A sucrose synthase mutant with improved thermostability
By genetically modifying sucrose synthase, especially mutations in specific amino acid positions, to improve its thermal stability, the problem of long reaction time and high risk of bacterial infection under medium temperature conditions is solved, and the rapid synthesis and efficient production of UDP-Glc at high temperatures is achieved.
Patent Information
- Application Number
- CN202211333535.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-28
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2042-10-28
AI Technical Summary
Sucrose synthase has low thermal stability and usually requires catalyzing of reactions under medium temperature conditions, resulting in a long reaction time and a high risk of bacterial infection.
By genetically modifying sucrose synthase mutants, especially single point or combination mutations at specific amino acid positions, the thermal stability is improved, including mutations such as G158W, Q162W, S240Y, Q183P, A83P, G612P, A79F, G39L, A100P, C235T, etc., the expression of E. coli engineered bacteria and purify the mutant enzyme.
The rapid synthesis of UDP-Glc at high temperatures can improve production efficiency, reduce bacterial infection risks, and meet industrial needs. The half-life of some mutants is significantly improved at 55°C, and the half-life of the combined mutant Q162W-G612P-A79F-S240Y is increased by 27 times and the catalytic efficiency is increased by 5.5 times.
Smart Images

Figure CN115975971B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a sucrose synthase mutant with improved thermal stability, and belongs to the field of enzyme engineering. Background Art
[0002] UDP-Glc exists in plants, animals, and microorganisms, serving as a glucose donor in the synthesis of sucrose, starch, glycogen, and other oligosaccharides and polysaccharides. It can also be converted into uridine diphosphate galactose and uridine diphosphate glucuronic acid. UDP-Glc can be converted to uridine diphosphate galactose (UDP-Gal) by the action of galactose epimerase, or to uridine diphosphate glucuronic acid (UDP-GlcA) by the catalysis of UDP-Glc dehydrogenase. Further conversion to uridine diphosphate xylose (UDP-Xyl) and uridine diphosphate arabinose (UDP-Ara) is achieved by the action of UDP-xylose synthase and UDP-xylose epimerase, respectively. These nucleotide sugars are common sugar donors in organisms and play an important role in cell growth, such as participating in protein glycosylation. They also provide important sugar donors for the synthesis of active sugars such as human milk oligosaccharides and glycosaminoglycans. UDPG has also been used in the development of new drugs and new sweeteners. For example, UDPG is used as a glycosyl donor to synthesize the antibiotic BE-7585A via ORF-36-28 enzyme catalysis; 14C-UDPG labeled with the hexacarbon as the only glycosyl donor is used to synthesize the main glycoside of stevia via UDP glycosyltransferase catalysis.
[0003] Nucleotide sugars like UDP-Glc are difficult to obtain naturally and are relatively expensive, making chemical and enzymatic methods the common methods for artificially preparing UDP-sugars. Chemical synthesis of UDP-Glc typically requires harsh conditions (such as low temperatures) and long reaction times, typically exceeding 12 hours. Enzymatic synthesis, with its milder and greener reaction conditions, demonstrates potential for industrial application.
[0004] The de novo synthesis pathway of UDP-Glc in organisms is relatively complex. Glc is catalyzed sequentially by hexokinase, phosphoglucomutase, and UDP-glucose pyrophosphorylase to produce UDP-Glc. Sucrose synthase is primarily involved in sucrose synthesis in microorganisms and plants and is closely associated with plant photosynthesis. Sucrose synthase catalyzes the decomposition of sucrose into UDP-Glc and fructose, and has garnered widespread attention due to its ability to catalyze the one-step synthesis of UDP-Glc. However, sucrose synthase is thermally unstable, typically requiring a reaction at moderate temperatures (30-45°C) for 10-12 hours. This reaction significantly increases the risk of bacterial contamination. Therefore, improving the thermal stability of sucrose synthase and enabling reactions at higher temperatures would not only shorten the reaction time and accelerate UDP-Glc synthesis, but also reduce the risk of bacterial contamination. Summary of the Invention
[0005] [Technical Issues]
[0006] The technical problem to be solved by the present invention is that sucrose synthase has low thermal stability and usually needs to catalyze the reaction under medium temperature conditions (30-45° C.).
[0007] [Technical solution]
[0008] The present invention provides a sucrose synthase mutant with improved thermal stability, wherein the amino acid sequence of the sucrose synthase mutant is different from that of SEQ ID NO. 1 at position G158, position 162, position 240, position 183, position 83, position 612, position 79, position 39, position 100 or position 235.
[0009] In one embodiment of the present invention, the parent of the sucrose synthase mutant is from Nitrosospiraeuropaea.
[0010] In one embodiment of the present invention, relative to SEQ ID NO. 1, the amino acid sequence of the sucrose synthase mutant is mutated from glycine to tryptophan at position 158, and is named G158W.
[0011] In one embodiment of the present invention, relative to SEQ ID NO. 1, the amino acid sequence of the sucrose synthase mutant is mutated from glutamine to tryptophan at position 162, and is named Q162W.
[0012] In one embodiment of the present invention, relative to SEQ ID NO. 1, the amino acid sequence of the sucrose synthase mutant is mutated from serine to tyrosine at position 240, and is named S240Y.
[0013] In one embodiment of the present invention, relative to SEQ ID NO. 1, the amino acid sequence of the sucrose synthase mutant is mutated from glutamine to proline at position 183, and is named Q183P.
[0014] In one embodiment of the present invention, relative to SEQ ID NO. 1, the amino acid sequence of the sucrose synthase mutant is mutated from alanine to proline at position 83, and is named A83P.
[0015] In one embodiment of the present invention, relative to SEQ ID NO. 1, the amino acid sequence of the sucrose synthase mutant is mutated from glycine to proline at position 612, and is named G612P.
[0016] In one embodiment of the present invention, relative to SEQ ID NO. 1, the amino acid sequence of the sucrose synthase mutant is mutated from alanine to phenylalanine at position 79, and is named A79F.
[0017] In one embodiment of the present invention, relative to SEQ ID NO. 1, the amino acid sequence of the sucrose synthase mutant is mutated from glycine to leucine at position 39 and is named G39L.
[0018] In one embodiment of the present invention, relative to SEQ ID NO. 1, the amino acid sequence of the sucrose synthase mutant is mutated from alanine to proline at position 100, and is named A100P.
[0019] In one embodiment of the present invention, relative to SEQ ID NO. 1, the amino acid sequence of the sucrose synthase mutant is mutated from cysteine to threonine at position 235, and is named C235T.
[0020] In one embodiment of the present invention, relative to SEQ ID NO.1, the amino acid sequence of the sucrose synthase mutant is mutated from glutamine to tryptophan at position 162, from glycine to proline at position 612, from alanine to phenylalanine at position 79, and from serine to tyrosine at position 240.
[0021] In one embodiment of the present invention, relative to SEQ ID NO. 1, the amino acid sequence of the sucrose synthase mutant is mutated from glutamine to tryptophan at position 162, and from glycine to proline at position 612.
[0022] In one embodiment of the present invention, relative to SEQ ID NO. 1, the amino acid sequence of the sucrose synthase mutant is mutated from glutamine to tryptophan at position 162, from glycine to proline at position 612, and from alanine to phenylalanine at position 79.
[0023] The present invention also provides a gene encoding the mutant.
[0024] The invention provides an engineered Escherichia coli capable of expressing the sucrose synthase mutant.
[0025] In one embodiment of the present invention, pET 28a(+) is used as the expression vector.
[0026] In one embodiment of the present invention, Escherichia coli BL21 is used as the host.
[0027] In one embodiment of the present invention, the specific steps of the method for preparing the above-mentioned sucrose synthase mutant are:
[0028] (1) Connecting the gene encoding the sucrose synthase mutant to an expression vector to obtain a recombinant expression vector,
[0029] (2) transferring the recombinant expression vector into a host, culturing the host, and causing the host to express the sucrose synthase mutant.
[0030] (3) Isolate and purify the sucrose synthase mutant from the host culture medium.
[0031] The sucrose synthase mutant with improved thermal stability of the present invention can be used to prepare UDP-Glc using sucrose as a substrate. For example, 1M sucrose is used as a substrate, 200mM UDP and 10mg / L purified sucrose synthase are added, and the reaction is carried out at 55°C to obtain UDP-Glc.
[0032] [Beneficial Effects]
[0033] The present invention transforms sucrose synthase by genetic engineering means, obtains a series of transformants with improved stability through single-point mutation and combined mutation, and can realize the synthesis of UDP-Glc at high temperature, thereby improving production efficiency and meeting the needs of industrial production.
[0034] The single mutants G158W, Q162W, S240Y, Q183P, A83P, G612P, A79F, G39L, A100P, and C235T all showed higher stability than WT. Among them, the half-lives of G158W and Q162W at 55°C were increased to 13 min and 9 min, respectively.
[0035] The combined mutant Q162W-G612P-A79F-S240Y retained 50% of its enzyme activity after incubation at 55°C for more than 30 minutes, and its half-life was 27-fold higher than that of the WT. The half-lives of Q162W-G612P and Q162W-G612P-A79F were 12 and 15 minutes, respectively, also significantly higher than those of the WT.
[0036] The combined mutant Q162W-G612P-A79F-S240Y was used to synthesize UDP-Glc. After 2 hours of reaction, Q162W-G612P-A79F-S240Y catalyzed the yield of 131 mM UDP-Glc, a 5.5-fold increase over the WT. Furthermore, Q162W-G612P-A79F-S240Y rapidly synthesized the product at 55°C, achieving a space-time conversion rate of 37 g / l / h for UDP-Glc. Within the first 30 minutes of the rapid reaction, the space-time conversion rate reached as high as 115 g / l / h. This demonstrates the rapid synthesis of UDP-Glc at high temperatures. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1Stability of single-point mutants
[0038] Figure 2 Relative enzyme activity of single mutants
[0039] Figure 3 Optimum temperature of single mutant
[0040] Figure 4 Stability of combined mutants
[0041] Figure 5 Relative enzyme activities of combined mutants
[0042] Figure 6 Optimal reaction temperature of combined mutants
[0043] Figure 7 Synthesis process of UDP-Glc DETAILED DESCRIPTION
[0044] The LB medium used in the following examples was composed of 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride (NaCl), and pH 7.4.
[0045] The PB buffer used in the following examples: 2.299 g Na2HPO4, 0.455 g NaH2PO4, fixed to 1 L.
[0046] Solution A (equilibrium solution) used in the following examples: 0.3404 g / L imidazole (5 mM) and 29.22 g / L NaCl (0.5 M) were added to the above PB solution to adjust the pH to 7.4.
[0047] Solution B (eluent) used in the following examples: 34.075 g / L imidazole (500 mM) and 29.22 g / L NaCl (0.5 M) were added to the above PB solution to adjust the pH to 7.4.
[0048] The enzyme activity assay method used in the following examples was as follows: the enzyme was incubated in 50 mmol / L PB buffer (pH 6.5) containing 100 mmol / L sucrose and 10 mmol / L UDP in a total volume of 100 μL at 50° C. for 5 min.
[0049] Definition of enzyme activity: The amount of enzyme required to convert 1 μmol UDP-Glc within 1 min is 1 enzyme activity unit (U).
[0050] Determination method of the products in the following examples: UDP-Glc was determined using a C18 column, a mobile phase of 40% tetrabutylammonium bromide, a flow rate of 1.51 ml / min, and a UV detector.
[0051] Example 1 Construction of sucrose synthase NmSusy and its mutants
[0052] (1) Construction of a recombinant plasmid containing a gene encoding sucrose synthase
[0053] Sucrose synthase from Nitrosospira europaea was selected as the wild type, the amino acid sequence of the enzyme is shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene is SEQ ID NO.2.
[0054] The nucleotide sequence SEQ ID NO.2 was synthesized by Sangon Biotech (Shanghai) Co., Ltd. EcoR I and Sac I on pET28a were selected as the sites for inserting the target gene, and the target gene was amplified with the upstream primer: ATGAATTCATGGCTAGCCTTCATAAATTT and the downstream primer ACGAGCTCTCACTGAGGA AGAGCCTGAGCCATA, so that the target gene has an enzyme cleavage site. pET28a was double-digested and purified to obtain a linearized plasmid fragment. The target gene with the enzyme cleavage site and the linearized plasmid fragment were connected together by homologous recombination. The system for homologous recombination contained: 1 μL enzyme-digested linearized plasmid, 1 μL target fragment, 2 μL Buffer, 1 μL recombinase, and 5 μL H2O. Homologous recombination was performed at 37°C for 30 minutes. The ligation product was then stored at -20°C.
[0055] The ligation product was transformed into competent Escherichia coli DE3 (BL21) and cultured at 37°C for 1 hour. The bacterial solution was then spread on a plate culture medium containing kanamycin resistance. After overnight culture, a single colony was picked, amplified and cultured, and the plasmid was extracted. Colony PCR was performed with universal primers, and plasmids with positive PCR results were sequenced to verify the correct sucrose synthase gene recombinant plasmid.
[0056] (2) Construction of a recombinant plasmid containing a gene encoding a sucrose synthase mutant
[0057] Rosetta DDG and Fold X were used to calculate the difference in Gibbs free energy between the wild-type and mutant forms. Mutants with significant reductions in free energy were selected for further structural analysis. Structural analysis was performed using protein visualization software such as Schrödinger, eliminating sites located near the active pocket that might introduce steric clashes. Furthermore, based on the structural characteristics of sucrose synthase, hotspots located near the tetramer interface or forming new hydrogen bond salt bridges at the interface were prioritized, ultimately identifying 10 mutation hotspots.
[0058] Using the whole plasmid PCR method, the recombinant plasmid obtained in step (1) was used as a template to perform PCR to obtain a recombinant plasmid in which the gene encoding the sucrose synthase mutant after mutation was linked to the expression vector pET 28a(+). The primers used are shown in Table 1. The recombinant plasmid was digested with DpnI for about 2 hours and transformed into competent E. coli BL21 (DE3) using the heat shock method. Monoclonal colonies were selected and cultured overnight at 37°C and 200 rpm. Plasmids were extracted from the monoclonal strain culture and sent to a sequencing company for sequencing. Mutants with correct sequencing results were considered to be successful mutants.
[0059] Table 1 Primer sequences used to construct mutants
[0060]
[0061]
[0062] (3) Induced expression and purification of target protein
[0063] Correctly sequenced monoclonal strains were activated by shaking in LB medium for 12 hours. The strains were then inoculated into fresh LB medium and cultured at 37°C, 200 rpm, until the OD reached 0.8. IPTG was then added to a final concentration of 1 mM and cultured at 16°C, 200 rpm for 20 hours. After the culture period, the precipitate was centrifuged and the supernatant was collected after treatment with a cell disruptor. The crude enzyme solution was then purified using a nickel column.
[0064] The nickel column purification method is as follows:
[0065] First, balance the nickel column with balance solution A, and then -1 The sample was injected at a flow rate of 100 μg / min. After injection, the column was rinsed again with Solution A for 10 minutes. The ratio of Solution B to Solution A was then adjusted to a concentration of 100 μM imidazole in the eluent. Contaminants were then eluted with the eluent. The imidazole concentration in the eluent was then adjusted to 200 μM, and the target protein was eluted and collected. The collected eluate containing the target protein (sucrose synthase mutant) was desalted and concentrated using an ultrafiltration tube. The concentrate was stored at 4°C for subsequent experiments.
[0066] Example 2 Comparison of stability, relative enzyme activity, and optimal temperature of single-point mutations of sucrose synthase NmSusy
[0067] 1. Stability comparison
[0068] The purified enzyme solutions of the mutants obtained in Example 1 were incubated at 55° C., and the residual enzyme activities were measured after incubation for 5, 10, 15, 30, 60, 120, and 180 min, respectively. The relative enzyme activities at other time points were calculated with the initial enzyme activity as 100%, and the time-residual enzyme activity curves were drawn (e.g., Figure 1 ) and the half-life was obtained by fitting. The half-life of the WT (wild type) at 55°C was 1 minute. The single-point mutants G158W, Q162W, S240Y, Q183P, A83P, G612P, A79F, G39L, A100P, and C235T all exhibited higher stability than the WT. The half-lives of G158W and Q162W at 55°C were increased to 13 minutes and 9 minutes, respectively. The half-lives of the remaining transformants, S240Y, Q183P, A83P, G612P, A79F, G39L, A100P, and C235T, were 5, 4, 4, 4, 4, 2, 3, and 2 minutes, respectively.
[0069] 2. Comparison of relative enzyme activity
[0070] like Figure 2 As shown, among single-point mutations, improved stability comes at the expense of some of the enzyme's catalytic activity. However, the enzymatic activities of A79F and A100P were improved by 12% and 18%, respectively, compared to WT. While G158W showed the most significant improvement in stability, it also suffered a 50% loss in enzymatic activity. Meanwhile, Q162W, another mutant with significantly improved stability, only lost less than 10% of its catalytic activity.
[0071] 3. Comparison of optimum temperature
[0072] like Figure 3 As shown in the figure, although the stability of the single point mutant was improved, its optimal temperature did not change and remained consistent with the WT, which was 55°C.
[0073] Example 3 Comparison of Stability, Relative Enzyme Activity, and Optimal Temperature of Combination Mutations of Sucrose Synthase NmSusy
[0074] 1. Construction of Combinatorial Mutants
[0075] Using the plasmid of mutant Q162W as a template, as in Example 1(2), the primers in Table 1 were used to insert the G612P mutation site to obtain the Q162W-G612P mutant. Using the plasmid of this double mutant as a template, the A79F mutation site was further inserted to obtain the triple mutant Q162W-G612P-A79F. This mutant plasmid was further used as a template to insert the S240Y mutation site to finally obtain the mutant Q162W-G612P-A79F-S240Y.
[0076] 2. Stability comparison:
[0077] The stability of the combined mutants was determined by referring to Example 2, and the time-residual enzyme activity curve at 55°C was obtained. Figure 4 As shown, the optimal mutant, Q162W-G612P-A79F-S240Y, retained 50% of its enzyme activity after incubation at 55°C for more than 30 minutes, and its half-life was calculated to be 27-fold higher than that of the WT. The half-lives of Q162W-G612P and Q162W-G612P-A79F were 12 and 15 minutes, respectively, also significantly higher than those of the WT.
[0078] 3. Comparison of relative enzyme activity
[0079] like Figure 5 As shown, the transformants with the three combined mutations showed minimal loss of enzyme activity. The enzyme activities of Q162W-G612P and Q162W-G612P-A79F were significantly improved, reaching 115% and 117% of the WT, respectively. Q162W-G612P-A79F-S240Y lost 10% of its WT activity, but its stability was significantly improved.
[0080] 4. Comparison of optimum temperature
[0081] While the thermal stability of the combined mutant transformants was improved, their optimum temperature also changed significantly, from the original 55°C to 65-70°C, showing stronger high temperature resistance.
[0082] Example 4: Synthesis of UDP-Glc using sucrose synthase mutants
[0083] 200mM UDP, 1M sucrose, and 0.1g / L wild-type sucrose synthase and the mutant Q162W-G612P-A79F-S240Y with the most significant stability improvement were added to phosphate buffer (pH 6.5). The reaction was carried out at 55°C for 2h. 10μl samples were taken at 30, 60, and 120min of reaction, and the UDP-Glc content was determined. The amount of UDP-Glc synthesized during the reaction was as follows: Figure 7 After 2 hours of reaction, Q162W-G612P-A79F-S240Y catalyzed the yield of 131 mM UDP-Glc, 5.5 times that of WT. Furthermore, Q162W-G612P-A79F-S240Y rapidly synthesized the product at 55°C, achieving a space-time conversion rate of 37 g / l / h for UDP-Glc. Within the first 30 minutes of the rapid reaction, the space-time conversion rate reached as high as 115 g / l / h, enabling rapid synthesis of UDP-Glc at high temperatures.
[0084] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.
Claims
1. A sucrose synthase mutant with improved thermostability, characterized in that Based on the amino acid sequence of sucrose synthase described in SEQ ID NO.1, glutamine at position 162 is mutated to tryptophan, or, Based on the amino acid sequence of sucrose synthase described in SEQ ID NO. 1, glutamine at position 162 is mutated to tryptophan, glycine at position 612 is mutated to proline, alanine at position 79 is mutated to phenylalanine, and serine at position 240 is mutated to tyrosine, or, Based on the amino acid sequence of sucrose synthase described in SEQ ID NO.1, glutamine at position 162 is mutated to tryptophan, and glycine at position 612 is mutated to proline, or, Based on the amino acid sequence of sucrose synthase described in SEQ ID NO.1, position 162 was mutated from glutamine to tryptophan, position 612 was mutated from glycine to proline, and position 79 was mutated from alanine to phenylalanine.
2. A gene encoding the sucrose synthase mutant according to claim 1.
3. An engineered Escherichia coli for expressing the sucrose synthase mutant according to claim 1.
4. The engineered Escherichia coli bacteria according to claim 3, characterized in that by Escherichia coli BL21 was used as the host and pET 28a(+) was used as the expression vector.
5. A method for preparing the sucrose synthase mutant according to claim 1, characterized in that: Including steps: (1) Connect the gene encoding the sucrose synthase mutant to the expression vector to obtain a recombinant expression vector. (2) The recombinant expression vector is transferred into the host, and the host is cultured so that the host expresses the sucrose synthase mutant. (3) Isolate and purify the sucrose synthase mutant from the host culture medium.
6. Use of the sucrose synthase mutant according to claim 1 in preparing UDP-Glc using sucrose as a substrate.
7. The use according to claim 6, characterized in that Sucrose synthase mutant was used to catalyze the reaction of sucrose and UDP at 55°C to produce UDP-Glc.
Citation Information
Patent Citations
Sucrose synthase mutant with improved catalytic characteristics
CN116790540A