Application of NLRC3 as a target in the preparation of drugs for treating secondary infection of sepsis

Abstract

The present invention relates to the field of biomedical technology, and in particular to the use of NLRC3 as a target in the preparation of drugs for treating secondary infections of sepsis. The present invention provides the use of a myeloid NLRC3 inhibitor or a macrophage-specific NLRC3 inhibitor in the preparation of drugs for treating / alleviating secondary infections of immunosuppression in septic mice, wherein the NLRC3 inhibitor has the function of blocking myeloid NLRC3. The present invention has found that in a septic mouse model, downregulation of myeloid-specific or macrophage-specific NLRC3 can improve the body's ability to clear bacteria and the survival rate during secondary infections of septic immunosuppressed hosts. This provides a new and effective gene therapy method for the treatment of such patients, and has good application prospects in improving the survival rate of secondary infections of septic hosts.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the use of NLRC3 as a target in the preparation of a drug for treating secondary infection of sepsis. Background Art

[0002] Sepsis is a clinical syndrome characterized by life-threatening organ dysfunction caused by host immune dysregulation against infection. It has always been the leading cause of death in intensive care units. Currently, there is no effective treatment other than traditional fluid resuscitation, anti-infection, and symptomatic support. Therefore, developing new strategies to prevent and treat sepsis remains a difficult problem that needs to be overcome.

[0003] Studies have shown that the vast majority of surviving sepsis hosts show immunosuppression for several days or even weeks after the onset of the disease. During this period, the host is very likely to develop secondary infections and increase mortality. However, most secondary infection pathogens are multi-drug resistant bacteria, which greatly increases the difficulty of infection control. Therefore, controlling secondary infections in immunosuppressed hosts with sepsis may be an important way to reduce the mortality rate of sepsis.

[0004] Currently, immune cell dysfunction is considered to be an important pathogenesis of sepsis secondary infection. Monocytes / macrophages are the most important of these immune cells. They have the functions of identifying, ingesting and killing invading microorganisms, releasing pro-inflammatory mediators and presenting antigens. Their functional inactivation will make the body unable to timely and effectively identify, ingest and eliminate pathogens, thereby inducing the body to suffer from secondary infection. At present, there is a lack of effective medical methods in the existing technology to reduce the incidence of sepsis secondary infection. Therefore, exploring new treatment methods for monocytes and macrophages may be a potentially valuable strategy for preventing and treating secondary infection in immunosuppressed hosts in sepsis.

[0005] NOD-like receptor family protein 3 (NLRC3) is a newly discovered cytoplasmic protein encoded by a gene on chromosome 16 that is highly conserved in evolution and mainly expressed in immune cells such as monocytes / macrophages and T cells. It can reduce the immune activity of CD4+T cells and macrophages. However, there is currently no evidence that NLRC3 can be used as a therapeutic target for sepsis. Summary of the invention

[0006] In view of this, the technical problem to be solved by the present invention is to provide an application of NLRC3 as a target in the preparation of a drug for treating secondary infection of sepsis.

[0007] The present invention provides use of an NLRC3 inhibitor in preparing a drug for treating and / or improving secondary infection of sepsis.

[0008] In the present invention, the treatment and / or improvement includes: improving the survival rate and / or improving the ability to eliminate pathogens.

[0009] In the present invention, the pathogens include pathogens of sepsis secondary infection, including pathogenic fungi and / or pathogenic bacteria. In some embodiments, Pseudomonas aeruginosa is used to verify the ability of NLRC3 inhibitors to eliminate pathogens.

[0010] Specifically, the pathogen elimination includes eliminating pathogens in peripheral blood and / or lungs.

[0011] The NLRC3 inhibitor of the present invention is preferably an inhibitor targeting myeloid cell NLRC3, more specifically, an inhibitor targeting macrophage NLRC3.

[0012] The present invention discloses the role of targeted downregulation of macrophage NLRC3 expression in sepsis immunosuppression and secondary infection. The basis includes two aspects. On the one hand, NLRC3 expression in mononuclear macrophages is elevated and is closely related to sepsis host immunosuppression and secondary infection. On the other hand, myeloid-specific NLRC3 knockout or targeted downregulation of macrophage NLRC3 expression can alleviate immunosuppression and secondary infection in septic mice.

[0013] The present invention also provides a drug for treating and / or improving secondary infection of sepsis, which comprises an NLRC3 inhibitor.

[0014] In some embodiments, the NLRC3 inhibitor includes any one of the following I) to III):

[0015] I), reagents for knocking out or knocking down NLRC3;

[0016] II), agents that inhibit NLRC3 activity;

[0017] III), substances that increase the level or activity of NLRC3 inhibitors.

[0018] In some specific embodiments, the NLRC3 inhibitor is siRNA of NLRC3, and its nucleic acid sequence is shown in SEQ ID NO:1.

[0019] In some specific embodiments, the NLRC3 inhibitor is shRNA of NLRC3, and its nucleic acid sequence is shown in SEQ ID NO:5.

[0020] In a specific embodiment, the drug of the present invention includes a diluent and a lentiviral vector carrying shRNA of NLRC3; the backbone vector of the lentiviral vector is a pHBAAV series vector.

[0021] Furthermore, the NLRC3 inhibitor in the drug of the present invention is an inhibitor targeting myeloid cells. More specifically, the NLRC3 inhibitor in the drug of the present invention is an inhibitor targeting macrophages. In the present invention, the inhibitor is a lentiviral vector or an adenovirus or adeno-associated virus vector, which contains a macrophage-specific promoter. In some specific embodiments, the pHBAAV series vector includes: a nucleic acid sequence such as a fragment shown in SEQ ID NO: 5, a macrophage-specific promoter SP146, an AAV fragment and a CMV promoter.

[0022] In the present invention, the dosage form of the drug is an injection, which includes an injection solution and / or an injection powder. The diluent is selected from PBS buffer. The concentration of the virus particles is 0.05×10 10 / μL~0.05×10 12 In some specific embodiments, the concentration of virus particles in the drug is 0.05×10 11 Pieces / μL.

[0023] The present invention also provides a method for treating and / or improving secondary infection of sepsis, which comprises administering the drug of the present invention.

[0024] The present invention provides the use of a macrophage NLRC3 inhibitor in the preparation of a method for treating / alleviating secondary infection of immunosuppression in septic mice, wherein the NLRC3 inhibitor has the function of blocking macrophage NLRC3. The present invention also found that in a septic mouse model, myeloid-specific NLRC3 knockout or macrophage NLRC3 inhibitor can improve the body's ability to clear pathogens and the survival rate of the host with secondary infection in septic immunosuppression. This provides a new and effective treatment method for the treatment of such patients, and has good application prospects in improving the survival rate of secondary infection in septic hosts. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Shows NLRC3 expression in monocytes of patients with sepsis (left) and the area under the curve (AUC) of NLRC3 expression in predicting secondary infection in sepsis (right);

[0026] Figure 2 The survival curve of myeloid-specific NLRC3 knockout in septic mice secondary to Pseudomonas aeruginosa (PA) infection is shown;

[0027] Figure 3 Shown are TNF-α, IL-6, and IL-1β in lung homogenate after secondary bacterial infection in myeloid-specific NLRC3 knockout mice (A), and bacterial load in lung homogenate and peripheral blood (B);

[0028] Figure 4A is a schematic diagram of the macrophage-specific NLRC3 gene downregulation vector, B and C are the GFP fluorescence intensity of alveolar macrophages and lung macrophages after AAV vector transfection; D is the sequence information of Mir30-Nlrc3;

[0029] Figure 5 Figure 3 shows NLRC3 expression in alveolar macrophages (AMs), lung macrophages (LMs) and alveolar epithelial cells (LECs) of mice infected with macrophage-specific NLRC3 gene downregulation vector (A), survival curve of mice after secondary infection with Pseudomonas aeruginosa (PA) (B), bacterial load in lung homogenate and peripheral blood (C), and TNF-α, IL-6 and IL-1β in lung homogenate (D);

[0030] Figure 6 Shown is the AAV2 / 9-SP146-mir30-m-Nlrc3-GFP plasmid map. DETAILED DESCRIPTION

[0031] The present invention provides the use of NLRC3 in the preparation of a drug for treating secondary infection of sepsis. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0032] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below in conjunction with the embodiments:

[0033] Example 1 Role of NLRC3 expression in peripheral blood of patients with sepsis in predicting secondary infection in the host

[0034] Study population: Critically ill patients admitted to the comprehensive ICU of Union Hospital affiliated to Tongji Medical College of Huazhong University of Science and Technology were selected. Whether they were diagnosed with sepsis was determined according to the Sepsis3.0 diagnostic criteria; sepsis inclusion criteria: ① met the diagnostic criteria for sepsis in Sepsis3.0, ② age ≥ 18 years old; exclusion criteria: ① age < 18 years old; ② uncooperative patients with mental illness; ③ patients with incomplete clinical data. Peripheral blood was collected from immunosuppressed patients with sepsis. 35 patients were included in this study.

[0035] Table 1 Demographic and clinical characteristics of patients with sepsis

[0036]

[0037]

[0038] Notes: ICU, intensive care unit; IQR, interquartile range; SOFA, sequential organ failure assessment; SD, standard deviation; unless otherwise specified, data are expressed as counts (%).

[0039] The study protocol was approved by the Medical Ethics Committee of our institution. Peripheral blood was collected 9 (7-12) days after the onset of sepsis. Among them, 19 patients developed secondary infection. The proportion of male patients in the sepsis immunosuppression secondary group was 47.4 (9 cases), and the average age was 64.0±13.8 years. Within 2 hours after blood collection, peripheral blood mononuclear cells (PBMCs) were separated by density gradient centrifugation, and PBMCs were prepared into cell suspensions in PRMI-1640 medium (Invitrogen, USA) containing 10% fetal bovine serum (Millipore, USA), and then inoculated in plastic dishes and incubated at 37°C, CO2 incubator for 60 min; non-adherent cells (lymphocytes) were aspirated and discarded, and adherent monocytes were retained; the level of NLRC3 in monocytes was detected by real-time PCR, and total monocyte RNA was extracted, purity was identified, and RNA concentration was determined. Reverse transcription was performed to synthesize cDNA, and PCR reaction was performed using cDNA as a template (forward primer: 5'-gtgccgaccgactcatctg-3', reverse primer: 5'-gtcctgcactcatccaagc-3'). The reaction conditions are shown in Table 2.

[0040] Table 2 RT-PCR reaction conditions

[0041] Step Step 1: 95.0℃for 30s Step 2: 95.0℃for 10s Step 3: 60.0℃for 30s +plate Read Step 4: GOTO Step 2,39 more times Step 5: 95.0℃for 10s Step 6: Melt curve 65.0℃to 95.0℃ END

[0042] The general clinical characteristics of the patients were recorded, such as age, gender, sepsis infection focus, time from onset to sample collection, sequential system failure assessment (SOFA), pathogen type, underlying disease, total length of hospital stay, length of stay in the ICU, etc. The patients were divided into sepsis secondary infection group and sepsis non-secondary infection group according to whether they had secondary infection. Secondary infection refers to a new infection that occurs in critically ill patients 48 hours after admission to the ICU. Stata / IC 15.1 software was used for statistical analysis, and GraphPadPrism8.0 software was used for drawing.

[0043] Results: The general clinical data of the patients are shown in Table 1. Compared with the non-secondary infection group, the expression level of NLRC3 in peripheral blood mononuclear cells of patients with secondary infection of sepsis was significantly increased ( Figure 1 (A) According to the expression level of NLRC3 in peripheral blood monocytes, the ROC curve was drawn. Figure 1As shown in B, the area under the curve (AUC) reflects the predictive efficacy (AUC = 0.5, no predictive efficacy; 0.5 < AUC < 0.7, very little predictive value; 0.7 < AUC < 0.9, relatively accurate predictive value; 0.9 < AUC < 1, more accurate predictive value). The AUC value of NLRC3 in peripheral blood mononuclear cells this time was 0.82. This indicates that NLRC3 in peripheral blood mononuclear cells has good predictive value for secondary sepsis infection;

[0044] Example 2 Effect of Myeloid-Specific NLRC3 Knockout on the Survival Rate of Mice with Secondary Infection in Sepsis Mice

[0045] Using myeloid cell-specific NLRC3 knockout mice (i.e., LysM Cre NLRC3 fl / fl , abbreviated as NLRC3 ΔMac ) and their littermate wild-type or LysM-Cre - / - NLRC3 fl / fl mice as controls (i.e., NLRC3 fl / fl , abbreviated as NLRC3 WT );

[0046] The method for constructing myeloid cell-specific NLRC3 gene knockout mice provided by the present invention includes the following steps: (1) Determine the target site of the gene to be knocked out in the mouse. First, analyze the structure of the NLRC3 gene and find that exon2-3 can be conditionally knocked out; design sgRNAs for the NLRC3 gene in the target site region. After verification and screening, it is found that the two sgRNAs, sgRNA#5 and sgRNA#14, have stable effects, and their sequences are shown in SEQ ID No: 8 and SEQ ID No: 9 respectively, and proceed to the next experiment.

[0047] Table 3

[0048] Guide 5‘→3’ (3')sgRNA#5 CAACATGATTACACACAAGTCCAGG(SEQ ID NO:6) (3')sgRNA#14 TTGGTTCAGAGTATGGCTGAGGG(SEQ ID NO:7)

[0049] ⑵ Co-inject or co-electroporate the active sgRNA with Cas9 mRNA or Cas9 Protein into the cytoplasm or nucleus of mouse fertilized eggs, and transplant the fertilized eggs into recipient female mice for pregnancy to obtain F0 generation conditional NLRC3 gene knockout mice; (3) Hybridize the F0 generation NLRC3 gene knockout mice with Cre LysM mice (purchased from Jackson Laboratory, USA) to obtain F1 generation LysM-Cre + / - NLRC3 loxp+ / - ; Then self-cross the F1 generation to obtain F2 generation: LysM-Cre + / - NLRC3 loxp / loxp / + / +Mice, namely myeloid cell-specific NLRC3 knockout mice (i.e., LysM Cre NLRC3 fl / fl , abbreviated as NLRC3 ΔMac ) and wild-type littermates or LysM-Cre - / - NLRC3 fl / fl Mice were used as control (i.e., NLRC3 fl / fl Abbreviated as NLRC3 WT );

[0050] Cecal ligation and puncture (CLP) sepsis model and sham operation (sham) model were constructed. In CLP model, 4-0 silk thread was used to ligate and puncture the cecum at 1 / 2 of the ileocecal valve after exposure, while in Sham group, only exposure was performed without puncture. 48 hours after surgery, Pseudomonas aeruginosa (PA) was instilled into the surviving mice through the trachea to simulate secondary lung infection after sepsis. The survival rate of mice in each group was observed for 10 days.

[0051] Figure 2 The results showed that downregulation of NLRC3 significantly improved the survival rate of septic mice when they were secondary to bacterial (PA) infection.

[0052] Example 3 Effect of myeloid-specific NLRC3 knockout on secondary lung bacterial clearance in septic mice

[0053] The sepsis mouse model and secondary infection were constructed according to the method of Example 2. 24 hours after bacterial infection, anesthesia was performed by intraperitoneal injection of 2% sodium pentobarbital in an SPF sterile operating room, and peripheral venous blood was collected under sterile conditions. At the same time, the right lung tissue was taken and ground on ice until the lung tissue block was completely ground to prepare lung homogenate; the levels of IL-1β, IL-6 and TNF-α in the tissue grinding fluid were detected by enzyme-linked immunosorbent assay (ELISA); lung homogenate and peripheral blood were taken, and 100 μl was inoculated on an agar plate after 10-fold serial dilution. The number of colonies was counted after 18-24 hours to detect the bacterial load in peripheral blood and lung homogenate.

[0054] Figure 3 Middle A and Figure 3 As shown in B, the NLRC3 WT Compared with mice, NLRC3 ΔMac The bacterial load in the lung homogenate and peripheral blood of the septic mice in the group after secondary infection was significantly reduced, which suggests that silencing NLRC3 in myeloid cells can significantly enhance the bacterial clearance ability of septic mice.

[0055] Example 4 Construction of adeno-associated virus vector for downregulation of macrophage NLRC3 driven by macrophage-specific promoter

[0056] In order to improve the safety and effectiveness of NLRC3 downregulation in the treatment of secondary infection in immunosuppressed hosts with sepsis, an adeno-associated virus (AAV) vector carrying a mouse macrophage-specific promoter that can downregulate the expression of macrophage NLRC3 gene was constructed. First, based on the gene sequence of mouse NLRC3 (NM_001081280) in GenBank and the results of preliminary experiments, the siRNA sequence GAGAACCACGGTCTGCACCATATTA (SEQ ID NO: 1) with high interference efficiency was selected as the NLRC3 interference target; then, based on the sequence information of the macrophage-specific promoter SP146-promotor reported in the literature. A macrophage-specific promoter AAV vector was constructed, and the sequence information of SP146-promotor is as follows:

[0057] CTAGCGAGGGCGGACCAGAAAAGGAGAAGTAGGAGCCAAGATTTCCAAACTCTGTGGTTGCCTTGCCAAGATTTCCAAACTCTGTGGTTGCCTTGCAGAAAAGGAGAAGTAGGAGAAGCGACTTCCTCTTCCAGAAGCGACTTCCTCTTTCCAGAGGAAGAGGGCGGAGGCTCACAAGGCAACCACAGAGTTTGGAAATCTTGGAAGCGA CTTCCTCTTTCCAGCAGAAAAGGAGAAGTAGGAGAAGCGACTTCCTTCTTTCCAGGTCCGCCCTCGCAAGCCTGAAGAGTCCCCAGAAACTGAAAGAAGAAGCAAAGCCCTTTCTGTACCCTCCCTGCCCCCTGTCCCGACCGCGACAAAAGCGACTTCCTCTTTCCAGTGCATTTAAGGCGCAGCCTGGAAGTGCCAGGGAGCACTG(SEQ ID NO:2)

[0058] The relevant primers were designed as follows for the XbaI / EcoRI restriction site of pHBAAV-U6-MCS-CMV-EGFP vector, and the promoter U6 was replaced by SP146 according to the instructions of the kit;

[0059] Table 4 SP146 amplification primers

[0060]

[0061] Then, according to the characteristics of RNAi and the characteristics of overexpression of SP146 promoter, the mir30 structure was constructed to effectively interfere with macrophage NLRC3. The sequence information of mir30-Nlrc3 is as follows: The plasmid schematic diagram is as follows Figure 4 Middle A,

[0062]

[0063] like Figure 4 As shown in D, Note: Green shading: basalstem; Blue shading: loop;

[0064] Double underline: sense strand; wavy line: antisense strand.

[0065] In this step, firstly, the relevant primers were designed for the BamHI / EcoRI restriction site of pHBAAV-146-MCS-CMV-EGFP vector as follows:

[0066] Table 4 mir30-Nlrc3 primers

[0067]

[0068] According to the kit instructions and the following system, amplification was performed to construct double-stranded fragments with sticky ends.

[0069] Component volume 10×PCR Buffer for KOD plus 10mM MgSO4(25mM) 50mM dNTPs(2mM) 1μl Forward primer (10μM) 1μl Reward primer (10μM) 14μl KOD plus DNA polymerase 1μl Plasmid template (10pg-200ng) <![CDATA[H2O]]> Up to 50μl Total volume 20μl

[0070] Using the seamless cloning kit instructions, mir30-Nlrc3 was connected into the vector pHBAAV-146-MCS-CMV-EGFP to reconstruct the NLRC3 RNAi plasmid:

[0071] The constructed AAV2 / 9-SP146-mir30-m-Nlrc3-GFP vector ( Figure 6 , shuttle plasmid), auxiliary vector pHelper and pAAV-RC vector, a transfection complex (as shown below), was added to 293 cells in good condition to complete virus packaging.

[0072] Component volume pAAV-RC Plasmid 10 μg pHelper Plasmid 20 μg Shuttle Plasmid 10 μg LipofiterTM 120μL Total volume 40μl

[0073] Finally, SPF-grade 4-5-week-old male C57BL / 6J mice weighing 17-20 g were randomly divided into AAV-ctrl-shRNA (control group) and AAV-SP-shNLRC3 group (test group) after 2-3 days of adaptive culture;

[0074] The control group mice were given AAV virus containing siRNA control sequence (TTCTCCGAACGTGTCACGTAA) (AAV-ctrl-shRNA); the test group was given AAV virus packaged with mir30-shNlrc3 vector (AAV-SP-shNLRC3). Under sterile conditions, 20 μL of PBS (containing 1×10 11 On the 28th day after AAV injection, the GFP expression level of infected lung tissue macrophages was detected by flow cytometry. At the same time, alveolar macrophages (AMs), lung macrophages (LMs) and alveolar epithelial cells (LECs) were extracted; RNAiso Plus was added to extract total RNA, which was reversed into cDNA, and the expression of NLRC3 mRNA was detected by Real-time PCR system; NLRC3 was successfully downregulated and used for experimental grouping ( Figure 4 );

[0075] Example 5 Effect of gene therapy targeting lung macrophages on secondary infection in septic mice

[0076] AAV-ctrl-shRNA and AAV-SP-shNLRC3 mice treated according to the method of Example 4 were selected, and a mouse model of sepsis and secondary infection was constructed according to the method of Example 2; after bacterial infection, the survival rate of each group of mice was observed for 10 days, and the levels of IL-1β, IL-6 and TNF-α in the lung homogenate 24 hours after bacterial infection were observed according to the methods in Examples 2 and 3; as well as the bacterial load in peripheral blood and lung homogenate.

[0077] Figure 5 Middle A and Figure 5 As shown in B, compared with AAV-ctrl-shRNA mice, the bacterial load in the lung homogenate and peripheral blood of AAV-SP-shNLRC3 septic mice after secondary infection was significantly reduced; the survival rate was significantly increased.

[0078] In summary: Gene therapy targeting lung macrophages can enhance the bacterial clearance ability of septic mice during secondary infection and improve the survival rate of septic mice with secondary infection.

[0079] The present invention provides a new idea and intervention target for the treatment of sepsis, that is, blocking NLRC3 in lung macrophages can improve the survival rate of sepsis immunosuppressant mice during secondary infection, thereby laying a foundation for the formulation of new intervention measures for sepsis and subsequent clinical applications.

[0080] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of NLRC3 inhibitors in the preparation of drugs for treating and / or improving secondary infections of sepsis; The NLRC3 inhibitor is siRNA of NLRC3, and its nucleic acid sequence is shown in SEQ ID NO: 1; Or the NLRC3 inhibitor is shRNA of NLRC3, and its nucleic acid sequence is shown in SEQ ID NO:

5.

2. The use according to claim 1, characterized in that: The treatment and / or improvement include: improving the survival rate and / or improving the ability to eliminate pathogens.

3. The use according to claim 2, characterized in that: The improving the pathogen elimination capability includes improving the ability to eliminate Pseudomonas aeruginosa.

4. The use according to claim 2 or 3, characterized in that: The pathogen elimination includes eliminating pathogens in peripheral blood and / or lungs.

5. The use according to claim 1, characterized in that: The medicine comprises a diluent and an adeno-associated virus vector carrying shRNA of NLRC3; the backbone vector of the adeno-associated virus vector is a pHBAAV series vector.

6. The use according to claim 5, characterized in that: The pHBAAV series vectors include: a nucleic acid sequence fragment as shown in SEQ ID NO: 5, a macrophage-specific promoter SP146, an AAV fragment and a CMV fragment.

Images