SNP primer combination, method and application for identifying Wuhua Sanhuang chicken breed

Abstract

The present invention discloses a SNP primer combination for identifying the Wuhua Sanhuang chicken variety, wherein the primer combination is used to amplify at least one selected from the following WHP1 site to WHP6 site. The present invention also discloses the nucleotide sequence of the SNP primer combination, as well as a kit and application comprising the SNP primer combination, and a method for identifying the Wuhua Sanhuang chicken variety based on the SNP primer combination. When only one SNP site genotype does not conform to the corresponding genotype of the Wuhua Sanhuang chicken, it can be completely ruled out that the individual belongs to the Wuhua Sanhuang chicken; by selecting any 2 SNP site combinations, the probability of determining that the genotype of the Wuhua Sanhuang chicken is consistent can reach more than 96%. This method is easy to operate and has high accuracy, and can effectively reduce the risk of Wuhua Sanhuang chicken being counterfeited on the market.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a SNP primer combination, method and application for identifying a Wuhua Sanhuang chicken variety. Background Art

[0002] Wuhua Sanhuang Chicken is the only excellent local chicken breed in Meizhou City, with good meat quality, stress resistance and a long breeding history. Due to the rapid expansion of commercial chickens, Wuhua Sanhuang Chicken has experienced a sharp decline in population and erosion of genetic characteristics. After years of resource collection, purification, rejuvenation and breeding by relevant research units and enterprises, the population size of Wuhua Sanhuang Chicken has been restored. The biggest difference between Wuhua Sanhuang Chicken and other breeds is that the ends of the tail feathers and primary wing feathers are white. However, there are many varieties of yellow chickens sold in the market, especially in the context of the gradual ban on live poultry and the listing of fresh frozen chickens. How to protect Wuhua Sanhuang Chicken from being counterfeited has become an important issue for companies to consider.

[0003] Single nucleotide polymorphism (SNP) mainly refers to the DNA sequence polymorphism caused by the variation of a single nucleotide at the genomic level. It has the characteristics of high density, wide distribution, high genetic stability, representativeness, and convenient detection. SNP sites are often used to identify specific varieties. Specifically, the SNP sites with large variety differences in the individual genomic DNA are first screened, and then multiple SNP sites are combined for variety identification. The characteristic varieties are judged or excluded by the site frequency. The identification results are often more objective and accurate. Therefore, both in scientific research and applied practice, it is urgent to develop a product and method that can effectively and accurately identify the Wuhua Sanhuang chicken variety, which can be applied to the Wuhua Sanhuang chicken variety identification work. Summary of the invention

[0004] The invention provides a SNP primer combination for identifying a Wuhua Sanhuang chicken variety.

[0005] Specifically, the SNP primer combination used to identify the Wuhua Sanhuang chicken breed is selected from at least one of the following WHP1 site to WHP6 site:

[0006] WHP1 is located at position 34462795 on chromosome 1, and this SNP is an A / G polymorphism;

[0007] WHP2 is located at position 70372345 on chromosome 1, and this SNP is a C / T polymorphism;

[0008] WHP3 is located at position 71604752 on chromosome 1, and this SNP is a G / T polymorphism;

[0009] WHP4 is located at position 80537328 on chromosome 1, and this SNP is a C / T polymorphism;

[0010] WHP5 is located at position 23,064,190 on chromosome 7, and this SNP is an A / C polymorphism;

[0011] WHP6 is located at position 5415206 on chromosome 24, and this SNP is a G / A polymorphism.

[0012] The nucleotide sequence corresponding to each of the SNP site primer sets is:

[0013] Primer set for WHP1:

[0014] WHP1F: CGTGGAATGAGAAAGCTGCACWHP1R: ATGAGGCCAATCAACTGCTCA;

[0015] Primer set for WHP2:

[0016] WHP2F: CTCTCAGCCAGCACCTGTAAWHP2R: TGTTCTTGGGTGGAGGTGTG;

[0017] Primer set for WHP3:

[0018] WHP3F: TGGCTTCTGTAACTTTCCGTGTWHP3R: TTGCACATACTTCATGCAACACT;

[0019] Primer set for WHP4:

[0020] WHP4F: CTGGACAGTGCTTCCCTCAGWHP4R: AGGGGCCTGTCTCAATAGGT;

[0021] Primer set for WHP5:

[0022] WHP5F:TCCCAATTTTGGAGCGTCTCAWHP5R:GGTCACGTTGGCTGTTAGGA;

[0023] Primer set for WHP6:

[0024] WHP6F:GGATGGAGGCACCGACTGWHP6R:CACCGTTCTGCTGCGTGTAG.

[0025] A second object of the present invention is to provide a kit comprising the above-mentioned SNP primer combination.

[0026] The third object of the present invention relates to the application of SNP primer combination in identifying Wuhua Sanhuang chicken variety.

[0027] A fourth object of the present invention is to provide a method for identifying the Wuhua Sanhuang chicken variety.

[0028] Specifically, the method for identifying the Wuhua Sanhuang chicken variety comprises the following steps:

[0029] (1) Extracting total genomic DNA from chicken tissues,

[0030] (2) selecting at least two SNP sites and the corresponding SNP primer set of claim 2 for PCR amplification;

[0031] (3) After sequencing the amplified product, determine the genotype;

[0032] (4) Based on the genotype results, determine whether the individual belongs to the Wuhua Sanhuang chicken breed.

[0033] Furthermore, the chicken tissue in step (1) is individual feathers containing feather medulla, muscle tissue or blood of the chicken breed.

[0034] Furthermore, the genotypes of the six SNP sites WHP1 to WHP6 in the Wuhua Sanhuang chicken are AA, TT, GG, TT, CC, and GG, respectively.

[0035] Furthermore, in step (4), if one of the genotypes corresponding to the selected SNP combination does not conform to the genotype corresponding to the Wuhua Sanhuang chicken, it is determined that the individual does not belong to the Wuhua Sanhuang chicken; if the genotypes corresponding to at least two of the selected SNP sites all conform to the genotype corresponding to the Wuhua Sanhuang chicken, the probability that the individual belongs to the Wuhua Sanhuang chicken is determined according to the Bayesian theorem. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The electrophoresis diagram of primer amplification for each SNP site.

[0037] Lanes 1-4 are Wuhua Sanhuang chicken, 5-6 are Wenchang chicken, 7-8 are Huaixiang chicken, 9-10 are Huiyang Huxu chicken, 11-12 are Xinghua chicken, 13-14 are Guangxi Sanhuang chicken, 15-16 are Hetian chicken, 17-18 are Taoyuan chicken, 19-20 are Jianghan chicken, 21-22 are Gushi chicken, and M is DNA marker DL 2000. DETAILED DESCRIPTION

[0038] Genome resequencing technology was used to sequence different chicken breeds. By comparing the DNA sequences between different chicken breeds, based on the red junglefowl reference genome (Galgal5), the DNA sequence containing 6 specific SNP sites of the Wuhua Sanhuang chicken breed was screened out. Primers were designed for this sequence to perform PCR amplification and sequencing to verify the genotype of the SNP site to jointly determine whether the individual to be tested belongs to the Wuhua Sanhuang chicken.

[0039] Specifically, the mean allele frequency of each locus of representative domestic yellow chicken varieties such as Huaixiang chicken, Xinghua chicken, Huiyang bearded chicken, Guangxi three yellow chicken, Wenchang chicken, Taoyuan chicken, Hetian chicken, Jianghan chicken, and Gushi chicken was first determined, and then the mean was compared with the allele frequency of each locus of Wuhua three yellow chicken to screen SNP loci with large allele frequency differences, and the allele frequency of a certain locus of Wuhua three yellow chicken was 0 or 1, and the loci of other populations were close to 1 or close to 0. The DNA sequences of 6 specific SNP loci were thus determined, as shown in Table 1.

[0040] Table 1 SNP locus combination for Wuhua Sanhuang chicken breed identification

[0041] Serial number chromosome Location Reference genome Mutation site WHP1 1 34462795 A G WHP2 1 70372345 C T WHP3 1 71604752 G T WHP4 1 80537328 C T WHP5 7 23064190 A C WHP6 24 5415206 G A

[0042] According to the 6 specific SNPs identified, the corresponding primer sets for amplifying the WHP1 site to the WHP6 site were designed, as shown in Table 2.

[0043] Table 2 Primer information of Wuhua Sanhuang chicken breed-specific SNP loci

[0044]

[0045] Identification method of Wuhua Sanhuang chicken breed:

[0046] (1) Using the “Animal Tissue Direct PCR Kit” of Chengdu Fuji Biotechnology

[0047] (http: / / www.foregene.com / scientific_detail.aspx?t=19&pid=5&cid=68) to quickly extract the total genomic DNA of the chicken tissue (muscle, feather) to be tested, or "EDTA anticoagulated blood direct PCR kit (http: / / www.foregene.com / scientific_detail.aspx?t=19&pid=7&cid=56) to quickly extract the total genomic DNA of the blood.

[0048] (2) According to the SNP combinations selected in Table 1, PCR amplification was performed using the corresponding primer pairs in Table 2.

[0049] (3) After sequencing the PCR amplification products, the genotypes were determined. The genotypes of the six SNP sites WHP1 to WHP6 in Wuhua Sanhuang chicken were AA, TT, GG, TT, CC, and GG, respectively.

[0050] (4) Based on the genotype results, determine whether the individual belongs to the Wuhua Sanhuang chicken breed.

[0051] If one of the genotypes corresponding to the selected SNP combination does not match the genotype corresponding to the Wuhua Sanhuang chicken, it is determined that the individual does not belong to the Wuhua Sanhuang chicken; if all the genotypes corresponding to the selected SNP combination match the genotypes corresponding to the Wuhua Sanhuang chicken, the probability that the individual belongs to the Wuhua Sanhuang chicken is determined according to the Bayesian theorem.

[0052] The calculation formula of Bayes' theorem is as follows:

[0053]

[0054] Among them, pi represents the frequency of the corresponding genotypes of other varieties in the i-th SNP in the SNP combination.

[0055] The genotype and gene frequency of SNP loci in Wuhua Sanhuang Chicken and other breeds are as follows:

[0056] Table 3 Genotypes and genotype frequencies of the six SNP loci in Wuhua Sanhuang chicken and other breeds

[0057]

[0058] Among them, the genotype frequency of other breeds refers to the average genotype frequency of representative domestic yellow chicken breeds such as Huaixiang chicken, Xinghua chicken, Huiyang bearded chicken, Guangxi Sanhuang chicken, Wenchang chicken, Taoyuan chicken, Hetian chicken, Jianghan chicken, and Gushi chicken.

[0059] According to Bayesian theorem, the probability of any one SNP site genotype being determined as Wuhua Sanhuang Chicken is as low as 84.39% and as high as 89.01%; the probability of any two SNP sites combined genotype being determined as Wuhua Sanhuang Chicken is above 96.95%; the probability of any three SNP sites combined genotype being determined as Wuhua Sanhuang Chicken is above 99.52%; the probability of any four SNP sites combined genotype being determined as Wuhua Sanhuang Chicken is above 99.92%; the probability of any five SNP sites combined genotype being determined as Wuhua Sanhuang Chicken is above 99.99%; the probability of all six SNP sites combined genotype being determined as Wuhua Sanhuang Chicken is above 99.99%. The probability of any one SNP site genotype excluding Wuhua Sanhuang Chicken is 100%.

[0060] Therefore, as long as the genotype of one SNP site does not match the corresponding genotype of Wuhua Sanhuang Chicken, the individual can be completely excluded from belonging to Wuhua Sanhuang Chicken; any combination of two SNP sites can reach a probability of more than 96% that the genotype of Wuhua Sanhuang Chicken is met. This method is easy to operate and has high accuracy, which can effectively reduce the risk of Wuhua Sanhuang Chicken being counterfeited in the market.

[0061] Example 1

[0062] Randomly select 20 Wuhua Sanhuang chickens, Xinghua chickens, Huanglang chickens and Lingnan yellow chickens from the breeding farm, pluck the feathers with medullary on the back, and use the "Animal Tissue Direct PCR Kit" of Chengdu Fuji Biological

[0063] (http: / / www.foregene.com / scientific_detail.aspx?t=19&pid=5&cid=68) Rapidly extract the total genomic DNA to be tested, and perform PCR amplification according to the primers of the 4 SNP sites in Table 4.

[0064]

[0065] The PCR system was 30 μL, containing 15 μL of 2×PCR reagent in the Fuji Biotechnology PCR Kit, 0.3 μL of each forward and reverse primer (20 ng / μL), 1 μL of DNA template, and 13.4 μL of ultrapure water.

[0066] PCR amplification conditions: first denaturation at 94°C for 3 min, then 35 cycles (94°C for 30 s, 58°C for annealing for 30 s, 72°C for extension for 30 s), and finally extension at 72°C for 5 min, and storage at 4°C. The PCR instrument was the American Bio-Rad T100 gradient PCR instrument. After the target band of the PCR amplification product was detected by 1.5% agarose gel electrophoresis, it was sent to Guangzhou Aiji Biotechnology Co., Ltd. for sequencing.

[0067] According to the sequencing results, the probability of excluding Wuhua Sanhuang chicken at a single locus is more than 90.91%, and the probability of 20 individuals with the combined genotype of AA GG CC GG at the four loci being identified as Wuhua Sanhuang chicken is 99.96%. Therefore, all 20 individuals were identified as Wuhua Sanhuang chicken, with an identification accuracy of 100%. The remaining individuals did not fully meet the AA GG CC GG genotype and were therefore determined to be non-Wuhua Sanhuang chicken.

Claims

1. A SNP primer combination for identifying the Wuhua Sanhuang chicken variety, characterized in that: The primer combination is used to amplify the following WHP1 site to WHP6 site based on the red junglefowl reference genome Galgal5: WHP1 is located at position 34462795 on chromosome 1, and this SNP is an A / G polymorphism; WHP2 is located at position 70372345 on chromosome 1, and this SNP is a C / T polymorphism; WHP3 is located at position 71604752 on chromosome 1, and this SNP is a G / T polymorphism; WHP4 is located at position 80537328 on chromosome 1, and this SNP is a C / T polymorphism; WHP5 is located at position 23,064,190 on chromosome 7, and this SNP is an A / C polymorphism; WHP6 is located at position 5415206 on chromosome 24, and this SNP is a G / A polymorphism.

2. The SNP primer combination for identifying the Wuhua Sanhuang chicken variety according to claim 1, characterized in that: The nucleotide sequence corresponding to the SNP primer combination is: Primer set for WHP1: WHP1F: CGTGGAATGAGAAAGCTGCAC WHP1R: ATGAGGCCAATCAACTGCTCA; Primer set for WHP2: WHP2F:CTCTCAGCCAGCACCTGTAA WHP2R: TGTTCTTGGGTGGAGGTGTG; Primer set for WHP3: WHP3F: TGGCTTCTGTAACTTTCCGTGT WHP3R:TTGCACATACTTCATGCAACACT; Primer set for WHP4: WHP4F:CTGGACAGTGCTTCCCTCAG WHP4R: AGGGGCCTGTCTCAATAGGT; Primer set for WHP5: WHP5F:TCCCAATTTGGAGCGTCTCA WHP5R:GGTCACGTTGGCTGTTAGGA; Primer set for WHP6: WHP6F:GGATGGAGGCACCGACTG WHP6R: CACCGTTCTGCTGCGTGTAG.

3. A kit comprising the SNP primer combination of claim 1 or 2.

4. Use of the SNP primer combination of claim 1 or 2 in identifying the Wuhua Sanhuang chicken variety.

5. A method for identifying the Wuhua Sanhuang chicken breed, characterized in that: The following steps are involved: (1) Extraction of total genomic DNA from chicken tissues, (2) performing PCR amplification using the SNP primer combination described in claim 2; (3) After sequencing the amplified product, determine the genotype; (4) According to the genotype results, determine whether the individual belongs to the Wuhua Sanhuang chicken breed; the genotypes of the six SNP sites WHP1 to WHP6 in the Wuhua Sanhuang chicken are AA, TT, GG, TT, CC, and GG, respectively.

6. The method for identifying the Wuhua Sanhuang chicken variety according to claim 5, characterized in that: The chicken tissue in step (1) is individual feathers containing feather medulla, muscle tissue or blood of the chicken breed.

Images