An adeno-associated virus mutant that efficiently infects ht-22 cells

By constructing an AAV9 peptide mutant library, AAV9 mutants with inserted heterologous peptides were screened, which solved the problem of low infection efficiency of wild-type AAV9 in HT-22 cells, achieving high-efficiency infection and cost savings, and supporting gene therapy research on central nervous system diseases.

CN115991743BActive Publication Date: 2026-03-17OBIO TECH (SHANGHAI) CORP LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-13
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

The existing AAV9 wild-type serotype has low efficiency in infecting HT-22 cells, resulting in large viral loads in in vitro studies and affecting cell state, which makes it difficult to meet the gene therapy needs of central nervous system diseases.

Method used

A peptide mutant library of AAV9 was constructed, and AAV9 serum capsid protein mutants with inserted heteropeptides were obtained through screening. Specifically, a polypeptide with the amino acid sequence SVADRMY was inserted at positions 588-589. Nucleic acid molecules and nucleic acid vectors were constructed, and AAV9 mutants that could efficiently infect HT-22 cells were screened.

Benefits of technology

Under the condition of MOI=1E+5, the mutant AAV9-HT01 significantly improved infection efficiency, increased the positive infection rate by 4.4 times, reduced the amount of virus used, saved experimental costs, and supported gene therapy research on central nervous system diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115991743B_ABST
    Figure CN115991743B_ABST
Patent Text Reader

Abstract

This invention relates to the packaging and screening of viral vectors, particularly to the packaging and screening of AAV mutants, specifically an adeno-associated virus mutant that efficiently infects HT-22 cells. By constructing a peptide mutant library of AAV9, a new AAV9 mutant with seven inserted amino acids was obtained through screening and verification. This mutant can effectively infect HT-22 cells at an MOI of 1E+5, achieving a higher infection rate than the natural AAV9 serotype at MOI=1E+5. The AAV9-HT01 mutant obtained after screening showed the best effect, with a significantly higher infection positivity rate compared to the control AAV9 serotype under the same MOI conditions. The fold increase was 4.4-fold as measured by luciferase (RLU) value detection. This effectively reduces the amount of AAV cells used for infection, saving experimental costs, and simultaneously makes it feasible to study the mechanisms of gene therapy for central nervous system diseases in HT-22 cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the packaging and screening of viral vectors, and more particularly to the packaging and screening of AAV mutants, specifically an adeno-associated virus mutant that efficiently infects HT-22 cells. Background Technology

[0002] Central nervous system (CNS) diseases seriously affect patients' physical and mental health and quality of life. Due to the complexity of the CNS itself and the blood-brain barrier (BBB) ​​which hinders drug delivery, it remains difficult to treat neurological diseases with commonly used surgical or traditional drugs. Therefore, scientists in various fields are currently studying the feasibility of gene therapy-based treatments for neurological diseases.

[0003] Adeno-associated virus (AAV) is a small, non-enveloped virus with an icosahedral structure, and is currently the simplest single-stranded DNA-deficient virus discovered. Due to its good safety profile, broad host cell range (dividing and non-dividing cells), low immunogenicity, and long duration of exogenous gene expression in vivo, it has gradually become an important platform for in vivo gene therapy delivery. However, the delivery efficiency of gene vectors is a significant obstacle to the development of AAV-mediated gene therapy for the central nervous system. Unlike other viral vectors, AAV's different capsid proteins can recognize different host cell surface receptors, enabling rAAV viral vectors to specifically infect different tissues. Therefore, many studies have used various cell lines, primary cells, mouse models, or non-human primate models to screen for AAV capsid proteins that can efficiently infect, i.e., AAV serotypes.

[0004] HT-22 cells are a mouse hippocampal neuronal cell line. This cell line is an excellent model for in vitro studies of glutamate toxicity and has been widely used in many neurodegenerative diseases, such as Alzheimer's Disease and Parkinson's Disease. Many researchers also use this cell line to conduct related in vitro mechanism studies. Our previous findings indicated that AAV9 wild-type serotype infection of HT-22 cells is inefficient, leading to the need for larger viral loads in in vitro studies. Furthermore, increasing the viral load can negatively impact cell state. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention designs and constructs an AAV9 peptide mutation library. Through library screening, AAV mutants that can efficiently infect the HT-22 cell line are obtained, so as to meet the needs of the HT-22 cell line for in vitro research applications.

[0006] This invention discloses an AAV9 serum-type capsid protein mutant with inserted heteropeptide;

[0007] The heteropeptide is a polypeptide whose amino acid sequence is SVADRMY (SEQ ID NO:12);

[0008] The heteropeptide is inserted between amino acids 588 and 589 of the AAV9 serum-type capsid protein.

[0009] This invention discloses a nucleic acid molecule encoding the above-mentioned AAV9 serum capsid protein mutant.

[0010] This invention discloses a nucleic acid vector that can operatively link the above-mentioned nucleic acid molecules.

[0011] This invention discloses a host cell containing the above-mentioned nucleic acid vector.

[0012] This invention discloses a composition or kit containing the above-mentioned AAV9 serum capsid protein mutant, nucleic acid molecule or nucleic acid vector.

[0013] This invention discloses the use of the above-mentioned AAV9 serum capsid protein mutant, nucleic acid molecule or nucleic acid vector in infecting HT-22 cells, wherein the use is for non-diagnostic and non-therapeutic purposes.

[0014] This invention discloses the use of the above-mentioned AAV9 serum capsid protein mutant, nucleic acid molecule or nucleic acid carrier in the preparation of drugs for treating central nervous system diseases.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] This technical solution constructs a peptide mutant library of AAV9 and, after screening and verification, obtains a new AAV9 mutant with 7 inserted amino acids. The mutant can effectively infect HT-22 cells at MOI=1E+5, achieving a higher infection effect than the natural AAV9 serotype at MOI=1E+5. The AAV9-HT 01 obtained after screening showed the best effect. Under the same MOI conditions, the infection positive rate was significantly improved compared to the control AAV9 serotype, with a fold increase of 4.4 times as measured by luciferase (RLU) value detection. This effectively reduces the amount of AAV-infected cells used, saves experimental costs, and makes it feasible to conduct gene therapy-related mechanism research on central nervous system diseases in HT-22 cells. Attached Figure Description

[0017] Figure 1This is a flowchart illustrating the expression pAAV-shortUBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA in Example 1;

[0018] Figure 2 The pAAV-shortUBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA-WPRE spectrum in Example 1;

[0019] Figure 3 Flowchart for building and filtering AAV9 libraries;

[0020] Figure 4 Fluorescence images of HT-22 cells infected with different serotypes in Example 2;

[0021] Figure 5 The graph shows the luciferin (RLU) values ​​of fireflies in HT-22 cells infected with different serotypes in Example 2. Detailed Implementation

[0022] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0023] Example 1: Construction of AAV97-mer random peptide insertion library:

[0024] The library consists of the following media:

[0025] Library shuttle: pAAV-short UBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA, such as Figure 1-2 As shown.

[0026] Example 2: AAV9 library construction and screening process:

[0027] By constructing a random mutant library of AAV9 peptides, novel AAV9 mutants with the insertion of 7 amino acids were screened, such as... Figure 3 As shown.

[0028] 1. Preparation of mutant libraries

[0029] 1.1 Chemical synthesis of the following two fragments of AAV9-7mer-NNS:

[0030] 5'CCACCAGAGTGCCCAANNSNNSNNSNNSNNSNNSGCACAGGCGCAG 3' (SEQ ID NO: 1);

[0031] 5'CGGTCTGCGCCTGTGCSNNSNNSNNSNNSNNSNNSNTTGGGCACTCTG 3' (SEQ ID NO: 2);

[0032] NNS represents a random encoded sequence.

[0033] 1.2 10 μL each of the synthesized AAV9-7mer-NNS positive and reverse strand primers (final primer concentration 10 mM) were added and annealed to obtain the AAV9-7mer-NNS template. The annealing program was: 95℃, 5 min; 95℃, 1 min; 92 min, 1 min; 4℃, 60 min. In steps two and three, the temperature was decreased by 3℃ for each cycle, for a total of 25 cycles.

[0034] 1.3 The plasmid pAAV-short UBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40 polyA (its structure and insertion site are as follows) was prepared. Figure 1 As shown in Table 1, BsmBI was used for single enzyme digestion. The digestion system (50 μL) is shown in Table 1.

[0035] Table 1

[0036]

[0037] After enzyme digestion at 55℃ for 4 hours, 1% agarose gel electrophoresis was performed. Large fragments were cut off under UV light and purified by blade.

[0038] 1.4 The purified enzyme digestion product obtained in step 1.3 and the AAV9-7mer-NNS nucleotide sequence obtained in step 1.2 were ligated using T4 DNA ligase. The ligation was performed using Takara's T4 DNA ligase, with a 10 μL reaction volume as shown in Table 2, and incubated overnight at 4°C.

[0039] Table 2

[0040]

[0041] 1.5 Add 10 μL of enzyme ligation product to 50 μL of library-specific electroporation competent cells (purchased from Lucigen), mix well, and transfer to a pre-cooled electrode cup. Electroporate using a Bio-Rad electroporator. After electroporation, add 1 mL of preheated SOC liquid culture medium at 37°C, and then thaw at 37°C for 1 hour before centrifugation and plating.

[0042] 1.6 Repeat steps 1.4-1.5 until the number of clones reaches 5 × 10⁻⁶. 11 .

[0043] 2. Library virus packaging and screening

[0044] 2.1 Packaging of AAV mutant library virus: 1.5 × 10⁻⁶ cells / plate 7 Two 293AAV packaging cells were seeded into 15cm cell culture dishes and cultured for 18-24 hours. Transfection could begin once the cells adhered. Using PEI transfection reagent, a pAAV-short UBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40 polyA–insertion expression vector library containing the AAV9-7mer-NNS insert fragment was packaged with a helper plasmid and transfected into 293AAV cells. 72 hours after transfection, the proportion of AAV-293 cells containing the vector library was counted under a fluorescence microscope to determine the viral packaging efficiency. After viral packaging was complete, the cells were repeatedly pipetted to completely detach them from the culture dish, and all cell samples were collected.

[0045] 2.2 Virus purification: The collected cell samples were repeatedly frozen and thawed at -80℃ and 37℃, centrifuged, and the cell supernatant was collected. Cell debris was removed using a 0.45μm PVDF filter. Subsequently, the collected recombinant AAV virus was purified using an AAV purification kit to obtain recombinant AAV virus.

[0046] 2.3 Determination of recombinant AAV virus titer: Take 20 μL of concentrated virus solution, add 1 μL of RNase-free DNase, mix well, incubate at 37℃ for 30 min, centrifuge at 10000 rpm for 10 min, take 20 μL of supernatant, add 80 μL of dilution buffer to another sterile tube, mix well, and react in a metal bath at 100℃ for 10 min. Allow to cool naturally to room temperature, add 3 μL of proteinase K, incubate at 37℃ for 60 min, react in a metal bath at 100℃ for 10 min, and cool to room temperature. Dilute the above sample and use it as a template to determine the recombinant AAV virus titer using real-time quantitative PCR. The qPCR reaction system and conditions are: 95℃, 10 min; 95℃, 30 s; 60℃, 30 s, 35 cycles.

[0047] 2.4 AAV virus infection of HT-22 (mouse hippocampal neurons):

[0048] 2.4.1 Cell Plating: HT-22 cells were seeded into 10cm cell culture dishes at a confluence of 40%, with a density of 5 × 10⁶ cells per dish. 6 The cells are plated into multiple cell culture dishes.

[0049] 2.4.2 Viral infection: HT-22 cells were infected with the virus from the pAAV-short UBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA–insertion expression vector library.

[0050] 2.5 Collect infected cells and perform fluorescence sorting using a flow cytometer. Select the cells with the highest red fluorescence intensity (top 5%) as the target cells for collection. After sorting and collecting, plate the cells into cell culture dishes, amplify them, and then collect the cells.

[0051] 2.6 After extracting the genome from the collected cells, PCR amplification was performed, and the PCR products were sequenced in high throughput.

[0052] Amplification primers:

[0053] AAV9-F: AACTACTAACCCGGTAGCAACGG (SEQ ID NO:3) (Forward primer on the vector)

[0054] For high-throughput sequencing of AAV9-R:CGTCCGTGTGAGGAATTTTGG (SEQ ID NO:4) (reverse primer on the vector), the primers used for adding adapter and index sequences are as follows:

[0055] NGS-AAV9-F:

[0056] TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAAACTACTAACCCGGTAGCAACGG(SEQ ID NO:5)

[0057] NGS-R1:

[0058] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGG CTAGCGAGTAATCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:6)

[0059] NGS-R2:

[0060] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGG CTAGTCTCCGGACGTCCGTGTGAGGAATTTTGG(SEQ ID NO:7)

[0061] NGS-R3:

[0062] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGG CTAGAATGAGCGCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:8)

[0063] NGS-R4:

[0064] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGG CTAGGGAATCTCCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:9)

[0065] NGS-R5:

[0066] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGG CTAGTTCTGAATTTCCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:10)

[0067] The expected sequencing sequence is:

[0068] AACTACTAACCCGGTAGCAACGGAGTCCTATGGACAAGTGGCCACAAACCACCAGAGTGCCCAANNSNNSNNSNNSNNSNNSNNSGCACAGGCGCAGACCGGCTGGGTTCAAAACCAAGGAATACTTCCGGGTATGGTTTGGCAGGACAGAGATGTGTACCTGCAAGGACCCATTTGGGCCAAAATTCCTCACACGGACG (SEQ ID NO: 11)

[0069] Analyzing the high-throughput sequencing results, the mutants with high frequency of occurrence were named AAV9-HTxx; for example, peptide 01 was named AAV9-HT01.

[0070] 3. Screening and validation of AAV9 mutants

[0071] 3.1 Construction of AAV9 mutant

[0072] Using the natural serotype AAV2 / 9 as a vector, candidate mutant fragments such as AAV9-HTxx were inserted at amino acid positions 588-589 to obtain new serotype vectors such as AAV9-HTxx. Based on the results of high-throughput sequencing, more than 30 mutants were constructed.

[0073] 3.2 Using the shuttle vector pAAV-CBh-mScarlet-P2A-Luc2, various mutant serotypes of AAV virus were obtained by packaging with AAV9-HTxx and other serotype vectors.

[0074] 3.3 The viral titers of the above viruses were determined using WPRE primers, and the expression of viral VP1, VP2, and VP3 was confirmed using coccidial assay.

[0075] 3.4 Viruses such as pAAV-CBh-mScarlet-P2A-Luc2 and AAV9-HTxx were analyzed at an MOI of 1×10⁻⁶. 5 HT cells were infected separately, and the infection results of five different mutant serotype peptides were selected. The fluorescence chromatograms at 72 h were compared with those of the control AAV9. Figure 4 As shown, the infection efficiency of the AAV9-HT01 mutant serotype virus was significantly higher than that of the control AAV9. Simultaneously, the luciferase (RLU) value of cells was detected using firefly luciferase assays. Figure 5 As shown, the infection efficiency of AAV9-HT 01 is higher than that of the control AAV9, with a 4.4-fold increase in RLU value compared to the control group AAV9. The AAV9-HT 01 obtained through screening showed the best results, with a significantly higher infection positivity rate compared to the control AAV9 serotype under the same MOI conditions, as indicated by a 4.4-fold increase in luciferase (RLU) value.

Claims

1. An AAV9 serotype capsid protein mutant into which a heterologous peptide is inserted, characterized in that, the heterologous peptide is a polypeptide consisting of an amino acid sequence of SVADRMY; the AAV9 serotype capsid protein has a sequence length of 736 amino acids; the heterologous peptide is inserted between the 588th and 589th amino acids of the AAV9 serotype capsid protein.

2. A nucleic acid molecule, characterized in that, a nucleic acid molecule encoding the AAV9 serotype capsid protein mutant of claim 1.

3. A nucleic acid vector into which the nucleic acid molecule of claim 2 is operably linked.

4. A host cell characterized in that, a nucleic acid vector of claim 3.

5. A composition or kit comprising the AAV9 serotype capsid protein mutant of claim 1, the nucleic acid molecule of claim 2, or the nucleic acid vector of claim 3.

6. Use of the AAV9 serotype capsid protein mutant of claim 1, the nucleic acid molecule of claim 2, or the nucleic acid vector of claim 3 for infecting HT-22 cells, for non-diagnostic and therapeutic purposes.

Citation Information

Patent Citations

  • Engineered adeno-associated virus capsids

    CA3148356A1

  • Recombinant adeno-associated virus particle containing variant AAV9 capsid protein

    CN114057840A