A molecular marker for detecting a premature senescence gene of a crop plant and use thereof
By detecting molecular markers of premature aging genes in crops, frameshift mutations of premature aging-related genes in crops such as rice can be identified, solving the problem of the lack of effective detection methods in existing technologies and realizing accurate detection of premature aging genes and anti-aging breeding.
Patent Information
- Application Number
- CN202210896698.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-28
- Publication Date
- 2026-05-12
- Estimated Expiration
- 2042-07-28
AI Technical Summary
The lack of effective molecular markers in current technologies for detecting crop premature aging genes leads to severe losses in crop production.
A molecular marker is provided for detecting premature aging genes in crops. The marker is verified by PCR amplification and sequencing of the genomic DNA of the sample to identify a frameshift mutation caused by a 4-base AACA deletion in the 11th exon of the LOC_Os03g31550 coding region.
It can accurately detect premature aging genes, predict whether crops will age prematurely, provide a molecular basis for breeding anti-aging crops, and improve crop yield and quality.
Smart Images

Figure CN115992278B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of crop breeding technology, and in particular to a molecular marker for detecting premature aging genes in crops and its application. Background Technology
[0002] Premature aging is a common phenomenon in agricultural production, causing significant losses to crops. For example, in rice, it manifests as yellowing and wilting of leaves, and even the entire plant withers and collapses. It significantly reduces the accumulation of dry matter in the grains, resulting in low grain fullness and high empty grain rate, ultimately hindering the realization of yield potential and leading to a decline in quality.
[0003] Some molecular markers related to premature aging have been discovered in existing technologies, but they are far from sufficient for molecular marker-assisted breeding of crops. Summary of the Invention
[0004] The purpose of this invention is to provide a molecular marker for detecting crop premature aging genes and its application, thereby filling the gaps in the prior art.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0006] This invention provides a molecular marker for detecting premature aging genes in crops. The forward sequence from the 5' end to the 3' end of the molecular marker is shown in SEQ ID NO.1, and the reverse sequence from the 3' end to the 5' end is shown in SEQ ID NO.2.
[0007] This invention also provides the application of the above-mentioned molecular markers for detecting crop premature aging genes in crop premature aging-related research.
[0008] Preferably, it is used to detect genes that cause premature aging in crops.
[0009] Preferably, it is used to predict whether crops will experience premature aging.
[0010] Preferably, the detection method includes the following steps:
[0011] The molecular markers for the crop premature aging gene described in claim 1 were used to amplify the genomic DNA of the sample by PCR to obtain PCR products;
[0012] The PCR product was sequenced. When the sequencing result is as shown in SEQ ID NO.3, it indicates that the sample is a seedling premature aging type.
[0013] Preferred for molecular-assisted breeding of anti-aging crops.
[0014] Preferably, the crop is a grass (Poaceae).
[0015] Preferably, the grass crop is rice, short-stalked grass, wheat, and / or goatgrass.
[0016] The technical effects and advantages of this invention are as follows:
[0017] The molecular markers provided in this invention for detecting premature aging genes in crops can detect a 4-base AACA deletion in the 11th exon of the LOC_Os03g31550 gene coding region, leading to a frameshift mutation and the formation of a premature aging-related gene. The presence of this premature aging-related gene in rice plants results in decreased uric acid content, increased harmful substances, and reduced enzyme activity; abnormal chloroplast ultrastructure and reduced photosynthetic performance. Studies have shown that rice containing the aforementioned premature aging-related gene exhibits a stable premature aging phenotype. In field conditions, the leaf tips of the second and third leaves show signs of premature aging as early as 10 days after sowing, and senescence continues until maturity. During the tillering stage, the photosynthetic pigment content in mesophyll cells is significantly reduced, chloroplast structure is abnormal, light damage is severe, photosynthetic performance is weakened, and uric acid content is decreased. This invention provides a molecular basis for further in-depth research on gene-regulated aging and also provides a reference for cultivating new varieties resistant to premature aging using premature aging genes. Attached Figure Description
[0018] Figure 1 The base sequences of mutant es33 and Nipponbare and Zhejing 99;
[0019] Figure 2 The amino acid sequences of mutants es33 and Zhejing 99 are shown.
[0020] Figure 3 The uric acid content during the tillering peak of mutants es33 and Zhejing 99;
[0021] Figure 4 Seedling phenotypes of mutant es33 and Zhejing 99;
[0022] Figure 5 Phenotypes of mutant es33 and Zhejing 99 at tillering and heading stages;
[0023] Figure 6 The main spike phenotype at maturity is that of mutant es33 and Zhejing 99;
[0024] Figure 7 The photosynthetic pigment content of mutants es33 and Zhejing 99 at different stages;
[0025] Figure 8 Chlorophyll fluorescence kinetic parameters during the tillering peak of mutants es33 and Zhejing 99;
[0026] Figure 9 Ultrastructure of chloroplasts during the tillering stage of mutants es33 and Zhejing 99;
[0027] Figure 10Physiological indicators of the tillering peak of mutants es33 and Zhejing 99; Detailed Implementation
[0028] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0029] Example 1: Amplification and Sequencing Verification
[0030] The conventional single-season late-season japonica rice variety Zhejing 99, bred by the Institute of Crop and Nuclear Technology Utilization of Zhejiang Academy of Agricultural Sciences and Zhejiang Wuwangnong Seed Industry Co., Ltd., was chemically mutagenized with ethyl methanesulfonate. After multiple generations of self-pollination in the Hangzhou experimental field of Zhejiang Academy of Agricultural Sciences and the Lingshui Nanfan Base in Hainan, six mutants with stable genetic early senescence phenotypes and significant differences were obtained. One mutant, t46, was selected from these and named es33 (earlysenescence 33).
[0031] Using Nipponbare and Zhejing 99 as controls, the gene LOC_Os03g31550 (Gene ID: 4333171) in mutants es33, Nipponbare, and Zhejing 99 (WT) was amplified and sequenced. An upstream primer containing a SpeI restriction site was designed, with the sequence: AGCCCAGATCACTAGTATGGGGTCGCTCACCAGGGCGGA (as shown in SEQ ID NO.1), and a downstream primer containing a BamHI restriction site was designed, with the sequence: TGCTCACCATGGATCCTACACTAAGCTTGGGACGGTAATAT (as shown in SEQ ID NO.2).
[0032] Sequencing was used to verify whether there was a mutation in the ES33 gene in the mutant es33. PCR amplification and sequencing were performed between wild-type Zhejing 99 and extreme single mutant es33 plants.
[0033] PCR amplification was performed using a PCR instrument. The PCR amplification system contained 2 μL ToYoBo dNTPs, 5 μL 2×PCR Buffer for KOD FX, 0.2 μL KOD FX, 0.2 μL DNA, 0.3 μL of the first primer and 0.3 μL of the second primer, and 2 μL ddH2O, for a total of 10 μL. The PCR amplification program was as follows: pre-denaturation at 95℃ for 5 min, followed by denaturation at 94℃ for 1 min, then annealing at 56℃ for 45 s, followed by holding at 72℃ for 1 min to allow the primers to extend onto the template. This completed one cycle. This cycle was repeated 32 times to allow a large accumulation of amplified DNA fragments. Finally, the product was held at 72℃ for 6 min to ensure complete extension, and then stored at 4℃.
[0034] Figure 1 as shown
[0035] The amino acid sequences of the mutant es33 and the wild-type Zhejing 99 were aligned using DNAMAN software. The results showed that a frameshift mutation caused by a 4-base deletion led to premature termination of translation, as Figure 2 shown
[0036] Example 2 Analysis of gene function differences
[0037] At the full-tillering stage, leaves of the same part of 3 plants of the mutant es33 and the wild-type Zhejing 99 were collected, frozen in liquid nitrogen, and the uric acid content in 0.1 g fresh weight leaves was measured using the Grace uric acid content bio-detection kit, with three replicates. Results: Compared with the wild-type Zhejing 99, the uric acid content in the leaves of the mutant es33 at the full-tillering stage decreased by 43%, as Figure 3 shown Figure 3 in which *: significant difference, 0.01 < P < 0.05; **: extremely significant difference, P < 0.01
[0038] The test results indicated that the enzymatic reaction of XDH catalyzing the formation of uric acid in the mutant was blocked. It was speculated that the mutation of gene ES33 led to the change of the protein XDH structure, resulting in the decrease of enzyme activity and the blockage of the enzymatic reaction. This result laid a foundation for the study to determine that the mutation of gene ES33 led to the decrease of XDH enzyme activity and further caused the decrease of uric acid content in the mutant es33 plants
[0039] Example 3 Analysis of phenotypic characteristics and agronomic traits
[0040] The wild-type Zhejing 99 and the mutant es33 were grown in the same large field with normal management mode in the natural environment, and the phenotypes at different growth stages were recorded. It was found that there were obvious phenotypic differences between the mutant es33 and the wild-type Zhejing 99. The phenotypic characteristics at the seedling stage were as Figure 4 shown Figure 4 in which A, B, C, and D are the phenotypes of the wild-type Zhejing 99 and the mutant es33 at 10, 14, 21, and 28 days after sowing respectively, and the scale bar is 1 cm; the phenotypic characteristics at the tillering stage and heading stage are as Figure 5 shown Figure 5 in which A and B are the phenotypes of the wild-type Zhejing 99 and the mutant es33 at the tillering stage and heading stage respectively, and the scale bar is 10 cm
[0041] Results showed that compared with the normal phenotype of Zhejing 99, premature senescence occurred in mutant es33 on the 10th day after sowing. The tips of the second and third leaves turned chlorotic, yellowed, and withered. The withering of the leaf tips became more obvious with growth. By the 28th day, except for the new leaves, the tips of all other leaves showed withering and senescence. The senescence phenotype of mutant es33 was obvious during the tillering stage. The tips of almost all leaves withered and senesced, with fewer tillers per plant, and the plant was somewhat shorter. At the heading stage, the plant of mutant es33 was significantly dwarfed, heading was delayed, the number of tillers was significantly reduced, and the tips of all leaves of the whole plant showed withering phenotype. After maturity, mutant es33 was short, yellowed, and severely senesced.
[0042] When grown to the mature stage in the field environment, the agronomic traits of mutant es33 and wild-type Zhejing 99 were investigated and statistically analyzed. The results are shown in Table 1:
[0043] Table 1 Agronomic traits of mutant es33 and Zhejing 99
[0044]
[0045]
[0046] Note: The values are mean ± standard deviation; *: significant difference, 0.01 < P < 0.05; **: extremely significant difference, P < 0.01.
[0047] The main panicle phenotypes of mutant es33 and Zhejing 99 at the mature stage were as Figure 6 shown.
[0048] Results showed that compared with wild-type Zhejing 99, the plant height of mutant es33 decreased by about 32%, the tillers per plant decreased by about 50%, the panicle length shortened by about 22%, the number of grains per panicle decreased by about 49%, the number of filled grains per panicle decreased by about 79%, the seed setting rate decreased by about 60%, and the 1000-grain weight decreased by about 28%. The differences all reached an extremely significant level; the grain width narrowed by about 12%, reaching a significant difference level, while the grain length showed no obvious change compared with wild-type Zhejing 99.
[0049] Based on the comparison of the premature senescence phenotypes of mutant es33 and wild-type Zhejing 99 and the investigation data of agronomic traits at the mature stage, it was shown that mutant es33 showed premature senescence phenotype at the seedling stage, and was more significantly premature senescent than the wild type at all stages. The number of filled grains per panicle and the seed setting rate decreased severely, and the 1000-grain weight decreased significantly, greatly affecting the rice yield and quality.
[0050] Example 4 Analysis of changes in photosynthetic pigment content and chlorophyll kinetic parameters
[0051] To determine whether the leaf tip drying phenotype of mutant es33 was caused by changes in photosynthetic pigment content, the photosynthetic pigment content of leaves at the same location in wild-type Zhejing 99 and mutant es33 grown in a field environment was measured at the seedling stage, early tillering stage, and peak tillering stage.
[0052] At 10:00 AM during the seedling stage, early tillering stage, and peak tillering stage, 0.1g of leaves from the same part of 3 healthy and uniform mutant es33 and Zhejing 99 plants were collected in the field and cut into 2×2mm pieces. 2 The small pieces were placed in 14 mL centrifuge tubes, 10 mL of 95% ethanol was added, and the mixture was placed in a 4℃ refrigerator for 48 h under light-protected conditions. After centrifugation at 8000 g for 5 min, the absorbance of the supernatant at three wavelengths (470 nm, 649 nm, and 665 nm) was measured using a UV-Vis spectrophotometer. The results were repeated three times. The chlorophyll a, chlorophyll b, and carotenoid contents per unit fresh weight of the leaves were calculated using the following formulas. The average values were taken, and the independent samples t-test was performed using SPSS 22 software.
[0053] Chla content (mg·g) -1 )=(13.95×OD 665 –6.88×OD 649 V / 1000W
[0054] Chlb content (mg·g) -1 )=(24.96×OD 649 -7.32×OD 665 V / 1000W
[0055] Car content (mg·g) -1 )=(1000×OD 470 +811.74×OD 665 -2851.32×OD 649 ) / 245
[0056] OD 470 OD 649 OD 665 These refer to the absorbance values of photosynthetic pigments at wavelengths of 470 nm, 649 nm, and 665 nm, respectively.
[0057] V: Total volume of photosynthetic pigment extract (mL) W: Fresh weight of leaves (g)
[0058] The results are as follows Figure 7 As shown.
[0059] Depend on Figure 7It can be seen that at the stage when the premature senescence phenotype appears, namely the seedling stage, the contents of chlorophyll a and chlorophyll b in the mutant es33 are respectively about 18% and 37% lower than those of the wild type, and the content of carotenoid has no obvious change, indicating that the early senescence and chlorosis phenotype at the leaf tip of the mutant es33 is mainly caused by the decrease in the contents of chlorophyll a and chlorophyll b, while the yellowing at the leaf tip is caused by the fact that the content of carotenoid has no obvious decrease; at the early tillering stage, the contents of chlorophyll a, chlorophyll b and carotenoid in the mutant es33 are respectively about 26%, 9% and 26% lower than those of the wild type, and all reach the extremely significant level of difference; at the full tillering stage, the contents of chlorophyll a, chlorophyll b and carotenoid in the mutant es33 are respectively about 43%, 48% and 34% lower than those of the wild type, and all reach the extremely significant level of difference. The data show that from the seedling stage, the premature senescence of the mutant es33 is accompanied by the decrease in the content of photosynthetic pigments. As the growth process progresses, the premature senescence gradually becomes serious, and the degree of decrease in the content of photosynthetic pigments also increases. It is speculated that the premature senescence phenotype at the leaf tip of the mutant es33 is related to the decrease in the content of photosynthetic pigments.
[0060] By measuring the chlorophyll kinetic parameters of the leaves of the mutant es33, it is determined whether its photosynthetic ability weakens as senescence progresses. At the full tillering stage, the chlorophyll fluorescence kinetic parameters of the leaf tips of the mutant es33 and the wild type Zhejing 99 were measured. At the full tillering stage, 3 plants of the mutant es33 and the wild type Zhejing 99 were taken from the field, dark-treated for 20 min, and the Imaging (Walz, Germany, PAM-2500) chlorophyll fluorescence rapid imager and Imaging win software were used to process and analyze the chlorophyll fluorescence parameters and image. The leaves of the same part of the test plants were placed under the lens of the PAM-2500 instrument, and the Fv / Fm and Y(NO) values were measured and imaged, with three replicates. The results show that the Fv / Fm of the mutant es33 is about 40% lower than that of the wild type, and the Y(NO) value is about 2.3 times higher than that of the wild type, as Figure 8 shown Figure 8 in: A: Fv / Fm of the leaves of the wild type and es33 at the full tillering stage; B: Y(NO) of the leaves of the wild type and es33 at the full tillering stage; C: Comparative bar chart of chlorophyll fluorescence kinetic parameters of the leaves of the wild type and es33 at the full tillering stage; *: significant difference, 0.01 < P < 0.05; **: extremely significant difference, P < 0.01.
[0061] Among them, Fv / Fm is the maximum photochemical quantum yield, also known as the light energy conversion efficiency of the maximum PSⅡ. The smaller this value is, the lower the light conversion efficiency. Y(NO) is an important indicator of light damage. The larger the Y(NO) value, the more the incident light exceeds the degree that the plant can accept, indicating that the plant has been damaged or the plant that continues to be irradiated will be damaged. By Figure 8It can be seen that, compared with the wild-type Zhejing 99, the mutant es33 has a lower light conversion efficiency and is severely damaged. This indicates that the photosynthetic capacity of the mutant es33 weakens with aging.
[0062] Example 5: Changes in chloroplast ultrastructure and analysis of photosynthetic indicators
[0063] When the premature senescence phenotype of the mutant es33 was just emerging in the seedling stage, the ultrastructure of the leaf tip chloroplasts of both the wild type and the mutant was observed by transmission electron microscopy. When the premature senescence phenotype appeared in the leaves of the mutant es33 under field conditions, leaves from the same location of both the mutant es33 and the wild-type Zhejing 99 were taken under the same conditions, cut into 2mm × 2mm pieces with a scalpel, avoiding the midrib, and immersed in 2.5% glutaraldehyde solution. The samples were then vacuum-fixed and incubated overnight at 4°C. The samples were rinsed three times with 0.1M phosphate buffer (pH = 7), 15 min each time. After fixation with 1% osmium tetroxide solution for 1–2 h, the samples were subjected to 0.1 mol·L⁻¹ solution. -1 The samples were washed three times with phosphate-buffered saline (PBS), dehydrated with alcohol at gradient concentrations (30%, 50%, 70%, 80%), each concentration for 15 min, then transitioned to 90% and 95% acetone solutions for 15 min each, followed by two treatments with pure acetone for 20 min each. The samples were then treated with a mixture of Spurr embedding medium and acetone at volume ratios of 1:1 and 3:1 for 1 h and 3 h respectively, and then treated overnight with pure Spurr embedding medium. The infiltration-treated samples were embedded, heated overnight at 70°C, sectioned using an ultramicrotome (70–90 nm), double-stained with lead citrate solution and 50% ethanol-based uranium acetate solution for 10 min, dried overnight, and the ultrastructure of chloroplasts was observed and images acquired using a Hitachi (Hitachi, Japan, H-7650) transmission electron microscope. Results are as follows: Figure 9 As shown, Figure 9 In the diagram: A, B, and C are ultrastructure diagrams of chloroplasts in wild-type Zhejing 99; D, E, and F are ultrastructure diagrams of chloroplasts in mutant es33; G is a grana; OG is an osmophilic granule.
[0064] Depend on Figure 9 It can be seen that the wild-type Zhejing 99 has regular chloroplast shape, a large number of grana, dense grana accumulation, and tightly and orderly arranged thylakoid lamellar structure, with complete chloroplast structure; while the mutant es33 has malformed chloroplast development, irregular shape, significantly reduced number of grana, loose and disordered thylakoids, and larger and more numerous osmophilic granules, indicating that the premature aging of the mutant es33 is accompanied by abnormal chloroplast structural development.
[0065] At the full tillering stage, on a sunny morning with stable photosynthesis at 10:00, the net photosynthetic rate (μmol CO2·(m 2 ) -1 ·s -1 )、stomatal conductance (m mol·(m 2 ) -1 ·s -1 ), intercellular CO2 concentration (μmol·mol -1 ), and transpiration rate (g·(m 2 ) -1 ·h -1 ) of the leaves at the same position of the mutant es33 and wild-type Zhejing 99 plants were measured respectively in the field using a Li-COR (USA, LI-6400XT) portable photosynthesis measurement system. Five replicates were taken and the average value was used. The data was analyzed by independent sample T-test using SPSS 22 software. The results are shown in Table 2 below:
[0066] Table 2 Photosynthetic performance of mutant es33 and wild-type Zhejing 99
[0067]
[0068] Note: The values are mean ± standard deviation; *: significant difference, 0.01 < P < 0.05; **: extremely significant difference, P < 0.01.
[0069] As can be seen from Table 2, the net photosynthetic rate of the mutant es33 is 57% lower than that of the wild type, the stomatal conductance is 63% less than that of the wild type, and the transpiration rate is 41% slower than that of the wild type. The data further confirms that the photosynthetic ability of the mutant has declined; while there is no significant difference in the intercellular CO2 concentration between the mutant and wild-type Zhejing 99, indicating that the photosynthetic ability of the mutant has decreased and is not sufficient to expel the intercellular CO2, resulting in the accumulation of CO2.
[0070] Example 6 Analysis of changes in premature senescence physiological indexes
[0071] At the full tillering stage, leaves of the same part of 3 plants of the mutant es33 and the wild type Zhejing 99 were collected from the field, quickly frozen in liquid nitrogen, and the contents of malondialdehyde (MDA), hydrogen peroxide (H2O2), the activities of catalase (CAT), peroxidase (POD), superoxide dismutase (SOD), the content and production rate of superoxide anion (OFR) in 0.1 g fresh weight leaves were measured using the Grace biological detection kit. The measurements were repeated three times, and the average values were taken. The data were analyzed by T-test. The data showed that the content of malondialdehyde (MDA) in the leaves of the mutant es33 was 2.27 times higher than that of the wild type, the content of hydrogen peroxide (H2O2) was 2.13 times higher, the content of superoxide anion (OFR) was 2.2 times higher, the production rate of superoxide anion (OFR) was 2.19 times higher, the activity of catalase (CAT) decreased by 45%, the activity of peroxidase (POD) decreased by 90%, and the activity of superoxide dismutase (SOD) decreased by 67%. The results are as Figure 10 shown in Figure 10 follows: A - G are respectively the contents of malondialdehyde, hydrogen peroxide, superoxide anion, the production rate of superoxide anion, the activities of catalase, peroxidase and superoxide dismutase of the wild type Zhejing 99 and the mutant es33 at the full tillering stage; *: significant difference, 0.01 < P < 0.05; **: extremely significant difference, P < 0.01.
[0072] The large accumulation of harmful substances such as malondialdehyde, hydrogen peroxide and superoxide anion in cells will break the self - balance of rice, along with a series of phenomena such as protein hydrolysis, enzyme activity reduction and DNA degradation, ultimately leading to cell senescence or death. The accumulation of harmful substances and the reduction of enzyme activity in the leaves of the mutant es33 indicate that the mutant cells have been severely damaged and senescence is in progress.
[0073] Example 7 Genetic Analysis
[0074] In July 2019, at the Haining Base of the Zhejiang Academy of Agricultural Sciences, the wild type Zhejing 99 was used as the female parent and crossed with the mutant es33 to obtain F1 seeds. The F1 seeds were sown in the Nanfan Breeding Base in Lingshui, Hainan, Zhejiang Academy of Agricultural Sciences, and the phenotypes of the F1 plants were observed to determine the dominance and recessiveness of the gene ES33. The F1 plants were self - crossed in April 2020 to obtain F2 seeds, and the F2 seeds were sown in the Haining Base in May of the same year to construct a genetic population. The phenotypes and the segregation of premature senescence traits of the F1 and F2 plants were observed and counted, and chi - square test was performed using SPSS software for genetic analysis to determine the genetic segregation of the gene ES33.
[0075] The results showed that all F1 plants exhibited the wild-type phenotype, with no premature senescence plants and no phenotypic segregation, indicating that ES33 is a recessive gene. The F2 plants obtained by self-pollination of F1 plants showed premature senescence segregation, with a total number of 2196 plants. Of these, 1655 were of the normal phenotype and 541 were of the premature senescence phenotype. The chi-square test using SPSS software (χ² test) showed that... 2 The results showed that the segregation ratio between normal plants and prematurely senescent plants was 3:1 (χ²). 2 The Mendelian law of segregation (=0.155<3.84) indicates that es33 is controlled by a single recessive nuclear gene.
[0076] As demonstrated by the above embodiments, the molecular markers provided by this invention can be used to detect the 4-base AACA deletion in the 11th exon of the LOC_Os03g31550 gene coding region, leading to a frameshift mutation and the formation of a premature aging-related gene. The presence of this premature aging-related gene results in decreased uric acid content, increased harmful substances, and reduced enzyme activity in rice plants; abnormal chloroplast ultrastructure and reduced photosynthetic performance. Studies have shown that rice containing the aforementioned premature aging-related gene exhibits a stable premature aging phenotype. In field conditions, the leaf tips of the second and third leaves show signs of premature aging withering on the 10th day after sowing, and senescence continues until maturity. During the tillering stage, the photosynthetic pigment content in mesophyll cells is significantly reduced, chloroplast structure changes, light damage is severe, photosynthesis is weakened, and uric acid content decreases. This invention provides a molecular basis for further in-depth research on gene-regulated aging and also provides a reference for cultivating new varieties resistant to premature aging using premature aging genes.
[0077] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A molecular marker for detecting premature aging in rice, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.
3.
2. The application of the molecular marker described in claim 1 in research on premature aging in rice, characterized in that, Includes the following steps: The genomic DNA of the sample was amplified by PCR using the upstream primer shown in SEQ ID NO.1 and the downstream primer shown in SEQ ID NO.2 to obtain the PCR product; The PCR product was sequenced. When the sequencing result was as shown in SEQ ID NO.3, it indicated that the rice had a 4-base AACA deletion in the 11th exon of LOC_Os03g31550, and the sample was a seedling premature senescence type.