Marker combinations, primer probe combinations, kits and uses for detecting multi-subtype ovarian cancer and ovarian borderline tumors

Abstract

The present application relates to the technical field of medical detection, and particularly relates to a marker combination, a primer probe combination, a kit and application for detecting multiple subtypes of ovarian cancer and borderline ovarian tumors. The marker combination comprises at least 3 of the following differential methylation regions: a differential methylation region of IFFO1, a differential methylation region of TFAP2E-AS1, a differential methylation region of WNT6, and a differential methylation region of AC104801.1. The present application can comprehensively cover the detection of multiple subtypes of ovarian cancer and borderline ovarian tumors, is suitable for liquid biopsy, and has high sensitivity and high specificity.

Description

Technical Field

[0001] This invention relates to the field of medical testing technology, specifically to biomarker combinations, primer-probe combinations, kits, and applications for detecting multiple subtypes of ovarian cancer and borderline ovarian tumors. Background Technology

[0002] Ovarian cancer is one of the most common malignant tumors in gynecology. Due to its subtle early symptoms and difficulty in diagnosis, most patients are diagnosed at an advanced stage. Ovarian cancer exhibits high heterogeneity, including epithelial ovarian cancers such as high-grade serous carcinoma, endometrioid carcinoma, and clear cell carcinoma, as well as non-epithelial ovarian cancers such as sex cord-stromal tumors and germ cell tumors. In addition, there are borderline ovarian tumors, whose biological behavior falls between benign and malignant.

[0003] Currently, commonly used clinical methods for ovarian cancer diagnosis include imaging examinations and serum CA125 testing, but their sensitivity and specificity are limited, especially for early-stage ovarian cancer and borderline tumors. In recent years, liquid biopsy technology based on DNA methylation has become a research hotspot for early tumor diagnosis due to its advantages such as being non-invasive, highly sensitive, and reproducible. There are some existing reports on ovarian cancer methylation biomarkers. For example, CN114672557A focuses on the application of a test kit for detecting tumor drug resistance, but the sample size is small and it does not involve the differentiation between benign and malignant tumors; CN117512106A involves the WNT6 gene as a diagnostic biomarker for ovarian cancer and its application, but it only protects the WNT6 gene expression level and does not involve DNA methylation detection; CN119177288A involves a DNA methylation combination biomarker of IFFO1 and TFAP2E, but it does not provide specific data for benign ovarian diseases and has insufficient sensitivity for early ovarian cancer detection; CN202510137281 and CN202210208334 (WO2023165035) have incomplete coverage of sample types or disease subtypes and lack systematic validation for non-epithelial ovarian cancer, borderline tumors, and early cases.

[0004] In summary, existing technologies have not yet provided a highly sensitive and specific DNA methylation detection biomarker combination that can simultaneously cover multiple subtypes of ovarian cancer (including early and late stages), encompass borderline tumors, and effectively differentiate benign ovarian diseases. Therefore, this invention provides a biomarker combination, primer-probe combination, kit, and application for detecting multiple subtypes of ovarian cancer and borderline ovarian tumors. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a combination of biomarkers, primer-probe combinations, kits and applications for detecting multiple subtypes of ovarian cancer and borderline ovarian tumors.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: In a first aspect, a combination of biomarkers for detecting multiple subtypes of ovarian cancer and borderline ovarian tumors, the combination of biomarkers comprising at least three of the following differentially methylated regions: differentially methylated region of IFFO1, differentially methylated region of TFAP2E-AS1, differentially methylated region of WNT6, and differentially methylated region of AC104801.1. The differentially methylated region of IFFO1 is located at chr12:6555557-6555857 (hg38). The differentially methylated region of TFAP2E-AS1 is located at chr1:35577235-35577633 (hg38). The differentially methylated region of WNT6 is located at chr2:218871435-218871894 (hg38). The differentially methylated region of AC104801.1 is located at chr2:172108005-172108422 (hg38).

[0007] Based on the above technical solution, the present invention can be further improved as follows.

[0008] Furthermore, the combination of markers includes at least one of the following (a) to (e): (a) Differentially methylated regions of IFFO1, TFAP2E-AS1, and WNT6; (b) Differential methylation regions of IFFO1, TFAP2E-AS1, and AC104801.1; (c) Differential methylation regions of IFFO1, WNT6, and AC104801.1; (d) Differential methylation regions of TFAP2E-AS1, WNT6, and AC104801.1; (e) Differential methylation regions of IFFO1, TFAP2E-AS1, WNT6 and AC104801.1.

[0009] Secondly, a primer-probe combination for detecting the marker combination.

[0010] Furthermore, the nucleotide sequences of the primer-probe combination for detecting the differentially methylated regions of IFFO1 are as shown in SEQ ID NO: 5-6, 13-15; The nucleotide sequences of the primer-probe combination for detecting the differentially methylated region of TFAP2E-AS1 are shown in SEQ ID NO:7-8, 16-18; The nucleotide sequences of the primer-probe combination for detecting the differentially methylated region of WNT6 are shown in SEQ ID NO: 9-10 and 19-21. The nucleotide sequences of the primer-probe combination for detecting the differentially methylated regions of AC104801.1 are shown in SEQ ID NO:11-12 and 22-24.

[0011] Thirdly, the application of a combination of biomarkers for detecting multiple subtypes of ovarian cancer and borderline ovarian tumors, wherein the combination of biomarkers is used in the preparation of products for detecting or prognostic assessment of multiple subtypes of ovarian cancer or borderline ovarian tumors.

[0012] Fourthly, the application of a primer-probe combination in the preparation of a product for detecting or assessing prognostic conditions of multiple subtypes of ovarian cancer, or borderline ovarian tumors.

[0013] Furthermore, the product includes a kit or reagent.

[0014] Fifthly, a kit comprising the aforementioned primer-probe combination.

[0015] Furthermore, it also includes DNA extraction reagents and bisulfite conversion reagents.

[0016] Sixthly, a detection reagent comprising the aforementioned primer-probe combination.

[0017] The beneficial effects of this invention are: (1) High sensitivity and high specificity: The biomarker combination of the present invention has a maximum sensitivity of 91.67% for early ovarian cancer (stage I / II) (combination 1 and combination 5), a maximum sensitivity of 88.89% for borderline tumors (combination 1 and combination 5), and a maximum specificity of 94.55% for benign ovarian diseases (combination 2), which is significantly better than the prior art.

[0018] (2) Comprehensive coverage of multiple subtypes: It can simultaneously detect epithelial ovarian cancer, non-epithelial ovarian cancer (sex cord-stromal tumors, germ cell tumors) and borderline tumors, covering a wide spectrum of diseases.

[0019] (3) Suitable for liquid biopsy: It can be stably detected in plasma cfDNA, enabling non-invasive and early diagnosis.

[0020] (4) Multiplex fluorescent PCR detection: The pre-amplification combined with multiplex qPCR probe method is used, which has high detection throughput, stable results and simple operation. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the sample screening and verification process of the present invention; Figure 2 The images show four-channel fluorescence curves for the fluorescent probe method; the left side shows the four-channel fluorescence curve for positive samples, and the right side shows the four-channel fluorescence curve for negative samples. Detailed Implementation

[0022] The principles and features of this invention are described below. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they should be performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0023] Example 1: Screening and Validation of Biomarkers Tissue samples were collected from stage I-II (28 cases) and stage III-IV (53 cases) of epithelial ovarian cancer, stage I-II (8 cases) and stage III-IV (11 cases) of non-epithelial ovarian cancer, tissue samples from borderline ovarian tumors (16 cases) (Table 1), and whole blood samples from benign ovarian diseases (49 cases, Table 2). All samples were collected and preserved in the Tongji Hospital Obstetrics and Gynecology Biobank from previous years (2020-2024) and retrieved from the biobank according to pathological type. Whole-genome bisulfite sequencing (WGBS) was performed on the above samples, and bioinformatics analysis was used to obtain differentially methylated regions (DMRs). Sanger sequencing was then performed to verify each region. Finally, it was determined that the DMR regions of the IFFO1, TFAP2E-AS1, WNT6, and AC104801.1 genes showed significant methylation differences. The specific grouping and procedures are as follows. Figure 1 As shown.

[0024] Table 1 Table 2 The tissue samples and whole blood samples mentioned above were subjected to Sanger sequencing again to verify the DMR of the four genes (IFFO1, TFAP2E-AS1, WNT6, and AC104801.1). The results of methylation ratio (sensitivity) and non-methylation ratio (specificity) are summarized in Tables 3 to 10: Table 3. Methylation ratio of IFFO1-DMR Table 4. Demethylation ratio of IFFO1-DMR The results in Tables 3 and 4 show that the overall sensitivity of the IFFO1-DMR region for epithelial ovarian cancer, non-epithelial ovarian cancer, and borderline tumors was 94.83%, and the overall specificity for benign ovarian diseases was 98.55%.

[0025] Table 5. Methylation ratio of TFAP2E-AS1-DMR Table 6. Demethylation ratio of TFAP2E-AS1-DMR The results in Tables 5 and 6 show that the overall sensitivity of the TFAP2E-AS1-DMR region for epithelial ovarian cancer, non-epithelial ovarian cancer, and borderline tumors is 94.83%, and the overall specificity for benign ovarian diseases is 95.65%.

[0026] Table 7 Methylation ratio of WNT6-DMR Table 8. Nonmethylation ratio of WNT6-DMR The results in Tables 7 and 8 show that the overall sensitivity of the WNT6-DMR region for epithelial ovarian cancer, non-epithelial ovarian cancer, and borderline tumors was 98.28%, and the overall specificity for benign ovarian diseases was 89.86%.

[0027] Table 9. Methylation ratio of AC104801.1-DMR Table 10. Demethylation ratio of AC104801.1-DMR The results in Tables 9 and 10 show that the overall sensitivity of the AC104801.1-DMR region for epithelial ovarian cancer, non-epithelial ovarian cancer, and borderline tumors is 90.52%, and the overall specificity for benign ovarian diseases is 94.20%.

[0028] The specific locations of the DMR regions of the four genes IFFO1, TFAP2E-AS1, WNT6, and AC104801.1 mentioned above are shown in Table 11: Table 11 Specific locations of DMR regions The bisulfite transformation sequences of the DMR regions of the above four genes are shown below: mIFFO1-DMR (SEQ ID NO:1): CGGTTTCGTTTGTCGTTATGGTTTTTCGTAATGATTTGGGTTTTTAATATTAACGTGTTTAAGATTTTGAATTTTTCGGTTTCGTTGTTTTGGTTAAGGTGTATGAGTTGGAGCGTCGGAATCGGTTGTTGGAGAAGTAATTGTAGTAAGCGTTGGAGGAGGTAAGTAGGGTCGGCGGGGTTGGGTCGTCGCGGATTTAGGTAGTGTAGATCGGTTCGTTAGTTTTATTCGGTTTTTGGGTTGTAGTTGGGCGTTCGGTCGGTCGTTGTTTGTAGTTTTTCGGCGCGCGGTTGTTGGGGTTTT.

[0029] mTFAP2E-AS1-DMR(SEQ ID NO:2): TAGTTGCGGCGGCGAGGTAGGTGGGTTTTTTGTTTTTTGGAGTCGTTTTTTTATATTTTGTTTTCGGCGTTTTTAGTAGTTTTATTTTGGTTTTTCGCGGTTATTGCGGGATTCGGCGTTGTCGTTAGTTTAGTGGGGAGTGAATTAGCGTTTTTTTCGTTTTCG GTTTTTTCGACGGTACGAGGAATTTTTGTTTTGTTTTATAGATTTTCGGTTTTCGTCGAGTGCGGTATTGGAGTTTGTTTCGTTAGGGTTTTGGAATTAGAAAGTCGTTTTTTGGTTATTTGAAGCGTCGGATTTTTATAGTGTTTTTTTAGTTTGGGCGGGAGCG。

[0030] mWNT6-DMR (SEQ ID NO:3): TTTAGTTGATCGTTTTAGTTCGCGTTGATTGTATTTGTTTGTATTTATAGATATTCGGGAGACGGTTTTCGTGTTCGTTATTATTGCGGTCGGCGTTAGTTACGTCGTTACGTAGGTTTGTTTTATGGGCGAGTTGTTGTAGTGCGGTTGTTAGGCGTTTCGCGGGCGGGTTTTTTTTCGGTTTTTCGGTTTGTTCGGTATTTTCGGATTTTTTGGTTTCGCGGGTTTTTCGGAAGGTAGCGTCGTTTGGGAGTGGGGAGGTTGCGGCGACGACGTGGATTTCGGGGACGAGAAGTCGAGGTTTTTTATGGACGCGCGGTATAAGCGGGGACGCGGAGATATTCGCGCGTTGGTGTAATTGTATAATAACGAGGCGGGTAGGTTGGTGCGTACGGGTAGGATGGAGTGAGTGTGTGCGGAAATGTGAGTGTGCGCGTAGGAGTGTGTTTGAGGAAGTGTT。

[0031] mAC104801.1 - DMR (SEQ ID NO:4): AGTTAATTATATGGTTATCGACGCGTAGTAGAGTTCGATTTCGAATTTAGATTTGGGTTATGGAGGTAAGGTCGTTGTCGTTTTGGGTTGTTTTCGGTTAGGGGACGCGAGAGAAGGCGGTATTATATTTATTTTTTTCGGGTTTGGTGTTGTTAGTTTCGCGGAATAGATTGGAAGGGGTATTGGTCGTTTTGAGGGCGATCGCGTTTTTTTTTTTTTAAAGAGAGTTTTGGAAGGGGGGTTTTTTTGGGAGAGGAGGAGGTTCGTTCGGTTGCGTAGAGGGTAGTTTCGGGAAGATTTTTGAATAGATTCGAGTTTTTGCGGAGAGGGCGGGATGCGGGTGTTTTTTGGTTTGGTACGTGAAGTTAAGTTTGAGGATTTGATGTTTTGTTTTCGTTGGGATTTCGTTTTAAGTTAT。

[0032] Example 2: Primer and Probe Design and Kit Construction Amplification primers, detection primers, and TaqMan probes were designed for the four DMRs (IFFO1, TFAP2E-AS1, WNT6, and AC104801.1) to construct a multiplex fluorescent PCR detection system. Using the bisulfite transformation sequences corresponding to the DMRs of these four genes as templates, amplification primers, detection primers, and probes were designed, as shown in Tables 12 and 13. Table 12 Amplification primers and detection primers Table 13 Probes Example 3: Clinical Sample Validation The kit constructed using Example 2 described above was used to test clinical plasma samples (including ovarian cancer, borderline tumors, and benign diseases). Results showed that the kit has good clinical applicability, and the test results showed high consistency with the gold standard in histopathology. A portion of the plasma samples were collected and stored in the Tongji Hospital Obstetrics and Gynecology Biobank from June 2024 to February 2025, and were retrieved from the biobank according to pathological type. The remaining plasma samples were collected by nurses in the gynecologic oncology ward of Tongji Hospital from May to September 2025.

[0033] The biomarker combinations (a total of 5) in the multiplex qPCR fluorescent probe system are shown in Table 14: Table 14. Combination of Markers 2 mL of plasma was extracted using a plasma cfDNA extraction kit (Nanjing Novizan Biotechnology Co., Ltd., VAMNE MagUltraCirculating Cell-free DNA Isolation Kit, catalog number N913) according to the instructions to obtain 25 uL of cfDNA.

[0034] The cfDNA obtained was transformed using the cfDNA bisulfite conversion kit (Nanjing Novizan Biotechnology Co., Ltd., EpiArt Ultrafast Magnetic DNA Methylation Bisulfite Kit, catalog number EM113) according to the instructions to obtain bis-cfDNA, 25 uL.

[0035] Pre-amplification forward and reverse primers for the DMRs of the genes corresponding to combinations 1, 2, 3, 4, and 5 were used, along with high-fidelity Taq polymerase (Nanjing Novizan Biotechnology Co., Ltd., Phanta Max Super-Fidelity DNA Polymerase, catalog number P507) for pre-amplification of the target regions. The total reaction volume was 50 μL, with 10 μL of bid-cfDNA template. The PCR program was: 95℃ for 2 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 15 s, 15 cycles; 72℃ for 5 min, 25℃ for 1 min, with other steps performed according to the manufacturer's instructions.

[0036] Finally, a multiplex qPCR fluorescent probe assay was performed using a multiplex PCR mix (Nanjing Novizan Biotechnology Co., Ltd., Taq HS DNA polymerase, catalog number P132). Combinations 1, 2, 3, and 4 each had three channels (FAM+ROX+Cy5), while combination 5 had four channels (FAM+VIC+ROX+Cy5). The volume was 25 μL, with 5 μL of pre-amplified product added as template. The PCR program was: 95℃ for 2 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 15 s, 40 cycles; 25℃ for 1 min. All other steps were performed according to the manufacturer's instructions.

[0037] Result interpretation: A Ct value ≤ 30 for the amplification curve of any one biomarker in combination 1, combination 2, combination 3, combination 4, or combination 5 is considered positive; a value > 30 is considered negative. The positive / negative interpretation of a sample is based on any two biomarkers being positive, and a single biomarker being positive or all biomarkers being negative. The final results are shown in Tables 15 to 17: Table 15 Results of Phase I-II Table 16 Results of Stages III-IV Table 17 Total Sensitivity The detection performance of five biomarker combinations (combination 1, combination 2, combination 3, combination 4, and combination 5) in plasma samples was tested. The results showed that: for 19 plasma samples of early epithelial ovarian cancer and 5 plasma samples of early non-epithelial ovarian cancer, combination 1 and combination 5 had the highest sensitivity for early-stage ovarian cancer, both at 91.67%; for 14 borderline ovarian tumors, combination 1 and combination 5 also had the highest sensitivity, both at 88.89%; for all epithelial ovarian cancers (119 cases), non-epithelial ovarian cancers (13 cases), and borderline ovarian tumors (14 cases), combination 4 and combination 5 had relatively higher overall sensitivity, at 95.33% (Table 15-17).

[0038] For benign ovarian diseases (220 cases in total), combinations 1 and 2 had relatively higher overall specificity, at 93.18% and 92.73%, respectively (Table 18); the four-channel fluorescent probe method, such as... Figure 2 .

[0039] Table 18 Overall specificity for benign ovarian diseases In summary, (1) High sensitivity and high specificity: The biomarker combination of this invention has a sensitivity of over 91.67% for early ovarian cancer (stage I / II), a sensitivity of 88.89% for borderline tumors, and a specificity of over 91.36% for benign ovarian diseases, which is significantly better than existing technologies. (2) Comprehensive coverage of multiple subtypes: It can simultaneously detect epithelial ovarian cancer, non-epithelial ovarian cancer (sex cord-stromal tumors, germ cell tumors) and borderline tumors, covering a wide range of diseases. (3) Applicable to liquid biopsy: It can be stably detected in plasma cfDNA, achieving non-invasive and early diagnosis. (4) Multiplex fluorescent PCR detection: It adopts a pre-amplification combined with multiplex qPCR probe method, which has high detection throughput, stable results, and simple operation.

[0040] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A combination of biomarkers for detecting multiple subtypes of ovarian cancer and borderline ovarian tumors, characterized in that, The biomarker combination includes at least three of the following differentially methylated regions: the differentially methylated region of IFFO1, the differentially methylated region of TFAP2E-AS1, the differentially methylated region of WNT6, and the differentially methylated region of AC104801.1; The differentially methylated region of IFFO1 is located at chr12:6555557-6555857 (hg38). The differentially methylated region of TFAP2E-AS1 is located at chr1:35577235-35577633 (hg38). The differentially methylated region of WNT6 is located at chr2:218871435-218871894 (hg38). The differentially methylated region of AC104801.1 is located at chr2:172108005-172108422 (hg38).

2. The biomarker combination for detecting multiple subtypes of ovarian cancer and borderline ovarian tumors according to claim 1, characterized in that, The combination of markers includes at least one of the following (a) to (e): (a) Differentially methylated regions of IFFO1, TFAP2E-AS1, and WNT6; (b) Differential methylation regions of IFFO1, TFAP2E-AS1, and AC104801.1; (c) Differential methylation regions of IFFO1, WNT6, and AC104801.1; (d) Differential methylation regions of TFAP2E-AS1, WNT6, and AC104801.1; (e) Differential methylation regions of IFFO1, TFAP2E-AS1, WNT6 and AC104801.

1.

3. A primer-probe combination, characterized in that, The primer-probe combination is used to detect the biomarker combination of claim 1 or 2.

4. The primer-probe combination according to claim 3, characterized in that, The nucleotide sequences of the primer-probe combination for detecting the differentially methylated regions of IFFO1 are shown in SEQ ID NO: 5-6, 13-15; The nucleotide sequences of the primer-probe combination for detecting the differentially methylated region of TFAP2E-AS1 are shown in SEQ ID NO:7-8, 16-18; The nucleotide sequences of the primer-probe combination for detecting the differentially methylated region of WNT6 are shown in SEQ ID NO: 9-10 and 19-21. The nucleotide sequences of the primer-probe combination for detecting the differentially methylated regions of AC104801.1 are shown in SEQ ID NO:11-12 and 22-24.

5. The application of a combination of biomarkers for detecting multiple subtypes of ovarian cancer and borderline ovarian tumors, characterized in that, The biomarkers described in any one of claims 1 to 2 are used in the preparation of products for the detection or prognostic assessment of multiple subtypes of ovarian cancer, or for the assessment of borderline ovarian tumors.

6. An application of a primer-probe combination, characterized in that, The primer-probe combination according to any one of claims 3 to 4 is used in the preparation of products for the detection or prognostic assessment of multiple subtypes of ovarian cancer, or borderline ovarian tumors.

7. The application of the primer-probe combination according to claim 6, characterized in that, The products include kits or reagents.

8. A reagent kit, characterized in that, The kit comprises the primer-probe combination as described in any one of claims 3 to 4.

9. The reagent kit according to claim 8, characterized in that, It also includes DNA extraction reagents and bisulfite conversion reagents.

10. A detection reagent, characterized in that, The detection reagent comprises the primer-probe combination as described in any one of claims 3 to 4.

Images