A method for screening different thousand grain weight of wheat and primer set used thereby

By designing primer sets and detecting the genotype of the AX-110125073 locus in the wheat genome, the problem of screening high-thousand-grain-weight wheat in existing technologies has been solved, achieving efficient screening and improved breeding efficiency.

CN115820909BActive Publication Date: 2026-04-14INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2022-10-28
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently screening and improving the thousand-grain weight of wheat, especially in early-generation selection, which makes it difficult to achieve significant breakthroughs and affects the yield improvement of wheat breeding.

Method used

A specific primer set was designed and used, including upstream primer F1, upstream primer F2 and downstream primer R, to identify the genotype of the AX-110125073 locus in the wheat genome through PCR amplification and fluorescence signal detection, and to screen for wheat varieties with high thousand-grain weight.

Benefits of technology

This method enables the efficient and accurate screening of wheat varieties with high thousand-grain weight, improving the efficiency and yield potential of wheat breeding and possessing significant breeding application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115820909B_ABST
    Figure CN115820909B_ABST
Patent Text Reader

Abstract

The application discloses a method for screening different thousand-grain-weight wheat and a primer set used by the method. The method comprises the following steps: detecting whether the genotype of AX-110125073 site of the wheat to be tested is AA homozygous type or GG homozygous type, and the thousand-grain-weight of the wheat with the genotype of AX-110125073 site being GG homozygous type is greater than the thousand-grain-weight of the wheat with the genotype of AX-110125073 site being AA homozygous type; the AX-110125073 site is the nucleotide at the 36th position from the 5' end of SEQ ID NO:1 in the wheat genome. Experiments prove that the wheat thousand-grain-weight trait can be screened by detecting the genotype of AX-110125073 site of the wheat to be tested. The application has important application value in wheat breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to a method for screening wheat of different thousand-grain weights and the primer set used therein. Background Technology

[0002] Wheat is a vital food crop globally, and its sustainable production directly impacts people's quality of life and national food security. Increasing yield per unit area is a perpetual goal of wheat breeding in my country and a crucial guarantee for national food security and economic development.

[0003] Yield is a quantitative trait controlled by multiple genes, with low heritability and significant environmental influences, making early selection difficult and hindering breakthroughs through conventional breeding methods. With the continuous development of molecular marker technology, linkage analysis, as an important tool for gene discovery, is increasingly being applied to the genetic research of yield traits, providing crucial evidence for revealing the genetic mechanisms of yield traits and molecular marker-assisted selection. Yield is composed of three factors: number of spikes per unit area, number of grains per spike, and thousand-grain weight. Among these, thousand-grain weight has high heritability and contributes significantly to yield; since the founding of the People's Republic of my country, the genetic progress in wheat yield in the Huang-Huai wheat region has mainly benefited from the improvement in thousand-grain weight. Therefore, further exploration of wheat yield, especially gene loci related to thousand-grain weight, and the targeted accumulation of superior alleles through molecular marker-assisted selection (MAS) can further improve yield.

[0004] In MAS breeding practices, a combination of phenotypic analysis, biochemical markers, and gene marker identification is commonly used. Single nucleotide polymorphism (SNP) markers are widely present in the genome, possessing advantages such as extremely high quantity, density, broad coverage, and high-throughput detection. With the rapid development of molecular biology techniques, SNP markers have been gradually applied to the construction of high-density genetic maps, quantitative trait gene localization, and germplasm genotyping, effectively accelerating the molecular breeding process. In recent years, the SNP genotyping detection scheme based on KASP (Kompetitive Allele-Specific PCR) technology developed by LGC Genomics has been successfully applied in crop MAS breeding research. Compared to the traditional Taqman method, universal fluorescent probes can replace site-specific fluorescent probes, effectively saving costs. KASP markers can be used efficiently and cost-effectively for the detection of specific markers in large-scale germplasm. Based on parental or natural populations, gene chips are used to detect SNP genotypes and discover target trait genetic loci. KASP markers are developed and tested in breeding materials, which can efficiently, accurately and cost-effectively carry out MAS breeding work for complex agronomic traits in wheat.

[0005] Jimai 22 is a high-yielding variety bred by the Crop Research Institute of the Shandong Academy of Agricultural Sciences. It was approved by the state for the Huang-Huai-Bei region in 2006, and its introduction and registration in Anhui and Henan provinces for the Huang-Huai-Nan region were completed in 2010 and 2011 respectively. Its cumulative planting area exceeds 21 million hectares, ranking first in the country for 12 consecutive years, with a current annual planting area of ​​approximately 1 million hectares. Zhongmai 578 is a strong-gluten, high-yielding new wheat variety jointly bred by the Institute of Crop Science and the Cotton Research Institute of the Chinese Academy of Agricultural Sciences. It was approved by the state for the Huang-Huai-Nan and Huang-Huai-Bei regions in 2020 and 2021 respectively, with a current annual planting area of ​​approximately 370,000 hectares. It has become a major promoted variety and an important backbone parent in the Huang-Huai wheat region. Summary of the Invention

[0006] The purpose of this invention is to determine the thousand-grain weight of wheat.

[0007] This invention first protects the primer set, which consists of upstream primer F1, upstream primer F2 and downstream primer R;

[0008] The upstream primer F1 consists of fluorescent tag sequence A and the DNA fragment shown in SEQ ID NO:2 from position 22 to 39 from the 5' end;

[0009] The upstream primer F2 consists of fluorescent tag sequence B and the DNA fragment shown in SEQ ID NO:3 from position 22 to 39 from the 5' end;

[0010] The nucleotide sequence of the downstream primer R is shown in SEQ ID NO:4.

[0011] In the primer set described above, the nucleotide sequence of fluorescent tag sequence A is shown as positions 1 to 21 from the 5' end of SEQ ID NO:2. The nucleotide sequence of fluorescent tag sequence B is shown as positions 1 to 21 from the 5' end of SEQ ID NO:3.

[0012] In the above text, the nucleotide sequence shown in SEQ ID NO:2 from position 1 to 21 starting from the 5' end is the FAM fluorescent tag sequence, and the fluorescence signal is specifically blue. The nucleotide sequence shown in SEQ ID NO:3 from position 1 to 21 starting from the 5' end is the HEX fluorescent tag sequence, and the fluorescence signal is specifically red.

[0013] This invention also protects the application of any of the primer sets described above, which may be any of the following b1)-b3):

[0014] b1) Determine the thousand-grain weight of the wheat to be tested;

[0015] b2) Screening for wheat varieties with high thousand-grain weight;

[0016] b3) Wheat breeding.

[0017] This invention also protects the application of the DNA fragment shown in SEQ ID NO:1, which may be any of the following b1)-b4):

[0018] b1) Determine the thousand-grain weight of the wheat to be tested;

[0019] b2) Screening for wheat varieties with high thousand-grain weight;

[0020] b3) Wheat breeding;

[0021] b4) as a molecular marker for identifying the thousand-grain weight of wheat to be tested.

[0022] b4) That is, the present invention also protects the molecular marker shown in SEQ ID NO:1.

[0023] This invention also protects a method for screening wheat of different thousand-grain weights, which may include the following steps: detecting the wheat to be tested based on... AX-110125073 Whether the genotype at the locus is homozygous AA or homozygous GG, based on AX-110125073 The thousand-grain weight of wheat with a genotype of GG homozygote at the locus is based on AX-110125073 The thousand-grain weight of wheat with the AA homozygous genotype at the locus;

[0024] AX-110125073 The site is the nucleotide at position 36 from the 5' end of SEQ ID NO:1 in the wheat genome.

[0025] In the above method, the detection of the wheat to be tested is based on AX-110125073 The steps to determine whether the genotype at a locus is homozygous AA or homozygous GG are as follows:

[0026] (a1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using any of the primer sets described above to obtain the PCR amplification product;

[0027] (a2) After completing step (a1), the fluorescence signal of the PCR amplification product is detected using an instrument. The color of the fluorescence signal is used to obtain the wheat sample based on the fluorescence signal. AX-110125073 Genotype at the locus.

[0028] In the above method, the detection of the wheat to be tested is based on AX-110125073 The steps to determine whether the genotype at a locus is homozygous AA or homozygous GG are as follows:

[0029] (b1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using any of the primer sets described above to obtain the PCR amplification product;

[0030] (b2) Take the PCR amplification product obtained in step (b1) and sequence it;

[0031] (b3) Based on the sequencing results obtained in step (b2), obtain the wheat sample to be tested. AX-110125073 Genotype at the locus.

[0032] This invention also protects a reagent kit for determining the thousand-grain weight of wheat, including the detection of the wheat grains being tested based on... AX- 110125073 The substance of the genotype at the locus;

[0033] AX-110125073 The site is the nucleotide at position 36 from the 5' end of SEQ ID NO:1 in the wheat genome.

[0034] The kit can specifically be based on the detection of wheat to be tested. AX-110125073 The material composition of the genotype at the locus.

[0035] In the above-mentioned reagent kit, the detection of the wheat to be tested is based on AX-110125073 The genotype material at the locus can be any of the primer sets described above.

[0036] The preparation method of the kit is also within the scope of protection of this invention. The preparation method of the kit includes the step of individually packaging each primer from any of the primer sets described above.

[0037] This invention also protects the application of any of the above-described reagent kits, which may be any of the following b1)-b3):

[0038] b1) Determine the thousand-grain weight of the wheat to be tested;

[0039] b2) Screening for wheat varieties with high thousand-grain weight;

[0040] b3) Wheat breeding.

[0041] In the above text, the term ">" specifically refers to the statistical definition of ">". The term "high thousand-grain weight" specifically refers to the statistical definition of "high thousand-grain weight".

[0042] Experiments have shown that the method provided in this invention is effective in detecting wheat based on... AX-110125073 Whether the genotype at the locus is homozygous AA or homozygous GG, based on AX-110125073 The thousand-grain weight of wheat with a genotype of GG homozygote at the locus is based on AX-110125073 The thousand-grain weight of wheat with the AA homozygous genotype at the locus; AX-110125073 The site is the nucleotide at position 36 from the 5' end of SEQ ID NO:1 in the wheat genome. Therefore, by detecting the wheat sample... AX- 110125073 The genotype at the locus can be used to screen for the thousand-grain weight trait in wheat. This invention has significant application value in marker-assisted breeding of wheat. Attached Figure Description

[0043] Figure 1 Genetic linkage map constructed from SNP markers in a 50K chip.

[0044] Figure 2 This is a partial detection result of the F5RIL population of 262 Zhongmai 578 / Jimai 22 in step five of Example 1.

[0045] Figure 3 The results are partial test results for 40 wheat varieties in Example 2. Detailed Implementation

[0046] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0047] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0048] Jimai 22 (described in the following literature: High-yielding, stable-yielding, disease-resistant, and widely adaptable new wheat variety - Jimai 22. Li Haosheng, Liu Jianjun, Song Jianmin, Liu Aifeng, Cheng Dungong, Zhao Zhendong. Journal of Triticeae Crops, 2007 (04): 744) is a wheat variety bred by the Crop Research Institute of Shandong Academy of Agricultural Sciences in 1994 through hybridization using its self-bred line 935024 as the female parent and 35106 as the male parent, and selected through pedigree selection. Jimai 22 has good comprehensive agronomic traits, high yield potential, good yield stability, and wide adaptability, and is a high-quality medium-gluten wheat variety.

[0049] Zhongmai 578 (described in the following literature: Planting performance and cultivation techniques of Zhongmai 578 in Zhumadian area. Wang Haifeng, Zhao Weiqin, Ran Wuling, Wu Changcheng, Wang Jiarun, Wang Zijun, Wang Fang, China Seed Industry. 2020(10): 99-101.) is a high-quality, strong-gluten, and high-yield wheat variety jointly developed by the Institute of Crop Science and the Cotton Research Institute of the Chinese Academy of Agricultural Sciences. It has the advantages of early maturity and good yellowing, high quality and strong gluten, high and stable yield, lodging resistance and wide adaptability, high and stable thousand-grain weight, and good grain marketability. It is a new generation variety for the production of high-quality strong-gluten wheat in Zhumadian area of ​​Henan Province.

[0050] The thousand-grain weight is the weight of 1,000 wheat seeds. It is an indicator of seed size and plumpness, an important aspect of seed quality assessment and crop evaluation, and a crucial basis for predicting yield in the field.

[0051] Example 1: Genes controlling thousand-grain weight AX-110125073 The discovery of the locus and the acquisition of the primer set for identifying the thousand-grain weight of wheat.

[0052] I. Field phenotypic data analysis and discovery of new thousand-grain weight QTL

[0053] 1. In the 2019-2020 crop year, the F5 RIL populations of Zhongmai 578, Jimai 22, and 262 F5 RIL populations of Zhongmai 578 / Jimai 22 were planted in Xinxiang, Henan (34°53′N, 113°23′E; E1). In the 2020-2021 crop year, the F5 RIL populations of Zhongmai 578, Jimai 22, and 262 F5 RIL populations of Zhongmai 578 / Jimai 22 were planted in Xinxiang (E2), Shangqiu (33°43′N, 114°49′E; E3), Luoyang (34°32′N, 112°16E; E4), and Gaoyi, Hebei (37°33′N, 114°26′E; E5), respectively, for a total of five environments. All environments adopted a completely randomized block design with three replicates, 1 m row length, 30 grains / row, and 20 cm row spacing. Other field management practices were carried out in accordance with local wheat field management standards. After the wheat matures, 30 ears are randomly selected and threshed manually; 1000 seeds are randomly selected and weighed, and the process is repeated three times. The average value is the weight of 1000 seeds.

[0054] 2. After completing step 1, use the internationally recognized SAS statistical software PROC CORR model to calculate the Pearson correlation coefficient of the thousand-grain weight and the PROC MIXED command to perform analysis of variance.

[0055] Analysis of variance showed that there were significant differences in thousand-grain weight among different genes at the 0.01 level, and the correlation coefficients of the five environments ranged from 0.71 to 0.87, indicating good correlation, relatively accurate data, and high consistency.

[0056] 3. Construction of genetic linkage maps

[0057] Genotyping of the F5RIL populations of Zhongmai 578, Jimai 22, and 262 Zhongmai 578 / Jimai 22 was performed using the wheat 50K microarray (Boao). The wheat 50K microarray contains 55,224 SNP markers, evenly distributed across 21 chromosomes. Before constructing the genetic linkage map, markers without parental polymorphism were removed, as were markers with a deletion rate greater than 20% and a minimum allele frequency less than 0.3. The remaining 9,354 high-quality polymorphic markers were then analyzed. Redundant markers were removed using the BIN function of Icimapping 4.2, leaving 1,501 markers. Linkage analysis was performed using JoinMap 4.0 software, and the genetic linkage map was constructed using MapChart 2.32.

[0058] The genetic linkage map constructed from SNP markers in the 50K chip is shown below. Figure 1 .

[0059] 4. QTL positioning

[0060] QTL analysis was performed using the Complete Interval Plotting (ICIM) method in IciMapping 4.2 software. The plotting parameters were set to a scan step size of 0.1 cM, a stepwise regression probability of the marker entering the interval (PIN) of 0.001, and 1000 permutation tests. P Calculate the Logarithm of the odds (LOD) critical value (<0.05). Interpret QTLs with a phenotypic variation rate greater than 10% as major-effect QTLs, and those repeatedly localized in three or more environments as stable QTLs. Name the QTLs according to international genetic nomenclature.

[0061] Ultimately, a thousand-grain weight QTL that is stable under five environmental conditions and the expected mean was identified. QTkw.caas-7D ; QTkw.caas-7D For the new thousand-grain weight QTL.

[0062] two, AX-110125073 Site discovery

[0063] The inventors of this invention conducted extensive sequence analysis, alignment, and preliminary experiments, and discovered... QTkw.caas-7D Upstream AX-110125073 SNP loci are not only physically close together, but also have many differential loci among the three homologous chromosomes. AX-110125073 SNP sites are abbreviated as SNP sites AX-110125073 Site.

[0064] AX-110125073 The locus is the 36th nucleotide from the 5' end of SEQ ID NO:1 in the wheat genome, and the genotypes are AA homozygous, GG homozygous, and AG heterozygous. SEQ ID NO:1: TCTCTTTCCTGTCATCTCCCCTTAATCAAATCGTGCRCACACCTTCTTCGCCCCCACACGCAGCGCAGGCAC (R represents A / G).

[0065] Since genomic DNA is a double-stranded DNA molecule composed of two single-stranded DNA molecules that are antisense complementary to each other, the DNA molecule that encodes proteins is generally named the sense DNA molecule, and the DNA molecule that is antisense complementary to the sense DNA molecule is named the antisense DNA molecule. AX-110125073 The genotypes at all loci are positive DNA genotypes.

[0066] III. Obtaining the primer set for determining the thousand-grain weight of wheat

[0067] according to AX-110125073 Based on the nucleotide sequences preceding and following the locus, a primer set suitable for identifying the thousand-grain weight of wheat using allele-competitive specific PCR was designed and synthesized. The primer set consists of three primer sequences: upstream primer F1, upstream primer F2, and downstream primer R, used to amplify the following: AX-110125073 The target sequence of the site. The nucleotide sequences of each primer are shown in Table 1.

[0068] Table 1

[0069]

[0070] Note: A single underscore indicates a FAM fluorescent tag sequence, and a double underscore indicates a HEX fluorescent tag sequence.

[0071] IV. Wheat based AX-110125073 Establishment of a genotyping method for loci

[0072] 1. Obtaining genomic DNA from the wheat sample

[0073] Genomic DNA was extracted from the wheat samples using the CTAB method.

[0074] The quality and concentration of the wheat genomic DNA to be tested must meet the requirements of PCR. The standards are as follows: agarose gel electrophoresis shows a single DNA band without obvious diffusion; the A260 / A280 ratio detected by a Nanodrop 2100 (Thermo) spectrophotometer is between 1.8 and 2.0 (the DNA sample is free of protein contamination), the A260 / A230 ratio is between 1.8 and 2.0 (the DNA sample has a low salt ion concentration), and there is no obvious light absorption at 270 nm (the DNA sample is free of phenol contamination); the concentration of the wheat genomic DNA to be tested is 50-200 ng / μL.

[0075] 2. Competitive allele-specific PCR

[0076] (1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the primer set synthesized in step three to obtain the PCR amplification product.

[0077] The reaction program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 61℃-55℃ (using the touch down program, decreasing by 0.6℃ per cycle) for 1 min, amplification for 10 cycles; 94℃ denaturation for 20 s, 55℃ for 1 min, and continued amplification for 26 cycles.

[0078] 3. After completing step 2, wait for the PCR amplification product temperature to drop below 40℃, then read the fluorescence values ​​using a microplate reader with FAM and HEX beam scanning (for FAM fluorescent tag sequences, observe the values ​​at excitation wavelength of 485nm and emission wavelength of 520nm; for HEX fluorescent tag sequences, observe the values ​​at excitation wavelength of 528nm and emission wavelength of 560nm). The color of the fluorescence signal indicates the type of wheat being tested. AX-110125073 Genotype of the locus. The specific judgment principle is as follows: if the wheat to be tested is based on AX-110125073 If the site displays a blue fluorescent signal, then the wheat being tested is based on... AX-110125073 The genotype at the locus is homozygous AA; if the wheat to be tested is based on AX-110125073 If the site displays a red fluorescent signal, then the wheat being tested is based on... AX-110125073 The genotype at the locus is GG homozygous; if the wheat to be tested is based on AX-110125073 If the site displays a green fluorescent signal, then the wheat being tested is based on... AX-110125073 The genotype at the locus is AG heterozygous.

[0079] It should be noted that if the fluorescence signal is weak after PCR amplification, affecting data analysis, additional cycles can be added (94℃ denaturation for 20s, 55℃ annealing and extension for 1min, 5 cycles) until the results are satisfactory.

[0080] V. Using the method in step four, the F5RIL populations of Zhongmai 578, Jimai 22, and 262 Zhongmai 578 / Jimai 22 were detected. AX-110125073 Genotype of the locus

[0081] Following the method in step four, the wheat samples to be tested were replaced with Zhongmai 578, Jimai 22, and 262 F5RIL populations of Zhongmai 578 / Jimai 22, respectively, while keeping all other steps unchanged. This yielded the F5RIL populations of Zhongmai 578, Jimai 22, and 262 F5RIL populations of Zhongmai 578 / Jimai 22. AX-110125073 Genotype at the locus. Some test results are shown below. Figure 2 (NTC stands for blank control, i.e., no template).

[0082] The genotyping results were compared with those from the F5RIL populations of Zhongmai 578, Jimai 22, and 262 Zhongmai 578 / Jimai 22 in the wheat 50K chip. The results indicate that the method described in step four for detecting wheat genotypes based on... AX-110125073 The genotypes at the locus were completely consistent with the genotyping results in the wheat 50K microarray. Therefore, the method provided in step four for detecting wheat genotypes based on... AX-110125073 The genotype at the locus has high accuracy.

[0083] Example 2: Correlation analysis and verification of the primer set synthesized in Example 1 for identifying the thousand-grain weight of wheat and the thousand-grain weight of wheat.

[0084] The wheat varieties tested were 40 (as shown in column 1 of Table 2). All 40 wheat varieties shown in column 1 of Table 2 are common varieties.

[0085] Table 2. Statistical results of genotypes and thousand-grain weight (g) of 40 wheat varieties

[0086]

[0087] 1. Testing of 40 wheat varieties based on AX-110125073 Genotype of the locus

[0088] Following the method in step four of Example 1, the wheat to be tested was replaced with 40 different wheat varieties, while all other steps remained unchanged, resulting in 40 wheat varieties based on... AX-110125073 Genotype at the locus. Some test results are shown below. Figure 3 .

[0089] The test results are shown in column 2 of Table 2.

[0090] 2. Thousand-grain weight trait test

[0091] Forty wheat varieties were planted in Anyang, Henan Province, in the 2012-2013, 2013-2014, and 2014-2015 seasons. A completely randomized block design with three replicates was used, with single-row plots, row length 1.5 m, row width 0.2 m, and 50 grains / row. Field management practices followed local wheat field management standards. After wheat maturity, 30 ears were randomly selected and threshed manually. 1000 seeds were randomly selected and weighed. The results were repeated three times, and the average weight was calculated as the thousand-grain weight.

[0092] The statistical results of the thousand-grain weight of each wheat variety in each year are shown in columns 3-5 of Table 2.

[0093] Calculate the average thousand-grain weight for each wheat variety over three years, i.e., the thousand-grain weight for each wheat variety. The statistical results of the thousand-grain weight for each wheat variety are shown in column 6 of Table 2.

[0094] 3. Correlation Analysis

[0095] The average thousand-grain weight of wheat for the two genotypes was calculated separately, and the PROCTTEST model of the internationally recognized SAS 9.2 statistical software was used for analysis. t Test results. Statistical results are shown in Table 3.

[0096] The results showed that in a population of 40 wheat varieties, the thousand-grain weight of the GG homozygous wheat varieties was greater than that of the AA homozygous wheat varieties; the ">" signifies statistical significance (i.e., significantly higher at the 0.05 level). Therefore, the GG homozygous type is a superior genotype for increasing the thousand-grain weight of wheat.

[0097] Table 3

[0098]

[0099] Note: * indicates P <0.05.

[0100] The above results indicate that by detecting the wheat under test based on AX-110125073 The genotype of a locus can be used to screen for the thousand-grain weight trait in wheat, and it has important application value in the process of molecular marker-assisted breeding of wheat.

[0101] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Primer set, consisting of upstream primer F1, upstream primer F2, and downstream primer R; The upstream primer F1 consists of a fluorescent tag sequence and the DNA fragment shown in SEQ ID NO:2 from position 22 to 39 from the 5' end; The upstream primer F2 consists of a fluorescent tag sequence and the DNA fragment shown in SEQ ID NO:3 from position 22 to 39 from the 5' end; The fluorescent tag sequence in upstream primer F1 and the fluorescent tag sequence in upstream primer F2 are two different fluorescent tag sequences, emitting different fluorescent signals; The nucleotide sequence of the downstream primer R is shown in SEQ ID NO:

4.

2. The primer set according to claim 1, characterized in that: The nucleotide sequence of the fluorescent tag sequence in the upstream primer F1 is shown as positions 1 to 21 from the 5' end of SEQ ID NO:2; The nucleotide sequence of the fluorescent tag sequence in the upstream primer F2 is shown as positions 1 to 21 from the 5' end of SEQ ID NO:

3.

3. The application of the primer set according to claim 1 or 2 is any one of the following b1)-b3): b1) Determine the thousand-grain weight of the wheat to be tested; b2) Screening for wheat varieties with high thousand-grain weight; b3) Wheat thousand-grain weight breeding; The application is achieved by obtaining the genotype of the wheat based on AX-110125073 the locus by PCR amplification using the primer set of claim 1 or 2; AX-110125073 The locus is the nucleotide at position 36 from the 5' end of SEQ ID NO: 1 in the wheat genome. based on AX-110125073 The thousand-grain weight of wheat with a genotype of GG homozygote at the locus is based on AX-110125073 The thousand-grain weight of wheat with the AA homozygous genotype at the locus.

4. A method for screening wheat of different thousand-grain weights, comprising the following steps: detecting the wheat to be tested based on... AX-110125073 Whether the genotype at the locus is homozygous AA or homozygous GG, based on AX-110125073 The thousand-grain weight of wheat with a genotype of GG homozygote at the locus is based on AX-110125073 The thousand-grain weight of wheat with the AA homozygous genotype at the locus; AX-110125073 The site is the nucleotide at position 36 from the 5' end of SEQ ID NO:1 in the wheat genome.

5. The method according to claim 4, characterized in that: The detection of wheat is based on AX-110125073 The steps to determine whether the genotype at a locus is homozygous AA or homozygous GG are as follows: (a1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the primer set described in claim 1 or 2 to obtain the PCR amplification product; (a2) After completing step (a1), the fluorescence signal of the PCR amplification product is detected using an instrument. The color of the fluorescence signal is used to obtain the wheat sample based on the fluorescence signal. AX-110125073 Genotype at the locus.

6. The method according to claim 4, characterized in that: The detection of wheat is based on AX-110125073 The steps to determine whether the genotype at a locus is homozygous AA or homozygous GG are as follows: (b1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the primer set described in claim 1 or 2 to obtain the PCR amplification product; (b2) Take the PCR amplification product obtained in step (b1) and sequence it; (b3) Based on the sequencing results obtained in step (b2), obtain the wheat sample to be tested. AX-110125073 Genotype at the locus.

7. A reagent kit comprising methods for detecting wheat-based... AX-110125073 The substance of the genotype at the locus; AX-110125073 The site is the nucleotide at position 36 from the 5' end of SEQ ID NO:1 in the wheat genome; The detection of wheat is based on AX-110125073 The genotype material at the locus is the primer set described in claim 1 or 2.

8. The application of the kit according to claim 7 is any one of the following b1)-b3): b1) Determine the thousand-grain weight of the wheat to be tested; b2) Screening for wheat varieties with high thousand-grain weight; b3) Wheat thousand-grain weight breeding; The application involves PCR amplification using the primer set described in claim 1 or 2 of the kit to obtain the wheat sample to be tested. AX-110125073 This is achieved through the genotype at the locus; AX-110125073 The site is the nucleotide at position 36 from the 5' end of SEQ ID NO:1 in the wheat genome; based on AX-110125073 The thousand-grain weight of wheat with a genotype of GG homozygote at the locus is based on AX-110125073 The thousand-grain weight of wheat with the AA homozygous genotype at the locus.

Citation Information

Patent Citations

  • Auxiliary method for screening wheat of different 1000-grain weights and special marker thereof

    CN101775439A

  • Method for assisting in identifying wheat grain weight characteristic and special primer group thereof

    CN108977441A