A nucleic acid detection primer group for rapid detection of blakeslea trispora based on loop-mediated isothermal amplification and a fluorescence detection method thereof

Abstract

The present application relates to the technical field of fungal nucleic acid detection, and particularly relates to a nucleic acid detection primer group for rapid detection of Brettanomyces based on loop-mediated isothermal amplification and a fluorescence detection method thereof, comprising two groups of primers P1 and P2, wherein the two groups of primers P1 and P2 are both designed based on a SNP site at a position of 5582 bp on a 2 mu plasmid of Brettanomyces. The present application selects a mutation at the position of 5582 bp, and then designs a specific nucleic acid detection primer group based on the mutation site for detection, so that the Brettanomyces can be rapidly, accurately and specifically detected, the sensitivity is high, and the quality detection demand of the Brettanomyces preparation can be met.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of fungal nucleic acid detection, and particularly relates to a nucleic acid detection primer set for rapid detection of Saccharomyces boulardii based on loop-mediated isothermal amplification and a fluorescence detection method thereof. BACKGROUND

[0002] Loop-mediated isothermal amplification (LAMP) is a novel isothermal nucleic acid amplification method, which mainly utilizes specific primers to recognize specific regions of target genes and utilizes an isothermal polymerase with strand displacement activity to rapidly amplify nucleic acids under constant temperature conditions (about 65℃), thereby ensuring high specificity and high efficiency of amplification.

[0003] Saccharomyces boulardii is a non-pathogenic yeast isolated from fruit in Indonesia by French microbiologist Henri Boulard in 1920. As an adjuvant for treating diarrhea and preventing antibiotic-related complications, the freeze-dried preparation of Saccharomyces boulardii has been widely used.

[0004] Saccharomyces boulardii presents smooth, raised, and off-white round colonies on YPD medium after being cultured at 37℃ for 48h. The cell body is oval-shaped and has typical budding characteristics. Saccharomyces boulardii has certain acid and heat resistance, can grow normally at 37℃, and has a survival rate significantly higher than that of ordinary yeast in a gastric acid environment. Mitterdorfer G et al. proved that Saccharomyces boulardii is a non-spore-forming Saccharomyces cerevisiae. In addition, Saccharomyces boulardii cannot utilize lactose and most organic acids, but can degrade galactose and lactic acid.

[0005] Clinical trials have proved that Saccharomyces boulardii has therapeutic effects on several types of diarrhea and enteritis, especially diarrhea associated with excessive growth of Clostridium difficile. In addition, Saccharomyces boulardii also shows preventive effects on traveler's diarrhea, antagonistic effects on Candida, and immune stimulating effects. Saccharomyces boulardii preparations are also used for the adjuvant treatment of Vibrio cholerae, rotavirus, traveler's diarrhea, and Helicobacter pylori.

[0006] There are many controversies in the biological classification of Saccharomyces boulardii. In 1967, Mc Murrough I et al. found that the biological characteristics of Saccharomyces boulardii and Saccharomyces cerevisiae were not completely the same, and determined that it was a new species of Saccharomyces. McCullough et al. proposed that Saccharomyces boulardii was a subspecies of Saccharomyces cerevisiae. At present, the identification and typing of Saccharomyces boulardii still have many difficulties. The traditional experimental scheme of phenotypic identification needs a long time, and the identification at the molecular level has certain difficulty due to the classification controversy and similar genome of Saccharomyces boulardii and Saccharomyces cerevisiae. By selecting suitable gene sequences, Saccharomyces cerevisiae and Saccharomyces boulardii can be identified and analyzed for their genetic relationship. The nucleotide difference in the variable D1 / D2 domain of 26S rDNA can identify all currently recognized ascomycetes, while the gene region of the spacer transcription region (ITS) and 5.8S ribosomal subunit (ITS1-5.8S-ITS2) shows high interspecific difference and low intraspecific polymorphism, which can be used to distinguish the species of Saccharomyces cerevisiae. In recent years, by using methods such as multiplex PCR, MLST or gene sequencing, Saccharomyces boulardii and Saccharomyces cerevisiae can be distinguished, but for the quality inspection of probiotic preparations such as Saccharomyces boulardii powder, the above methods are technically feasible but need a long time and more data analysis, and often cannot meet the needs of timely identification of a large number of finished products.

[0007] Therefore, in view of the current quality detection needs of Saccharomyces boulardii preparations, a rapid and accurate Saccharomyces boulardii identification method needs to be established. SUMMARY

[0008] The technical problem to be solved by the present application is to provide a rapid and accurate Saccharomyces boulardii identification method.

[0009] To solve the above technical problems, the purpose of the present application is achieved by the following technical scheme: a nucleic acid detection primer set for rapid detection of Saccharomyces boulardii based on loop-mediated isothermal amplification is provided, which includes P1 and P2 two groups of primers, the P1 and P2 two groups of primers are designed based on the 5582bp stable SNP site on the 2μm plasmid of Saccharomyces boulardii, and the SNP site is fixed on the inner primer.

[0010] Preferably, the P1 primer set (SNP site is fixed on the 5' end of the inner primer) is as follows:

[0011] asF3-1: TTCAGTCCTTCCTTCCAAC;

[0012] asB3-1: ACAGTTATTAGTCCCACCAG;

[0013] asFIP-1: CATTCATCCCGGAATCTCTAAAGGATTCACTCTTTTTTTGCTGTAAACG;

[0014] asBIP-1-OL: GAATCACCTATTAAAGCAGCTTGAC-AAGATGTTATGAAGCTCGTAAG;

[0015] asLF-1:GTTTCAATGAACTGGCGGCAGA;

[0016] asLB-1: AGTAAGCAATTGGGTAACGACG.

[0017] Preferably, the P2 (SNP site fixed at the 3' end of the inner primer) primer set is as follows:

[0018] asF3-13:CTTCCTTCCAACTCACTCTT;

[0019] asB3-13:ACAGTTATTAGTCCCACCAG;

[0020] asFIP-13: CATTCATCCCGGAATCTCTAAAGGAT-TTTGCTGTAAACGATT CTCTG;

[0021] asBIP-13-OL: GAATCACCTATTAAAGCAGCTTGAC-AAGATGTTATGAAG CTCGTAAG;

[0022] asLF-13:TTCAATAGTTTCAATGAACTGGCGG;

[0023] asLB-13: TGGTGGAACTAAAGTAAGCAATTGG.

[0024] Preferably, the FIP and BIP primers in the p1 primer set are modified near the sites corresponding to the SNPs, and the specific base modifications are as follows:

[0025] FIP changed 1: CATTAATCCCGGAATCTCTAAAGGATTCACTCTTTTTTTGCTG TAAACG;

[0026] FIP change 3: CACTAATCCCGGAATCTCTAAAGGATTCACTCTTTTTTTGCTG TAAACG;

[0027] FIP change 5: CACTCATCCCGGAATCTCTAAAGGATTCACTCTTTTTTTGCTG TAAACG;

[0028] BIP change 1: GAATAACCTATTAAAGCAGCTTGACAAGATGTTATGAAGCTC GTAAG;

[0029] BIP change 3: GACTAACCTATTAAAGCAGCTTGACAAGATGTTATGAAGCTC GTAAG;

[0030] BIP change 5: GACTCACCTATTAAAGCAGCTTGACAAGATGTTATGAAGCTC GTAAG.

[0031] Based on the aforementioned primer sets P1, P2, and the modified P1 primer set, primer set P3 was obtained.

[0032] asF3-1: TTCAGTCCTTCCTTCCAAC;

[0033] asB3-1:ACAGTTATTAGTCCCACCAG;

[0034] FIP change 5: CACTCATCCCGGAATCTCTAAAGGATTCACTCTTTTTTTGCTG TAAACG;

[0035] BIP change 5: GACTCACCTATTAAAGCAGCTTGACAAGATGTTATGAAGCTC GTAAG;

[0036] asLF-1:GTTTCAATGAACTGGCGGCAGA;

[0037] asLB-1: AGTAAGCAATTGGGTAACGACG;

[0038] This invention also provides a rapid fluorescence detection method for *Saccharomyces boulardii* based on loop-mediated isothermal amplification, comprising the following steps:

[0039] S1. Create a reaction system and set up a positive control group and a negative control group;

[0040] S2, fluorescence amplification reaction at 65℃ for 60 min;

[0041] S3. Observe the amplification and perform data analysis based on the Ct value.

[0042] Preferably, the reaction system comprises a reaction premix A and a reaction premix B, the reaction premix A comprising a Bst DNA large fragment polymerase and a fluorescent dye.

[0043] Preferably, the reaction premix B comprises a B. D. nucleic acid detection primer group, a 10x reaction buffer, 1.6 mM dNTPs, 8 mM magnesium sulfate, 0.8 M betaine and DEPC water.

[0044] Preferably, in the B. D. nucleic acid detection primer group, the molar ratio of the outer primer, the inner primer and the loop primer is 1:4:2.

[0045] Preferably, the positive control group comprises a B. D. genomic DNA group and a S. C. genomic DNA group, and the negative control group is DEPC water.

[0046] The present application selects a mutation at 5582 bp of the 2 μm plasmid of B. D. and then designs a specific nucleic acid detection primer group based on the mutation site for detection, so that B. D. can be detected quickly, accurately and specifically, and the sensitivity is high. The As-LAMP fluorescent detection test method based on the specific nucleic acid detection primer group provided by the present application produces a Ct difference in amplification of B. D. and S. C., and the operation is simple. Under the condition of 65℃ isothermal, the B. D. can be accurately and quickly detected and screened within 60 min. The detection result of the As-LAMP fluorescent detection test method for detecting B. D. provided by the present application is simple and accurate, and the amplification curve can be observed by a fluorescence amplifier, the Ct range is fixed, and the detection result is determined.

[0047] In summary, the As-LAMP fluorescent detection method provided by the present application can distinguish B. D. and S. C. by comparing with the positive control Ct value, the detection result is intuitive and easy to determine, and the quality detection demand of B. D. preparation can be met. BRIEF DESCRIPTION OF DRAWINGS

[0048] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0049] Figure 1 The amplification results of the P3 primer group of B. D. and S. C. provided by the present application

[0050] Figure 2 The amplification test results of the As-LAMP method of the present application on the mixed DNA of B. D. and S. C. DETAILED DESCRIPTION

[0051] The technical solutions of the present application will be described clearly and completely below in combination with the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative efforts belong to the scope of protection of the present application.

[0052] It should be understood that the terms "comprising" and "including" as used in the specification and the appended claims indicate the presence of the described features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0053] It should also be understood that the terms used in the present application specification are only for the purpose of describing specific embodiments and are not intended to limit the present application. As used in the present application specification and the appended claims, the singular forms "a", "an" and "the" are intended to include the plural forms unless the context clearly indicates otherwise.

[0054] It should be further understood that the term "and / or" as used in the present application specification and the appended claims means any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0055] In addition, the terms "approximately", "substantially", and the like are intended to indicate that the relevant content is not required to be absolutely accurate, but can have some deviation. For example, "approximately equal" does not only mean absolute equality, since it is difficult to achieve absolute "equality" in actual production and operation processes, and there is generally some deviation. Therefore, in addition to absolute equality, "approximately equal" also includes the above-mentioned case where there is some deviation. By way of example, in other cases, unless otherwise specified, the terms "approximately", "substantially", and the like have similar meanings to the above.

[0056] Embodiment 1

[0057] The embodiments of the present application provide a design idea of fixing SNP sites at the ends (3' and 5' ends) of internal primers at the 5582bp site on the 2μm plasmid of the Saccharomyces boulardii, and design two groups of primers, which are different in that the loop primers containing mutation sites are different, including a pair of outer primers F3 and B3, a pair of loop primers LF and LB, and internal primers FIP and BIP fixed with SNP sites; the nucleotide sequences are as follows: nucleic acid detection primer group, including P1 and P2;

[0058] The P1 primer set (SNP site fixed at the 5' end of the inner primer) includes a pair of outer primers F3 and B3, a pair of inner primers FIP and BIP, and a loop primer LF1.

[0059] The nucleotide sequences of F3, B3, FIP, BIP and LF1 are as follows:

[0060] Table 1 P1 primer set and P2 primer set sequence list

[0061]

[0062] Example 2

[0063] The present embodiment provides a LAMP fluorescent detection method for detecting the difference in Ct value of the Pichia and Saccharomyces cerevisiae obtained by detecting the Pichia and Saccharomyces cerevisiae SNP mutation nucleic acid detection primer set. In order to further improve the discrimination of the primer for the SNP site, that is, according to the Ct value difference of P1 and P2, the most suitable Ct difference is selected, and the FIP and BIP primers in the primer set are modified in the vicinity of the SNP corresponding site to further expand the Ct difference. The present embodiment modifies the bases within the 5bp range of the FIP and BIP primers in the P1 primer set corresponding to the SNP site. As shown below, the FIP and BIP in the P1 primer set are modified by three types of base modification.

[0064] Table 2 FIP and BIP modification control table

[0065]

[0066] Table 3 FIP and BIP modification amplification Cq value control table

[0067]

[0068] Through the double selection of Ct value and time, the best primer set P3 is finally selected.

[0069] Table 4 P3 primer set sequence list

[0070]

[0071] Example 3

[0072] The present embodiment provides a LAMP fluorescent detection method for detecting the difference in Ct value of the Pichia and Saccharomyces cerevisiae obtained by detecting the Pichia and Saccharomyces cerevisiae SNP mutation nucleic acid detection primer set. In order to further improve the discrimination of the primer for the SNP site, that is, according to the Ct value difference of P1 and P2, the most suitable Ct difference is selected, and the FIP and BIP primers in the primer set are modified in the vicinity of the SNP corresponding site to further expand the Ct difference. The present embodiment modifies the bases within the 5bp range of the FIP and BIP primers in the P1 primer set corresponding to the SNP site. As shown below, the FIP and BIP in the P1 primer set are modified by three types of base modification.

[0073] S1, create a reaction system, and set up a positive control group and a negative control group;

[0074] S2, 65℃ fluorescent amplification reaction for 60min;

[0075] S3, observe amplification and analyze data according to Ct value.

[0076] Specifically, the reaction system comprises reaction premix A, reaction premix B, and two positive controls and one negative control are set. Specifically, the detection method of the embodiment is set as 25 μL reaction system, containing the following substances: 1 μL of DNA sample to be detected (pre-adjusted to 10 ng / ul), 3 μL of reaction premix A (Bst DNA large fragment polymerase 8U, SYTO 9 fluorescent dye 1 μL), 21 μL of reaction premix B (primer group 2.8 μL, dNTP 1.6 mM, betaine 0.8 mM, magnesium sulfate 8 mM, DEPC water to 21 μL); the positive control group is the Saccharomyces boulardii genomic DNA group and the Saccharomyces cerevisiae genomic DNA group, and the negative control group is DEPC water.

[0077] The primer group is the nucleic acid detection primer group P3 of Example 2. Among them, the molar ratio of the outer primer, the inner primer and the loop primer is 1:4:2.

[0078] Example 4

[0079] Whether the amplification curve is "S" type is observed by a fluorescence amplifier to determine the detection result. If the "S" type amplification curve is observed, the detection result is determined to be positive; if the Ct value is within 55Ct (within 28min), that is, the detection sample contains the Saccharomyces boulardii positive control; if the Ct value is after 28min, that is, the detection sample contains the Saccharomyces cerevisiae positive control; if the "S" type amplification curve is not observed, the detection result is determined to be negative, that is, the detection sample does not contain the Saccharomyces boulardii.

[0080] Specifically, after the reaction is completed, the amplification curve is observed by a fluorescence amplifier. The two groups of primers in Example 1 and Example 2 are shown in Table 1, Figure 1 , and the figure: F5-B5-Saccharomyces boulardii DNA, F5-B5-Saccharomyces cerevisiae DNA.

[0081] Table 5 amplification Ct values of different primer groups

[0082]

[0083] As shown in Table 1, Figure 1 , the experimental results show that the Saccharomyces boulardii and Saccharomyces cerevisiae are detected by adjusting the primers and the difference in Ct value.

[0084] Sample detection Ct value result analysis

[0085] The LAMP fluorescence detection method provided in Example 3 is used to compare and analyze the Ct values of the clinical samples and the positive controls. The primers in Example 1 and Example 2 are used for verification.

[0086] (a) Samples to be tested: The samples to be tested were amplified using mixed DNA (Bula sacchariformis and Saccharomyces cerevisiae) at different concentrations as templates. The concentrations of the mixed DNA were 10 ng / μL of Bula sacchariformis DNA, 10 ng / μL of Saccharomyces cerevisiae DNA, 10 ng / μL of mixed DNA (90% Saccharomyces cerevisiae and 10% Bula sacchariformis), 10 ng / μL of mixed DNA (99% Saccharomyces cerevisiae and 1% Bula sacchariformis), and 10 ng / μL of mixed DNA (99.9% Saccharomyces cerevisiae and 0.1% Bula sacchariformis).

[0087] (b) Reaction system and conditions (25 μL reaction system, same as in Example 3):

[0088] 3 μL of reaction premix A, 21 μL of reaction premix B, and 1 μL of the sample to be tested were added. The reaction system was reacted at 65℃ for 60 min.

[0089] (c) Judgment of test results:

[0090] Specifically, after the reaction is complete, observe the amplification curve using a fluorescence amplification instrument. For example... Figure 2 As shown, after amplification using the primer set in Example 2, *Saccharomyces boulardii* DNA at a concentration of 0.1% still exhibited faster amplification than pure *Saccharomyces cerevisiae* DNA at the same concentration. A Ct value below 55 indicates that the primer set can distinguish at least one in a thousand of the 5582-site mutations on the 2μm plasmids of yeast, thus identifying *Saccharomyces boulardii* and *Saccharomyces cerevisiae*.

[0091] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any person skilled in the art can easily conceive of various equivalent modifications or substitutions within the technical scope disclosed in the present invention, and these modifications or substitutions should all be covered within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A primer set for rapid zymosan and Saccharomyces cerevisiae nucleic acid detection based on loop-mediated isothermal amplification, characterized by, The primer set is as follows: asF3-1: TTCAGTCCTTCCTTCCAAC; asB3-1:ACAGTTATTAGTCCCACCAG; FIP change 5: CACTCATCCCGGAATCTCTAAAGGATTCACTCTTTTTTTGCTGTAAACG; BIP change 5: GACTCACCTATTAAAGCAGCTTGACAAGATGTTATGAAGCTCGTAAG; asLF-1:GTTTCAATGAACTGGCGGCAGA; asLB-1: AGTAAGCAATTGGGTAACGACG.

2. A loop-mediated isothermal amplification-based rapid zone fluorescent detection method for Saccharomyces and Saccharomyces cerevisiae, characterized by, Includes the following steps: S1. Create a reaction system, and set up a positive control group and a negative control group. The positive control group includes the Saccharomyces boulardii genomic DNA group and the Saccharomyces cerevisiae genomic DNA group. S2. Using the nucleic acid detection primer set described in claim 1, perform a fluorescence amplification reaction at 65 °C for 60 min; S3. Observe the amplification and perform data analysis based on the Ct value. 3.The loop-mediated isothermal amplification (LAMP) -based rapid detection method for Saccharomyces and Saccharomyces cerevisiae according to claim 2, characterized in that: The amplification reaction system includes reaction premix A and reaction premix B. Reaction premix A includes Bst DNA polymerase and fluorescent dye. Reaction premix B includes the nucleic acid detection primer set as described in claim 1, 10× reaction buffer, 1.6 mM dNTPs, 8 mM magnesium sulfate, 0.8 M betaine and DEPC water.

4. The method according to claim 3, wherein the method is based on loop-mediated isothermal amplification (LAMP) for rapid detection of Saccharomyces and Saccharomyces cerevisiae. In the nucleic acid detection primer set, the molar ratio of the outer primer, inner primer, and loop primer is 1:4:

2.

5. The method according to claim 4, wherein the method is based on loop-mediated isothermal amplification (LAMP) for rapid detection of Saccharomyces and Saccharomyces cerevisiae. The negative control group was DEPC water.

Images