153781309 of the SFRP2 gene is shown in SEQ ID No. 1, the nucleotide sequence of the capture primer is shown in SEQ ID No. 2, and the nucleotide sequence of the probe is shown in SEQ ID No.
3. The nucleotide sequence of the forward primer in the primer pair for detecting methylation at a specific site chr8:96494187 of the SDC2 gene is shown in SEQ ID No. 25, the nucleotide sequence of the capture primer is shown in SEQ ID No. 26, and the nucleotide sequence of the probe is shown in SEQ ID No.
27. The nucleotide sequence of the reverse primer is shown in SEQ ID No.
28.
3. The system according to claim 2, characterized in that, The probe sequence is labeled with at least one fluorescent group; the fluorescent group is selected from FAM, VIC, CY5, HEX, JOE, ROX, TAMRA, TET, TexasRed or CY3.
Citation Information
Patent Citations
Primers, probes and kit for detecting specific methylation of colorectal tumor
CN110373470A
SDC2 methylation detection kit and application thereof
CN114854854A