A high-sensitivity probe and its preparation method and application

Abstract

The present invention relates to the field of gene detection technology, and specifically to a highly sensitive probe, and a preparation method and application thereof. The probe is a partially double-stranded probe, which includes a template probe chain and a detection probe chain, wherein the detection probe chain is sequentially a complementary pairing region of a target sequence to be detected, a connecting base, a template probe complementary pairing region and a labeling region from 5' to 3' end, and the labeling region contains a labeling base; the template probe chain is sequentially a complementary pairing region of a detection probe chain and a complementary pairing region of a detection probe chain labeling region from 3' to 5' end, and the complementary pairing region of the detection probe chain labeling region does not contain a connecting base; the template probe chain and the detection probe chain form a partially double-stranded probe whose 5' end of the detection probe chain is a single chain. The probe provided by the present invention contains multiple labels, and its detection sensitivity can reach the level of radioisotope detection.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a high-sensitivity probe, a preparation method and application thereof. Background Art

[0002] Northern blot is a commonly used experimental method in biochemistry and molecular biology. It detects the target fragment by hybridizing with a probe that is complementary to a specific gene. It is a commonly used RNA qualitative and quantitative analysis method. In the Northern blot method, RNA samples are separated according to molecular weight after gel electrophoresis, and then the samples are transferred from the gel to the membrane, and then hybridized with a labeled probe complementary to the target sequence, and the expression of the target gene is detected by developing the probe signal.

[0003] At present, there are two main types of probe methods used in Northern blot: one is based on radioactive labeling of isotopes, which has the advantages of high sensitivity, good specificity and strong resolution, but radioactive isotopes are harmful to the human body, the probe half-life is short, and it also requires a specific laboratory and corresponding test protection facilities, as well as specially trained personnel to operate, which has high requirements and leads to extremely high detection costs; the second is to incorporate reporter groups through enzymatic, photochemical and chemical means, and such reporter groups can be detected by highly sensitive cold light, fluorescence or metal precipitation detection systems. In the detection process of small RNA, since the length of the detected small RNA is short, generally only more than 20 nucleotides, the length of the corresponding probe is also short. For shorter probes, synthetic oligonucleotides are generally used as probes, and then the 3' end or 5' end is labeled. At this time, generally only one or two groups are labeled, and the number of detectable groups directly affects the detection sensitivity. Summary of the invention

[0004] In view of the technical problems existing in the prior art, one of the purposes of the present invention is to provide a new probe, which contains multiple labels and has extremely high detection sensitivity.

[0005] The high-sensitivity probe provided is a partially double-stranded probe, which includes a template probe chain and a detection probe chain, wherein the detection probe chain is composed of a complementary pairing region of a target sequence to be detected, a connecting base, a template probe complementary pairing region and a label region from the 5' to the 3' end, wherein the label region contains a label base;

[0006] The template probe chain has a detection probe chain complementary pairing region and a detection probe chain label region complementary pairing region from the 3' end to the 5' end, and the detection probe chain label region complementary pairing region does not contain a connecting base;

[0007] The template probe chain and the detection probe chain form a partially double-stranded probe in which the 5' end of the detection probe chain is a single strand.

[0008] The present invention adopts a double-probe fusion method, and multiple labeling groups are incorporated in the fusion process, and the detection sensitivity can reach the level of radioisotope detection.

[0009] In one embodiment of the present invention, the label is a biotin label or a digoxigenin label.

[0010] A second object of the present invention is to provide a method for preparing the above-mentioned high-sensitivity probe, comprising the following steps:

[0011] synthesizing a template probe chain and a detection probe chain without a label region respectively;

[0012] Annealing the template probe chain and the detection probe chain without the label region in an annealing system to form a partially double-stranded probe precursor;

[0013] Amplifying a portion of the double-stranded probe precursor in an amplification system, thus obtaining;

[0014] The amplification system contains a labeled base but does not contain a base complementary to the connecting base.

[0015] In one embodiment of the present invention, the connecting base is C, and the substrate of the amplification system does not contain dGTP and its marker; or the connecting base is A, and the substrate of the amplification system does not contain dTTP and its marker; or when the connecting base is G, the substrate of the amplification system does not contain dCTP and its marker; or when the connecting base is T, the substrate of the amplification system does not contain dATP and its marker.

[0016] In one embodiment of the present invention, the annealing conditions are: keeping at 70° C. for 5 minutes, then cooling to 22° C. at a cooling rate of 0.1° C. / s and keeping for 5 minutes.

[0017] The third purpose of the present invention is to protect the application of the above-mentioned high-sensitivity probe in nucleic acid detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 A schematic diagram of the structure and preparation method of the probe according to the present invention;

[0019] Figure 2 The figure is a comparison chart of the detection effect of the probe prepared in Example 1-2 and the prior art, wherein A is the detection effect of the biotin probe in the prior art, and B is the detection effect of the probe used in the present invention;

[0020] Figure 3This is a comparison chart of the detection effect of the probe prepared in Example 3-4 and the detection effect of radioisotope labeling, wherein A is the detection effect of radioisotope labeling, and B is the detection effect of the probe used in the present invention.

[0021] Figure 4 This is the detection effect of the probe prepared in Example 5, where both lanes show the detection results. DETAILED DESCRIPTION

[0022] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand the present invention more clearly.

[0023] The following embodiments are only used to illustrate the present invention, but are not limited to the scope of the present invention. Based on the specific embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without creative work belong to the protection scope of the present invention.

[0024] In the examples of the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art; in the examples of the present invention, unless otherwise specified, the technical means used are conventional means well known to those skilled in the art.

[0025] In the process of small RNA detection, since the length of the detected small RNA is extremely short, generally only more than 20 nucleotides, the length of the corresponding probe is also short. For shorter probes, synthetic oligonucleotides are generally used as probes, and then the 3' end or 5' end is labeled. This labeling generally labels one group, so the number of detectable groups directly affects its detection sensitivity. Based on this, the present invention adopts a double probe fusion method, and multiple labeled groups are incorporated in the fusion process, thereby greatly improving the detection sensitivity. The structure of the provided probe is as follows:

[0026] The probe is a partially double-stranded probe, which includes a template probe chain and a detection probe chain. The detection probe chain is composed of a complementary pairing region of a target sequence to be detected, a connecting base, a template probe complementary pairing region and a labeling region from the 5' to the 3' end, and the labeling region contains a labeling base; the template probe chain is composed of a complementary pairing region of a detection probe and a complementary pairing region of a labeling region of a detection probe chain from the 3' to the 5' end, and the complementary pairing region of the labeling region of the detection probe chain does not contain a connecting base; the template probe chain and the detection probe chain complement each other to form a partially double-stranded probe with the 5' end of the detection probe chain being a single chain.

[0027] The preparation method is as follows:

[0028] First, a template probe chain and a detection probe chain without a label region are synthesized separately;

[0029] Secondly, the template probe chain and the detection probe chain without the label region are annealed in an annealing system to form a partially double-stranded probe precursor;

[0030] Finally, part of the double-stranded probe precursor is amplified in an amplification system containing labeled bases to obtain;

[0031] The amplification system contains a labeled base but does not contain a base complementary to the connecting base.

[0032] In the present invention, the purpose of connecting bases is to block the synthesis of complementary pairing regions of the target sequence to be detected of the detection probe during labeling. The connecting bases can be one, two or more, but cannot contain four bases of A, T, C, and G at the same time. When using different template primers for polymerized amplification, different substrates can be used according to the bases of the region to be labeled in the primers. For example, when the region to be labeled contains A, C, and G (i.e., the connecting base is T), the amplification system can only contain the corresponding complementary base substrates T, G, and C and their markers. Of course, the bases of the region to be labeled do not necessarily have to be three bases, but fewer types may easily form secondary structures, affecting its amplification efficiency.

[0033] The complementary pairing region of the detection probe chain label region on the template probe chain is a random sequence at one end, which cannot contain a connecting base, but needs to contain multiple bases other than the connecting base. For example, when the connecting base is C, this region needs to contain multiple bases G, A, and T.

[0034] In the present invention, biotin labeling and digoxigenin labeling are the two most commonly used labels.

[0035] The preparation and detection principle of the probe of the present invention are as follows Figure 1 shown.

[0036] Example 1

[0037] The present invention provides a method for preparing a highly sensitive probe, comprising the following steps:

[0038] S1. Synthesize a detection probe miRGUS, the 5' end of the probe contains 21 bases that are complementary to the sequence to be detected, the 3' end contains 19 bases that are complementary to the template probe, and the 3' end and the 5' end are connected by base C, specifically: 5'(AGAGCTGATAGCGCGTGACAA)C(AG GAACGGTGCACAGGCAC)3', as shown in SEQ ID NO:1.

[0039] S2, synthesize a template probe, the 3' end of which is a sequence complementary to the 3' end of the detection probe, and the 5' end is a random sequence containing multiple Gs, A's, and T's but no base C, specifically: 5'(GAGGGAGAGGGTAGGAGGGTGGTGGTGTGGGATGTGTAT)(TGTGCCTGTGCACCGTTCCT)3', as shown in SEQ ID NO:2.

[0040] S3, the detection probe synthesized in step S1 and the template probe synthesized in step S2 are mixed in equal amounts and then annealed, and the two probes form a partially double-stranded probe precursor according to the complementary pairing of their 3' terminal bases.

[0041] The reaction system during annealing is: 5 μL of 10 mM detection probe, 5 μL of 10 mM template probe, a total of 10 μL, and the final concentration of the detection probe and template probe is 5 mM.

[0042] The annealing procedure was as follows: keep at 70°C for 5 min, cool to 25°C at a cooling rate of 0.1°C / s, and keep at this temperature for 5 min.

[0043] S4, the partially double-stranded probe precursor obtained in step S3 is subjected to the action of T4 DNA polymerase, with the 5' base sequence of the template probe as a template, and dATP, dTTP and biotin-dCTP labeled with biotin as substrates, to synthesize a labeled probe containing multiple biotin groups toward the 5' end of the template probe. Since dGTP is not added to the substrate, the base C connected in the 5' of the detection probe blocks the synthesis toward the 5' direction of the detection probe during the synthesis process, thereby ensuring the single-stranded state of its 5' end.

[0044] The amplification system was: 1 μL T4 DNA polymerase, 2 μL annealed probe primer, 1 μL 10×Buffer 2.1, 1 μL 1 mM dATP, 1 μL 1 mM dTTP, 1 μL 1 mM biotin-dCTP, and 3 μL ddH2O. The reaction conditions were: incubation at 25°C for 10 min and at 37°C for 1 h.

[0045] Wherein, 10X Buffer 2.1 and T4 DNA polymerase can be reagents in T4 DNA polymerase (NEB#M0203L) from NEB;

[0046] dATP and dTTP can be reagents in the dNTP set (#N0446S) from NEB;

[0047] Biotin-16-dCTP can be a reagent from jena bioscience, product number NU-809-BIO16-S.

[0048] Example 2

[0049] The embodiment of the present invention provides a method for preparing a high-sensitivity probe, which is different from Example 1 in that the detection probe synthesized in step S1 is miR166, specifically: 5'(GGGGAATGAAGCCTGGTCCGA)C(AGGAACGGTGCACAGGCAC)3', as shown in SEQ ID NO:3.

[0050] Example 3

[0051] The embodiment of the present invention provides a method for preparing a high-sensitivity probe, which is different from Example 1 in that the detection probe synthesized in step S1 is yeastU6, specifically: 5'(TATGCAGGGGAACTGCTGAT)C(AGGAACGGTGCACAGGCAC)3', as shown in SEQ ID NO:4.

[0052] Example 4

[0053] The embodiment of the present invention provides a method for preparing a high-sensitivity probe, which is different from Example 1 in that the detection probe synthesized in step S1 is plantU6, specifically: 5'(AGGGGCCATGCTAATCTTCTC)C(AGGAACGGTGCACAGGCAC)3', as shown in SEQ ID NO:5.

[0054] Example 5

[0055] The embodiment of the present invention provides a method for preparing a high-sensitivity probe, which is different from Example 4 in that the detection probe synthesized in step S1 is plantU6, specifically: 5'(AGGGGCCATGCTAATCTTCTC)TT(AGGCGCTCACTGTCCCAGT)3', as shown in SEQ ID NO:6, the template probe is: 5'(GCGAGCGGAGCGCGGAGCGGAGAGCGAGGAGGCGAGGAGA)(ACTG GGACAGTGAGCGCCT)3', as shown in SEQ ID NO:7, and dGTP, dTTP and biotin-dCTP labeled with biotin are used as substrates.

[0056] Example 6

[0057] The embodiment of the present invention provides a method for preparing a high-sensitivity probe, which is different from Example 5 in that the detection probe synthesized in step S1 is miR156, specifically: 5'(GTGCTCACTCTCTTCTGTCA)TT(AGGCGCTCACTGTCCCAGT)3', as shown in SEQ ID NO:8.

[0058] The probe prepared in Example 1-2 and the single-stranded probe containing one labeled base in the prior art were used for labeling detection at the same time. The detection results are as follows: Figure 2 As shown;

[0059] The probe prepared in Example 3-4 and the probe labeled with a radioactive isotope were used for labeling detection at the same time. The detection results are as follows: Figure 3 shown.

[0060] The detection results of the probe prepared in Example 5 are as follows Figure 4 shown.

[0061] from Figure 2 , 3 It can be seen that the detection sensitivity of the probe used in the present invention is much higher than that of the biotin-labeled probe in the prior art, and can basically reach the sensitivity of the radioactive isotope-labeled probe.

[0062] It is necessary to point out that the above embodiments are limited to further elaboration and explanation of the technical solution of the present invention, and are not further limitations of the technical solution of the present invention. The method of the present invention is only a preferred implementation scheme, and is not used to limit the protection scope of the present invention. Any modification, equivalent substitution, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for preparing a high-sensitivity probe, characterized in that: The following steps are involved: S1, synthesize a detection probe The detection probes are miRGUS, miR166, yeastU6, and plantU6, wherein the nucleotide sequence of miRGUS is shown in SEQ ID NO: 1, the nucleotide sequence of miR166 is shown in SEQ ID NO: 3, the nucleotide sequence of yeastU6 is shown in SEQ ID NO: 4, and the nucleotide sequence of plantU6 is shown in SEQ ID NO: 5 or SEQ ID NO: 6; S2, synthesizing a template probe, wherein the 3' end of the probe is a sequence complementary to the 3' end of the detection probe, and the 5' end is a random sequence at one end, including multiple G, A, T, but not including base C; when the nucleotide sequence of the detection probe is as shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, the nucleotide sequence of the template probe is as shown in SEQ ID NO:2; when the nucleotide sequence of the detection probe is as shown in SEQ ID NO:6, the nucleotide sequence of the template probe is as shown in SEQ ID NO:7; S3, the detection probe synthesized in step S1 and the template probe synthesized in step S2 are mixed in equal amounts and then annealed, and the two probes form a partially double-stranded probe precursor according to the complementary pairing of their 3' terminal bases; wherein the reaction system during annealing is: 5 μL of 10 mM detection probe, 5 μL of 10 mM template probe, a total of 10 μL, and the final concentration of the detection probe and the template probe is 5 mM; the annealing program is: keep at 70°C for 5 minutes, cool to 25°C at a cooling rate of 0.1°C / s, and keep warm for 5 minutes; S4, the partially double-stranded probe precursor obtained in step S3 is subjected to the action of T4 DNA polymerase, with the 5' base sequence of the template probe as a template, and dATP, dTTP and biotin-dCTP labeled with biotin as substrates, to synthesize a labeled probe containing multiple biotin groups toward the 5' end of the template probe. Since dGTP is not added to the substrate, the connecting base C in the 5' of the detection probe blocks the synthesis toward the 5' direction of the detection probe during the synthesis process, thereby ensuring the single-stranded state of its 5' end; The amplification system was: 1 μL T4 DNA polymerase, 2 μL annealed probe primer, 1 μL 10×Buffer 2.1, 1 μL 1 mM dATP, 1 μL 1 mM dTTP, 1 μL 1 mM biotin-dCTP, 3 μL ddH2O, and the reaction conditions were: incubation at 25°C for 10 min and incubation at 37°C for 1 h.

2. A highly sensitive probe, characterized in that: Prepared by the method of claim 1.

3. Use of the high-sensitivity probe according to claim 2 in the preparation of nucleic acid detection reagents.

Images