Primer set for background screening of tobacco chromosome 1 for resistance to spotted wilt and its application

Abstract

The present invention belongs to the field of tobacco breeding and relates to a primer set for background screening of spotted wilt-resistant tobacco chromosome 1 and its application. A PCR primer combination for background screening of spotted wilt-resistant tobacco breeding is provided, comprising a first PCR primer set, a second PCR primer set, a third PCR primer set, a fourth PCR primer set, and / or a fifth PCR primer set; the first PCR primer set is composed of three primers shown in SEQ ID NOs: 1-3; the second PCR primer set is composed of three primers shown in SEQ ID NOs: 4-6; the third PCR primer set is composed of three primers shown in SEQ ID NOs: 7-9; the fourth PCR primer set is composed of three primers shown in SEQ ID NOs: 10-12; and the fifth PCR primer set is composed of three primers shown in SEQ ID NOs: 13-15; the spotted wilt-resistant tobacco is a hybrid and backcross offspring of a donor parent, Polalta tobacco, and a recipient parent, K326 tobacco. The primer combination of the present invention can be used for early generation screening of spotted wilt-resistant tobacco with a K326 background, greatly shortening the breeding cycle of K326 spotted wilt-resistant directed improvement and improving breeding efficiency.

Description

Technical Field

[0001] The present invention belongs to the field of tobacco breeding and relates to a primer set for identifying the genotypes of a donor parent, Polalta, and a backcross parent, K326, in the backcross breeding process of spotted wilt-resistant tobacco, in particular to a primer set for background screening of chromosome 1 of spotted wilt-resistant tobacco and an application thereof in the directional improvement of K326 tobacco for spotted wilt resistance or the breeding of spotted wilt-resistant tobacco varieties. Background Art

[0002] In crop production, some superior varieties excel in many important traits such as yield and agronomics. However, due to the poor performance of individual traits (such as disease resistance and insect resistance), it is often difficult to fully realize the potential of yield and quality, which restricts large-scale planting. Targeted variety improvement is to target the individual defective traits of existing main varieties or specialty varieties. Through backcross breeding, the superior target traits are introduced from the donor to the recurrent parent, while maintaining the other excellent traits of the recurrent parent. It is an effective and important breeding method for breeders to improve a single or a few undesirable traits of a variety. The genetic background and other traits of the varieties after targeted improvement are consistent with those of the original superior varieties, and they are an upgraded version of the original superior varieties.

[0003] In modern breeding, marker-assisted selection (MAS) has greatly accelerated the progress of targeted improvement breeding. In particular, marker-assisted backcross background selection utilizes molecular markers to select individual plants in backcross progeny that share the same genome as the recurrent parent, thereby reducing the number of backcross generations and achieving targeted improvement in a shorter timeframe. In theory, marker-assisted backcross breeding is the fastest and most optimal breeding approach for targeted improvement of single or multiple traits controlled by major genes. Compared to conventional backcross breeding for targeted improvement, marker-assisted backcross background selection allows improved varieties to enter the market earlier.

[0004] Tobacco spotted wilt disease (TSWD) is a serious disease caused by infection by the Orthotospoviruses. Tomato spotted wilt virus (TSWV) is a representative species of the Orthotospoviruses. N.alata is a wild tobacco in the Nicotiana genus that has good resistance to TSWV and is the only available source of resistance to tobacco spotted wilt to date. Gajos et al. used N.otophora as a bridge parent and successfully transferred the spotted wilt resistance gene locus (RTSW locus, where RTSW is R esistance to TSWV (abbreviation for "V"), a cultivar 'Polalta', a spotted wilt-resistant tobacco, was obtained by transferring wild tobacco (N. alata) to cultivated tobacco (N. tabacum L.). 'Polalta' is a European strain with dark air-cured tobacco ancestry, significantly different from the flue-cured tobacco strains that dominate the Chinese and international markets. Crossing Polalta with the dominant flue-cured tobacco variety K326 as the female parent yielded spotted wilt-resistant tobacco with agronomic traits comparable to those of the dominant flue-cured tobacco. However, differences in metabolites and chemical composition still exist between the resulting spotted wilt-resistant tobacco and the dominant flue-cured tobacco, posing the risk that its characteristics may not fully meet the requirements of the flue-cured tobacco industry. To mitigate this risk in dominant flue-cured tobacco varieties targeted for spotted wilt resistance, backcross breeding with spotted wilt-resistant tobacco is needed to improve spotted wilt resistance in dominant flue-cured tobacco varieties. Using molecular markers for backcross-assisted background selection can accelerate the process of targeted improvement of spotted wilt resistance in flue-cured tobacco.

[0005] Single nucleotide polymorphisms (SNPs) are widely distributed throughout the genome and are the most common form of genetic variation among plant individuals. Common SNPs include base substitutions, transversions, insertions, and deletions. While most SNPs distributed throughout the genome do not directly determine phenotype, their close linkage to phenotypic-determining loci makes them promising candidates for development as important molecular markers. SNPs have become one of the most ideal molecular markers for studying the inheritance of complex plant traits.

[0006] Competitive allele-specific PCR (KASP) genotypes single nucleotide polymorphisms (SNPs) by specifically matching primer terminal bases. The basic principle is that two primers with different terminal bases each carry a fluorescent linker sequence. Based on the different fluorescent signals carried by the amplified products, large numbers of samples can be rapidly tested and their genotypes accurately determined. Since its introduction, KASP technology has rapidly captured the market with its exceptional flexibility, accuracy, and cost-effectiveness, playing a vital role in assisted crop breeding.

[0007] Currently, there are no reports on the use of co-dominant KASP markers for background selection in backcross breeding of tobacco lines resistant to spotted wilt. The development of co-dominant, specific KASP molecular markers based on the foreground donor parent and the background backcross parent could enable rapid, accurate, low-cost, high-throughput, and automated detection of background reversion rates in individual backcross plants, accelerating the targeted improvement of spotted wilt resistance in major flue-cured tobacco varieties. Summary of the Invention

[0008] The technical problem to be solved by the present invention is to provide SNP markers, primer combinations and methods for background screening of tobacco chromosome 1 for resistance to spotted wilt, so as to promote the directional improvement of K326 tobacco resistance to spotted wilt.

[0009] To solve the above technical problems, the present invention provides a PCR primer combination for screening spotted wilt-resistant tobacco breeding backgrounds, comprising a first PCR primer set, a second PCR primer set, a third PCR primer set, a fourth PCR primer set and / or a fifth PCR primer set;

[0010] The first PCR primer set consists of three primers having nucleotide sequences as shown in SEQ ID NOs: 1-3; the second PCR primer set consists of three primers having nucleotide sequences as shown in SEQ ID NOs: 4-6; the third PCR primer set consists of three primers having nucleotide sequences as shown in SEQ ID NOs: 7-9; the fourth PCR primer set consists of three primers having nucleotide sequences as shown in SEQ ID NOs: 10-12; and the fifth PCR primer set consists of three primers having nucleotide sequences as shown in SEQ ID NOs: 13-15.

[0011] The spotted wilt-resistant tobacco is a hybrid and backcross offspring of the donor parent Polalta tobacco and the recipient parent K326 tobacco;

[0012] The first PCR primer set is used to amplify the SNP site at 46558954 bp on tobacco chromosome 1, at which the genotype of K326 tobacco is G and the genotype of Polalta tobacco is A;

[0013] The second PCR primer set is used to amplify the SNP site at 46722391 bp on tobacco chromosome 1, where the genotype of K326 tobacco is A and the genotype of Polalta tobacco is G;

[0014] The third PCR primer set is used to amplify the SNP site at 143104070 bp on tobacco chromosome 1, where the genotype of K326 tobacco is C and the genotype of Polalta tobacco is T;

[0015] The fourth PCR primer set is used to amplify the SNP site at 166603840 bp on tobacco chromosome 1, where the genotype of K326 tobacco is T and the genotype of Polalta tobacco is G;

[0016] The fifth PCR primer set is used to amplify the SNP site at 191420573 bp on tobacco chromosome 1, where the genotype of K326 tobacco is T and the genotype of Polalta tobacco is G;

[0017] The location of the SNP site on the chromosome was determined based on the whole genome sequence of K326 tobacco.

[0018] The present invention also provides a KASP primer combination for screening spotted wilt-resistant tobacco breeding backgrounds, comprising a first KASP primer set, a second KASP primer set, a third KASP primer set, a fourth KASP primer set and / or a fifth KASP primer set;

[0019] The first KASP primer set consists of three primers: F1-1, F1-2, and R1. F1-1 is composed of a first tag sequence and a nucleotide sequence shown in SEQ ID NO: 1 in series from its 5' end to its 3' end; F1-2 is composed of a second tag sequence and a nucleotide sequence shown in SEQ ID NO: 2 in series from its 5' end to its 3' end; and the nucleotide sequence of R1 is shown in SEQ ID NO: 3.

[0020] The second KASP primer set consists of three primers: F2-1, F2-2, and R2. F2-1 is composed of a first tag sequence and a nucleotide sequence shown in SEQ ID NO:4 in series from its 5' end to its 3' end. F2-2 is composed of a second tag sequence and a nucleotide sequence shown in SEQ ID NO:5 in series from its 5' end to its 3' end. The nucleotide sequence of R2 is shown in SEQ ID NO:6.

[0021] The third KASP primer set consists of three primers: F3-1, F3-2, and R3. F3-1 is composed of a first tag sequence and a nucleotide sequence shown in SEQ ID NO:7 in series from its 5' end to its 3' end. F3-2 is composed of a second tag sequence and a nucleotide sequence shown in SEQ ID NO:8 in series from its 5' end to its 3' end. The nucleotide sequence of R3 is shown in SEQ ID NO:9.

[0022] The fourth KASP primer set consists of three primers: F4-1, F4-2, and R4. F4-1 is composed of a first tag sequence and a nucleotide sequence shown in SEQ ID NO: 10 in series from its 5' end to its 3' end; F4-2 is composed of a second tag sequence and a nucleotide sequence shown in SEQ ID NO: 11 in series from its 5' end to its 3' end; and the nucleotide sequence of R4 is shown in SEQ ID NO: 12.

[0023] The fifth KASP primer set consists of three primers: F5-1, F5-2, and R5. F5-1 is composed of a first tag sequence and a nucleotide sequence shown in SEQ ID NO: 13 in series from its 5' end to its 3' end. F5-2 is composed of a second tag sequence and a nucleotide sequence shown in SEQ ID NO: 14 in series from its 5' end to its 3' end. The nucleotide sequence of R5 is shown in SEQ ID NO: 15.

[0024] The nucleotide sequences of the first tag sequence and the second tag sequence are different and are not homologous to the tobacco genome sequence;

[0025] The spotted wilt-resistant tobacco is a hybrid and backcross offspring of the donor parent Polalta tobacco and the recipient parent K326 tobacco;

[0026] The first KASP primer set is used to amplify the SNP site at 46558954 bp on tobacco chromosome 1, where the genotype of K326 tobacco is G and the genotype of Polalta tobacco is A;

[0027] The second KASP primer set is used to amplify the SNP site at 46722391 bp on tobacco chromosome 1, where the genotype of K326 tobacco is A and the genotype of Polalta tobacco is G;

[0028] The third KASP primer set is used to amplify the SNP site at 143104070 bp on tobacco chromosome 1, where the genotype of K326 tobacco is C and the genotype of Polalta tobacco is T;

[0029] The fourth KASP primer set is used to amplify the SNP site at 166603840 bp on tobacco chromosome 1, where the genotype of K326 tobacco is T and the genotype of Polalta tobacco is G;

[0030] The fifth KASP primer set is used to amplify the SNP site at 191420573 bp on tobacco chromosome 1, where the genotype of K326 tobacco is T and the genotype of Polalta tobacco is G;

[0031] The location of the SNP site on the chromosome was determined based on the whole genome sequence of K326 tobacco.

[0032] The present invention provides a kit comprising the above-mentioned PCR primer combination or the above-mentioned KASP primer combination.

[0033] In some embodiments of the present invention, the kit comprises the above-mentioned KASP primer combination and a PCR premix; the PCR premix comprises a first fluorescent probe, a first quenching probe, a second fluorescent probe, and a second quenching probe;

[0034] The nucleotide sequence of the first fluorescent probe is consistent with the nucleotide sequence of the first tag sequence in the KASP primer set, and its 5' end is connected to the first fluorescent group; the nucleotide sequence of the first quencher probe is reverse complementary to the nucleotide sequence of the first tag sequence, and its 3' end is connected to the quencher group;

[0035] The nucleotide sequence of the second fluorescent probe is consistent with the nucleotide sequence of the second tag sequence in the KASP primer set, and its 5' end is connected to the second fluorescent group; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second tag sequence, and its 3' end is connected to the quencher group.

[0036] In some embodiments of the present invention, the first tag sequence is GAAGGTGACCAAGTTCATGCT; the second tag sequence is GAAGGTCGGAGTCAACGGATT; the first fluorescent group is FAM, and the second fluorescent group is HEX.

[0037] The use of the above-mentioned PCR primer combination or the above-mentioned KASP primer combination or the above-mentioned kit in the breeding of tobacco resistant to spotted wilt also falls within the protection scope of the present invention.

[0038] The present invention provides a method for screening a tobacco breeding background resistant to spotted wilt, comprising the following steps:

[0039] a) extracting DNA from tobacco plants resistant to spotted wilt;

[0040] b) performing PCR amplification on the DNA of the spotted wilt-resistant tobacco using the PCR primer set;

[0041] c) detecting the amplification results, determining the genotype of the SNP site amplified by each PCR primer set in the tobacco plant resistant to spotted wilt, and screening the tobacco plant resistant to spotted wilt whose SNP site is a K326 tobacco genotype;

[0042] The spotted wilt-resistant tobacco is a hybrid and backcross offspring of a donor parent, Polalta tobacco, and a recipient parent, K326 tobacco.

[0043] The present invention also provides a method for screening a tobacco breeding background resistant to spotted wilt, comprising the following steps:

[0044] a) extracting DNA from tobacco plants resistant to spotted wilt;

[0045] b) adding the KASP primer set and PCR premix to the DNA of the spotted wilt-resistant tobacco to perform KASP amplification;

[0046] The PCR premix contains a first fluorescent probe, a first quenching probe, a second fluorescent probe and a second quenching probe;

[0047] The nucleotide sequence of the first fluorescent probe is consistent with the nucleotide sequence of the first tag sequence in the KASP primer set, and its 5' end is connected to the first fluorescent group; the nucleotide sequence of the first quencher probe is reverse complementary to the nucleotide sequence of the first tag sequence, and its 3' end is connected to the quencher group;

[0048] The nucleotide sequence of the second fluorescent probe is consistent with the nucleotide sequence of the second tag sequence in the KASP primer set, and the 5' end of the second fluorescent probe is connected to the second fluorescent group; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second tag sequence, and the 3' end of the second quencher probe is connected to the quencher group;

[0049] c) detecting the fluorescent signal to determine the genotype of the spotted wilt-resistant tobacco at the SNP site amplified by each KASP primer set, and screening spotted wilt-resistant tobacco having a K326 tobacco genotype at the SNP site;

[0050] The spotted wilt-resistant tobacco is a hybrid and backcross offspring of a donor parent, Polalta tobacco, and a recipient parent, K326 tobacco.

[0051] In some embodiments of the present invention, the first tag sequence is GAAGGTGACCAAGTTCATGCT; the second tag sequence is GAAGGTCGGAGTCAACGGATT; the first fluorescent group is FAM, and the second fluorescent group is HEX.

[0052] In some embodiments of the present invention, during the KASP amplification,

[0053] The PCR system includes: DNA template, KASP primer working solution and KASP-TF V4.0 2X Master Mix;

[0054] The PCR program was as follows: step 1, pre-denaturation at 95°C for 15 min; step 2, denaturation at 95°C for 20 s, 65-57°C (1°C decrease per cycle) for 60 s, for a total of 9 cycles; step 3, denaturation at 95°C for 20 s, annealing at 57°C for 1 min, for a total of 32 cycles.

[0055] Experiments have shown that using the KASP primer set developed by the present invention, PCR amplification is performed using the tobacco genomic DNA to be tested as a template, and then genotyping the PCR amplification products by fluorescence signal detection. Based on the typing results, tobacco plants with a chromosome 1 background of the backcross parent, K326 tobacco, can be quickly and accurately screened for resistance to spotted wilt. Screening using SNP markers distributed continuously on a chromosome can ensure that the entire chromosome contains only the backcross parent genotype. Compared with traditional marker screening, the SNP-KASP primer set developed by the present invention has the advantages of high accuracy, low cost, and high detection efficiency, making it suitable for large-scale screening of tobacco breeding for resistance to spotted wilt. The identification method using the SNP-KASP primer set of the present invention can be used to screen tobacco breeding backgrounds for resistance to spotted wilt in early generations, thereby greatly shortening the breeding cycle for targeted improvement of K326 tobacco for resistance to spotted wilt and improving breeding efficiency.

[0056] As used herein, the term "RTSW locus" or "spotted wilt resistance locus" refers to a DNA segment comprising the RTSW gene, which confers resistance to tobacco spotted wilt in either the heterozygous or homozygous state. The "RTSW gene" refers to a gene from the genome of Nicotiana alata that confers resistance to spotted wilt. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 The distribution of SNPs derived from the donor parent, Polalta, in the genome of spotted wilt-resistant tobacco (Single Plant No. 12). SNPs derived from the donor parent, Polalta, are shown in light colors, while those derived from the recurrent parent, K326, are shown in dark colors.

[0058] Figure 2 The following table shows the results of SNP genotyping using the five SNP-KASP primer sets of the present invention. For each primer set, the genotype for Parent 1 is obtained by amplification of two Polalta homozygous donor parents, the genotype for Parent 2 is obtained by amplification of two K326 homozygous recurrent parents, and the heterozygous genotype is obtained by amplification of three Polalta × K326 F1 hybrids. Negative genotypes are obtained by amplification of ultrapure water samples without DNA.

[0059] Figure 3The results of chromosome 1 background screening using the five SNP-KASP primer sets of the present invention on a segregating population of spotted wilt-resistant tobacco offspring were presented. For each primer set, the sample enclosed in the dashed circle in the upper left corner represents the Polalta homozygous donor parent genotype, the sample enclosed in the dashed circle in the lower right corner represents the K326 homozygous recurrent parent genotype, the sample enclosed in the dashed circle in the middle diagonal position represents the heterozygous genotype, and the sample enclosed in the dashed circle in the lower left corner represents the unamplified sample. A total of 384 samples were included, including 376 DNA samples from spotted wilt-resistant tobacco, 2 DNA samples from Polalta, 2 DNA samples from K326, 2 DNA samples from the Polalta×K326 F1 line, and 2 DNA-free ultrapure water samples (as a negative control). DETAILED DESCRIPTION

[0060] The present invention will be further described in detail below with reference to the embodiments. Obviously, the embodiments described are only a part of the embodiments of the present invention, rather than all the embodiments.

[0061] In the following examples, if the specific techniques or conditions are not specified, they were carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased.

[0062] The tobacco materials used in the following examples are:

[0063] Polalta is a TSWV-resistant tobacco material containing a spotted wilt resistance gene locus (RTSW locus) and has been described in non-patent literature (Laskowska D, A,2010.TSWV resistance in DH lines of tobacco(Nicotianatabacum L.)obtained from a hybrid between'Polalta'and The tobacco material is disclosed in Plant Breeding 129, 731-3. The public can obtain the tobacco material from tobacco germplasm resource conservation units.

[0064] K326, a major flue-cured tobacco variety, does not contain the spotted wilt resistance locus (RTSW locus). Its reference genome sequence is publicly available at https: / / solgenomics.net / organism / Nicotiana_tabacum / genome, and tobacco germplasm collections are available from tobacco germplasm collection institutions.

[0065] F1 plants obtained by hybridization with K326(♀) (K326×Polalta F1), K326×Polalta The segregating population (K326×Polalta BC7F1) obtained by backcrossing with K326(♀) for 7 generations, the spotted wilt-resistant tobacco (single plant No. 12, whose genotype is RTSW / rtsw) without linkage drag obtained from K326×PolaltaBC7F1, and the single plant No. 12 The segregating populations (K326×Polalta BC8F1) obtained by backcrossing with K326(♀) for one generation were all created by our research group and are preserved in the Yunnan Tobacco Agricultural Science Research Institute. Among them, the screening process of tobacco resistant to spotted wilt (single plant No. 12) can be found in the international patent application with application number PCT / CN2021 / 129382, invention name “Spotted wilt-resistant tobacco plants without linkage drag and breeding methods thereof”, and the Chinese patent application with application number 202111311707.0, invention name “Molecular markers for screening spotted wilt-resistant tobacco plants without linkage drag and their applications”. The entire contents of these two patent applications are hereby incorporated into this article by reference. The results of previous studies have shown that the agronomic traits of spotted wilt-resistant tobacco that breaks the linkage drag are not significantly different from those of K326, and can be used for spotted wilt-resistant tobacco breeding, officially entering the commercial breeding process.

[0066] The main reagents used in the following examples are:

[0067] KASP-TF V4.0 2X Master Mix (Cat. No. LGC-KBS-1050-132) was purchased from LGCBiosearch. The magnetic bead-based universal genomic DNA extraction kit (Cat. No. DP705) was purchased from Tiangen Biochemical Technology Co., Ltd.

[0068] Example 1. Acquisition of SNP markers for screening tobacco breeding backgrounds for resistance to spotted wilt

[0069] In order to To obtain spotted wilt-resistant tobacco from hybridization and backcrossing with K326(♀), with a chromosomal background as close to that of K326 as possible, except for the RTSW locus, it was necessary to develop SNP markers for screening spotted wilt-resistant tobacco breeding backgrounds. Therefore, we used the donor parent, Polalta, the recipient parent, K326, and previously obtained spotted wilt-resistant tobacco for marker development.

[0070] We performed whole-genome resequencing on Polalta, K326, and spotted wilt-resistant tobacco (single plant number 12). The sequencing platform was the BGISEQ-500, using the PE100 sequencing strategy. By filtering the raw data, aligning it with the cultivated tobacco reference genome, and detecting SNP variants, we filtered the SNPs from the two parents (K326 and Polalta). A total of 50,009 high-quality SNPs (GQ (quality score) >= 40) between the two parents were identified, distributed across all 24 chromosomes (Table 1).

[0071] Table 1 SNP distribution of the two parents and single plant No. 12

[0072]

[0073]

[0074] The results of the resequencing SNP analysis of single plant No. 12 showed that the vast majority of SNP sites were heterozygous, and the SNP genotype characteristics were consistent with the characteristics of backcrossing. After 7 generations of backcrossing, more than 97% of the sites in the genome were consistent with the backcross parent K326. In addition to the 106 SNP heterozygous sites containing the RTSW site on chromosome 12 (chr12), there were also 1257 SNP homozygous or heterozygous sites that were consistent with the donor parent Polalta. Markers need to be designed in the next segregation population for screening. The distribution of SNPs on chromosomes of single plant No. 12 is shown in Tables 2 and Figure 1 Table 2 shows only chromosomes with >10 SNPs.

[0075] Table 2 Distribution of SNPs on chromosomes of single strain No. 12

[0076] chromosome Number of SNPs Chromosome 1 (chr1) 732 Chromosome 7 (chr7) 61 Chromosome 8 (chr8) 14 Chromosome 12 (chr12) 106 Chromosome 13 (chr13) 33 Chromosome 18 (chr18) 62 Chromosome 19 (chr19) 45 Chromosome 20 (chr20) 178

[0077] From the resequencing results, we know that chromosome 1 (chr1) contains a longer donor-derived fragment ( Figure 1To screen for crossover plants from the segregating population and ultimately obtain plants containing only the recurrent parent K326 background in this region, we designed SNP-KASP primer sets targeting 35 SNPs across five chromosomal regions. Specifically, we designed six SNP-KASP primer sets around 47 Mb, ten SNP-KASP primer sets around 142 Mb, nine SNP-KASP primer sets around 167 Mb, and ten SNP-KASP primer sets around 190 Mb.

[0078] The 35 sets of SNP-KASP primers were screened using two homozygous parents (K326 and Polalta) and their hybridized F1 plants, with ultrapure water without DNA added as a negative control. The steps are as follows:

[0079] Preparation of KASP primer working solution: Take 12 μL (100 μM) of each upstream primer (first upstream primer, second upstream primer) and 30 μL (100 μM) of downstream primer, add sterile ultrapure water to 100 μL, mix thoroughly, and use as KASP primer working solution.

[0080] PCR system: 2 μL DNA template (about 30 ng / μL), 0.08 μL KASP primer working solution, 2.5 μL KASP-TF V4.0 2X Master Mix (LGC, product number LGC-KBS-1050-132), and add sterile ultrapure water to 5 μL.

[0081] PCR program: Step 1, pre-denaturation at 95°C for 15 min; Step 2, denaturation at 95°C for 20 s, 65-57°C (1°C decrease per cycle) for 60 s, for a total of 9 cycles; Step 3, denaturation at 95°C for 20 s, annealing at 57°C for 1 min, for a total of 32 cycles.

[0082] A blank control (NTC) without adding DNA template to the PCR system was also set up in the experiment, and one blank control was set up for each primer set.

[0083] The PCR results are as follows: After the reaction is completed, a fluorescence microplate reader (FLUOstar OPTIMA, BMG Labtech, Germany) is used to perform fluorescence amplification on the obtained amplified products, and the fluorescence signal data is read using SNPviewer software to determine the genotype. If the fluorescence signal data of the amplified product of the tobacco to be tested is blue near the X-axis after analysis by SNPviewer software, the genotype of the tobacco to be tested is the K326 parent type; if the fluorescence signal data of the amplified product of the tobacco to be tested is red near the Y-axis after analysis by SNPviewer software, the genotype of the tobacco to be tested is the Polalta parent type; if the fluorescence signal data of the amplified product of the tobacco to be tested is green near the diagonal after analysis by SNPviewer software, the genotype of the tobacco to be tested is heterozygous; the fluorescence signal data of the amplified product of the negative control is black near the origin after analysis by SNPviewer software.

[0084] The optimal combination of SNP typing results that were consistent with the genotype, had good typing effects, and was evenly distributed on the chromosome was screened. Finally, five SNP markers were determined for the background screening of tobacco chromosome 1 for spotted wilt resistance, two of which were located near 47Mb, and the remaining three were located near 142Mb, 167Mb, and 190Mb, respectively. The basic information of the KASP primer sets used to detect these five SNP markers is detailed in Table 3. The results of SNP genotyping using the five KASP primer sets are shown in Table 3. Figure 2 shown.

[0085] Table 3 SNP-KASP primer sets for chr1 chromosome background selection

[0086]

[0087]

[0088] The KASP primer combination used for chr1 chromosome background selection consists of five primer sets, designated SNP-KASP primer sets 1-5. Each primer set consists of three primers: a first upstream primer, a second upstream primer, and a downstream primer, and is used to amplify a single SNP site. The last base at the 3' end of the first upstream primer is the SNP genotype of K326, indicated by capital letters in parentheses within the primer name; the last base at the 3' end of the second upstream primer is the SNP genotype of Polalta, indicated by lowercase letters in parentheses within the primer name. In each primer set, the first upstream primer contains a FAM fluorescent tag sequence (GAAGGTGACCAAGTTCATGCT) (SEQ ID NO: 26) at its 5' end, and the second upstream primer contains a HEX fluorescent tag sequence (GAAGGTCGGAGTCAACGGATT) (SEQ ID NO: 27) at its 5' end. The fluorescent tag sequences in the primers are underlined in Table 3; sequences without underline are genome-specific sequences. The numbers in the primer names indicate the locations of the SNPs amplified by each primer set on chromosome 1. SNP-KASP primer set 1 amplifies the SNP at 46,558,954 bp on chromosome 1; SNP-KASP primer set 2 amplifies the SNP at 46,722,391 bp on chromosome 1; SNP-KASP primer set 3 amplifies the SNP at 143,104,070 bp on chromosome 1; SNP-KASP primer set 4 amplifies the SNP at 166,603,840 bp on chromosome 1; and SNP-KASP primer set 5 amplifies the SNP at 191,420,573 bp on chromosome 1. The chromosomal locations of these SNPs were determined based on the complete genome sequence of the tobacco variety K326. The complete genome sequence of K326 is available at https: / / solgenomics.net / organism / Nicotiana_tabacum / genome.

[0089] Example 2. Validation of SNP markers for screening tobacco breeding backgrounds for resistance to spotted wilt

[0090] The SNP markers obtained in Example 1 for background screening of tobacco chromosome 1 for resistance to spotted wilt disease were verified using the segregating population BC1F1 of single plant No. 12 obtained by backcrossing single plant No. 12 with K326 (ie, K326×PolaltaBC8F1).

[0091] The RTSW site is the target site for improved resistance to spotted wilt, so the offspring must first contain the RTSW site. Using the non-toxic gene infiltration identification method we established earlier, 800 individual plants from the K326×Polalta BC8F1 segregation population were identified for resistance to spotted wilt. The non-toxic gene infiltration identification method is a method for identifying tobacco resistance using the tomato spotted wilt virus NSm gene as described in a Chinese patent (patent number ZL201710414755.X, invention name "A method for identifying tobacco resistance using the tomato spotted wilt virus NSm gene"), and the entire content of the Chinese patent is hereby incorporated herein by reference. The specific steps are:

[0092] (1) Agrobacterium EHA105 containing the non-toxic gene NSm expression vector was cultured in LB medium at 28°C for 24 h. The cells were collected by centrifugation and diluted with infiltration buffer (10 mmol / L MgCl2, 10 mmol / L MES, 200 μmol / L acetosyringone) to an OD600 suspension of 0.5.

[0093] (2) Using a sterile syringe with the needle removed, inject 9.5-10.5 μl of the bacterial suspension from the back of the tobacco leaf into the interveinal space, forming a visible infiltration spot. Place the inoculated tobacco plant in an environment of 20-28°C and 80% humidity, alternating between 16 hours of continuous light and 8 hours of continuous darkness, and observe for a total of 72 hours.

[0094] (3) Observation: If the tobacco test host produces a hypersensitive reaction (HR) induced by the identified strain containing the avirulent gene NSm expression vector, it is confirmed that the tobacco test host is a disease-resistant variety relative to the avirulent gene NSm.

[0095] The results of NSm-mediated disease resistance identification showed that among the 800 plants in the K326×Polalta BC8F1 segregation population, 415 produced HR reactions and were TSWV-resistant plants (indicated by RTSW), 380 plants had no HR reactions and were TSWV-susceptible plants (indicated by rtsw), and the other 5 plants were not included in the statistics because they were too small to be suitable for HR detection.

[0096] We selected 376 of the 415 HR-positive plants and extracted total DNA from each plant using a universal genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., DP705) using a magnetic bead method. We used our previously developed spotted wilt resistance marker, NaChr3_59M (see International Patent Application No. PCT / CN2021 / 129382 and Chinese Patent Application No. 202111311707.0), to verify the NSm-mediated resistance identification results. The results showed that only three of the 376 plants had inconsistent results with the NSm-mediated resistance identification method, resulting in an accuracy rate of greater than 99.2%.

[0097] KASP detection was performed on the DNA of 376 HR-positive plants using the five SNP-KASP primer sets shown in Table 3 of Example 1. Two homozygous parents (K326 and Polalta) and the F1 generation plants obtained by hybridization were used as controls, and ultrapure water without DNA was used as a negative control. The KASP detection method was the same as in Example 1. The test results are shown in Tables 4 and Figure 3 shown.

[0098] Table 4 SNP genotyping results of tobacco resistant to spotted wilt

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108] In the table, numbers 1-376 represent DNA samples from 376 HR-positive plants. Numbers 377 and 378 represent DNA samples from Polalta, numbers 379 and 380 represent DNA samples from K326, numbers 381 and 382 represent DNA samples from a Polalta × K326 F1 hybrid, and numbers 383 and 384 represent ultrapure water without DNA added (negative control). A represents the homozygous Polalta genotype; B represents the homozygous K326 genotype; H represents the heterozygous genotype; N indicates negative; and "?" indicates that the sample was not amplified. Pos indicates positive, and Neg indicates negative.

[0109] The results showed that using all five SNP-KASP primer sets, 92 strains with homozygous genotypes and 129 strains with heterozygous genotypes were identified for the recurrent parent of K326 from 376 isolates in the segregating population. The results from SNP-KASP primer sets 1 and 2 were largely consistent, as were the results from SNP-KASP primer sets 3, 4, and 5. Some discrepancies in the results between SNP-KASP primer sets 1 and 2 and SNP-KASP primer sets 3, 4, and 5 were likely due to the large physical distance between the two segments, resulting in a high number of chromosomal exchanges and recombination events. This also highlights the need to design multiple detection sites for a single chromosome.

[0110] To verify the accuracy of SNP markers, we selected six strains (numbered 11, 17, 24, 30, 102, and 109) for resequencing. The sequencing platform used was the BGISEQ-500, using the PE100 sequencing strategy. By filtering the raw data, aligning it to the cultivated tobacco reference genome, and detecting SNP variants, the resequencing data were aligned to high-quality SNPs between the parents and filtered. The SNP counts on chr1 for the six strains were determined (Table 5).

[0111] Table 5 Resequencing results of 6 strains identified by SNP-KASP primer set

[0112] Number of SNPs on chr1 Single plant No. 12 732 Single plant 12BC1F1-11 12 Single plant 12BC1F1-17 12 Single plant 12BC1F1-24 14 Single plant 12BC1F1-30 12 Single plant 12BC1F1-102 4 Single plant 12BC1F1-109 12

[0113] The results showed that the six individuals screened had significantly fewer SNPs on chromosome chr1 that were identical to the donor parent, Polalta. The remaining SNPs could be due to sequencing errors or background noise inherent in genomic SNP analysis. Therefore, it can be confirmed that the entire chr1 chromosome of the backcross individuals screened using SNP-KASP primer sets 1-5 is completely identical to the recurrent parent, K326.

[0114] It can be seen that the SNP-KASP primer set developed by the present invention can effectively screen out tobacco resistant to spotted wilt with the chromosome 1 background of the backcross parent K326, has the advantages of reliability, simplicity and practicality, and has important application prospects in tobacco germplasm resource evaluation and breeding marker-assisted selection. At the same time, it provides a reference basis for breeding directed improved tobacco varieties with high resistance to spotted wilt.

[0115] The above embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A PCR primer combination for screening tobacco breeding backgrounds for resistance to spotted wilt, characterized in that: including a first PCR primer set, a second PCR primer set, a third PCR primer set, a fourth PCR primer set, and a fifth PCR primer set; The first PCR primer set consists of three primers having nucleotide sequences as shown in SEQ ID NOs: 1-3; the second PCR primer set consists of three primers having nucleotide sequences as shown in SEQ ID NOs: 4-6; the third PCR primer set consists of three primers having nucleotide sequences as shown in SEQ ID NOs: 7-9; the fourth PCR primer set consists of three primers having nucleotide sequences as shown in SEQ ID NOs: 10-12; and the fifth PCR primer set consists of three primers having nucleotide sequences as shown in SEQ ID NOs: 13-15. The spotted wilt-resistant tobacco is a hybrid and backcross offspring of the donor parent Polalta tobacco and the recipient parent K326 tobacco; The first PCR primer set is used to amplify the SNP site at 46558954 bp on tobacco chromosome 1, at which the genotype of K326 tobacco is G and the genotype of Polalta tobacco is A; The second PCR primer set is used to amplify the SNP site at 46722391 bp on tobacco chromosome 1, where the genotype of K326 tobacco is A and the genotype of Polalta tobacco is G; The third PCR primer set is used to amplify the SNP site at 143104070 bp on tobacco chromosome 1, where the genotype of K326 tobacco is C and the genotype of Polalta tobacco is T; The fourth PCR primer set is used to amplify the SNP site at 166603840 bp on tobacco chromosome 1, where the genotype of K326 tobacco is T and the genotype of Polalta tobacco is G; The fifth PCR primer set is used to amplify the SNP site at 191420573 bp on tobacco chromosome 1, where the genotype of K326 tobacco is T and the genotype of Polalta tobacco is G; The location of the SNP site on the chromosome was determined based on the whole genome sequence of K326 tobacco.

2. A KASP primer combination for screening tobacco breeding backgrounds for resistance to spotted wilt, characterized in that: including a first KASP primer set, a second KASP primer set, a third KASP primer set, a fourth KASP primer set, and a fifth KASP primer set; The first KASP primer set consists of three primers: F1-1, F1-2, and R1, wherein the nucleotide sequence of F1-1 is shown in SEQ ID NO: 16; the nucleotide sequence of F1-2 is shown in SEQ ID NO: 17; and the nucleotide sequence of R1 is shown in SEQ ID NO: 3; The second KASP primer set consists of three primers: F2-1, F2-2, and R2, wherein the nucleotide sequence of F2-1 is shown in SEQ ID NO: 18; the nucleotide sequence of F2-2 is shown in SEQ ID NO: 19; and the nucleotide sequence of R2 is shown in SEQ ID NO: 6; The third KASP primer set consists of three primers: F3-1, F3-2, and R3, wherein the nucleotide sequence of F3-1 is shown in SEQ ID NO: 20; the nucleotide sequence of F3-2 is shown in SEQ ID NO: 21; and the nucleotide sequence of R3 is shown in SEQ ID NO: 9; The fourth KASP primer set consists of three primers: F4-1, F4-2, and R4, wherein the nucleotide sequence of F4-1 is shown in SEQ ID NO: 22; the nucleotide sequence of F4-2 is shown in SEQ ID NO: 23; and the nucleotide sequence of R4 is shown in SEQ ID NO:

12. The fifth KASP primer set consists of three primers: F5-1, F5-2, and R5, wherein the nucleotide sequence of F5-1 is shown in SEQ ID NO: 24; the nucleotide sequence of F5-2 is shown in SEQ ID NO: 25; and the nucleotide sequence of R5 is shown in SEQ ID NO:

15. The spotted wilt-resistant tobacco is a hybrid and backcross offspring of the donor parent Polalta tobacco and the recipient parent K326 tobacco; The first KASP primer set is used to amplify the SNP site at 46558954 bp on tobacco chromosome 1, where the genotype of K326 tobacco is G and the genotype of Polalta tobacco is A; The second KASP primer set is used to amplify the SNP site at 46722391 bp on tobacco chromosome 1, where the genotype of K326 tobacco is A and the genotype of Polalta tobacco is G; The third KASP primer set is used to amplify the SNP site at 143104070 bp on tobacco chromosome 1, where the genotype of K326 tobacco is C and the genotype of Polalta tobacco is T; The fourth KASP primer set is used to amplify the SNP site at 166603840 bp on tobacco chromosome 1, where the genotype of K326 tobacco is T and the genotype of Polalta tobacco is G; The fifth KASP primer set is used to amplify the SNP site at 191420573 bp on tobacco chromosome 1, where the genotype of K326 tobacco is T and the genotype of Polalta tobacco is G; The location of the SNP site on the chromosome was determined based on the whole genome sequence of K326 tobacco.

3. A kit, characterized in that Comprising the PCR primer combination according to claim 1.

4. A kit, characterized in that Comprising the KASP primer combination according to claim 2.

5. The kit according to claim 4, characterized in that The kit further comprises a PCR premix; the PCR premix comprises a first fluorescent probe, a first quenching probe, a second fluorescent probe and a second quenching probe; The nucleotide sequence of the first fluorescent probe is as shown in SEQ ID NO: 26, and the 5' end thereof is connected to the first fluorescent group; the nucleotide sequence of the first quencher probe is reverse complementary to the nucleotide sequence of the first fluorescent probe, and the 3' end thereof is connected to the quencher group; The nucleotide sequence of the second fluorescent probe is shown in SEQ ID NO: 27, and its 5' end is connected to the second fluorescent group; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second fluorescent probe, and its 3' end is connected to the quencher group.

6. The kit according to claim 5, characterized in that The first fluorescent group is FAM, and the second fluorescent group is HEX.

7. Use of the PCR primer combination according to claim 1, the KASP primer combination according to claim 2, or the kit according to any one of claims 3 to 6 in breeding tobacco varieties resistant to spotted wilt.

8. A method for screening tobacco breeding backgrounds for resistance to spotted wilt, characterized in that: The following steps are involved: a) extracting DNA from tobacco plants resistant to spotted wilt; b) performing PCR amplification on the DNA of the spotted wilt-resistant tobacco using the PCR primer set described in claim 1; c) detecting the amplification results, determining the genotype of the SNP site amplified by each PCR primer set in the tobacco plant resistant to spotted wilt, and screening the tobacco plant resistant to spotted wilt whose SNP site is a K326 tobacco genotype; The spotted wilt-resistant tobacco is a hybrid and backcross offspring of a donor parent, Polalta tobacco, and a recipient parent, K326 tobacco.

9. A method for screening tobacco breeding backgrounds for resistance to spotted wilt, characterized in that: The following steps are involved: a) extracting DNA from tobacco plants resistant to spotted wilt; b) adding the KASP primer set and PCR premix of claim 2 to the DNA of the spotted wilt-resistant tobacco to perform KASP amplification; The PCR premix contains a first fluorescent probe, a first quenching probe, a second fluorescent probe and a second quenching probe; The nucleotide sequence of the first fluorescent probe is as shown in SEQ ID NO: 26, and the 5' end thereof is connected to the first fluorescent group; the nucleotide sequence of the first quencher probe is reverse complementary to the nucleotide sequence of the first fluorescent probe, and the 3' end thereof is connected to the quencher group; The nucleotide sequence of the second fluorescent probe is as shown in SEQ ID NO: 27, and the 5' end thereof is connected to the second fluorescent group; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second fluorescent probe, and the 3' end thereof is connected to the quencher group; c) detecting the fluorescent signal to determine the genotype of the spotted wilt-resistant tobacco at the SNP site amplified by each KASP primer set, and screening spotted wilt-resistant tobacco having a K326 tobacco genotype at the SNP site; The spotted wilt-resistant tobacco is a hybrid and backcross offspring of a donor parent, Polalta tobacco, and a recipient parent, K326 tobacco.

10. The method according to claim 9, characterized in that The first fluorescent group is FAM, and the second fluorescent group is HEX.

11. The method according to claim 9, characterized in that During the KASP amplification, The PCR system includes: DNA template, KASP primer working solution and KASP-TF V4.0 2X Master Mix; The PCR program was as follows: step 1, pre-denaturation at 95°C for 15 min; step 2, denaturation at 95°C for 20 s, 65-57°C for 60 s, for a total of 9 cycles, with a decrease of 1°C during each cycle; step 3, denaturation at 95°C for 20 s, annealing at 57°C for 1 min, for a total of 32 cycles.

Images