Specific primers for molecular markers of Mongolian sheep gene LEPR and their application
By detecting the T→C mutation at the intronic region of 43174682 of the LEPR gene of Mongolian sheep, screening Mongolian sheep with TC and CC genotypes as breeding parents, the problem of difficulty in improving the reproductive capacity of Mongolian sheep in the existing technology was solved, and a significant increase in lamb number was achieved.
Patent Information
- Application Number
- CN202310157177.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-23
- Publication Date
- 2025-03-28
- Estimated Expiration
- 2043-02-23
AI Technical Summary
The prior art is difficult to effectively improve the reproductive capacity of Mongolian sheep, especially in terms of lamb number.
By designing specific primers to detect whether there is a T→C mutation in the intronic region 43174682 of the LEPR gene in the genome of Mongolian sheep, the genotype of Mongolian sheep individuals at this site was determined, and Mongolian sheep with TC and CC genotypes were selected as breeding parents.
Effective screening of the reproductive capacity of Mongolian sheep was achieved. The number of lamb production of Mongolian sheep with TC and CC genotypes was 0.41 and 0.4 higher than that of Mongolian sheep with TT genotypes, an increase of 31% respectively.
Smart Images
Figure CN116004857B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of molecular biology, and in particular relates to specific primers of molecular markers of Mongolian sheep gene LEPR and applications thereof. Background Art
[0002] Mongolian sheep is the most numerous and widely distributed rough-wool sheep breed in China, mainly distributed in Inner Mongolia Autonomous Region, Northeast China, North China and Northwest China. Mongolian sheep is the common ancestor of China's short-tailed and fat-tailed sheep breeds including Sunite sheep, Ujumchin sheep, Hulunbuir sheep, Tan sheep, Bayinbuluke sheep, small-tailed Han sheep, Duolang sheep and Hu sheep.
[0003] Wuzhumuqin sheep are produced in Wuzhumuqin grassland in the eastern part of Xilin Gol League, Inner Mongolia Autonomous Region, and are mainly distributed in East Wuzhumuqin Banner, West Wuzhumuqin Banner and other areas, with a total number of about 7 million. Wuzhumuqin sheep are Mongolian sheep that have formed an excellent group through long-term breeding under local conditions. Wuzhumuqin sheep are suitable for year-round grazing and have the characteristics of fast fattening, strong fat accumulation ability, high meat production rate, and early sexual maturity. They are suitable for grazing and fattening during the peak growth period of forage. At the same time, Wuzhumuqin sheep are also good recipient sheep for purebred breeding embryo transplantation. The offspring lambs have a strong physique, strong disease resistance, and good adaptability.
[0004] Sonid sheep are produced in Sonid Left Banner and Sonid Right Banner of Xilin Gol League, Inner Mongolia Autonomous Region. They are known as Gobi sheep and have strong adaptability. They can quickly gain weight even if they are grazed all year round without any feed supplement. They are well-known throughout the country for their plump muscles, strong physique, tender meat, no smell and good taste. Sonid sheep have been formed through long-term natural and artificial selection in the specific ecological environment of Sonid grassland, and have a long history of formation. Under grazing conditions, they have become a local fine breed for meat that is cold-resistant, drought-resistant, fast-growing and strong-lived, and can best adapt to desert and semi-desert grasslands. The total number of Sonid sheep in stock is about 1 million. In 1986, it was approved as a local fine breed by the Technical Supervision Bureau of Xilin Gol League and officially named by the People's Government of Inner Mongolia Autonomous Region in 1997.
[0005] Leptin receptor gene (LEPR) is the receptor of leptin gene (LEP), located in the region from 43101289bp to 43200280bp of chromosome 1 of sheep. The full length of the gene is 98992 bp, with 20 exons and 19 introns, encoding 895 amino acids (NCBI reference sequence: NC_040252.1). Yu Jiarui et al. recorded the number of ovulations by laparoscopy and used real-time fluorescence quantitative PCR technology to detect the expression of LEPR and LEP genes in 11 tissues (heart, liver, spleen, lung, kidney, adrenal gland, fallopian tube, uterine body, pituitary gland, hypothalamus, ovary) of small-tailed Han sheep during the follicular phase and the expression of the hypothalamus-pituitary-ovarian gonadal axis in BB type and ++ type small-tailed Han sheep during the follicular phase and luteal phase. The results showed that the number of ovulations of BB type ( P =0.0035) and litter size ( P =0.0040) was significantly higher than the ++ type. LEPR and LEP were expressed in various tissues during the follicular phase; the LEPR gene was highly expressed in the ovary, uterine body, and adrenal tissues, and the LEP gene was highly expressed in the hypothalamus, pituitary, ovary, and kidney tissues. In the ovary, the expression of the LEPR gene in the ++ type of the follicular phase was higher than that in the ++ type of the luteal phase, but the difference was not significant ( P >0.05); the LEPR gene expression level of BB type in the follicular phase was significantly higher than that of ++ type in the follicular phase ( P =0.007), luteal phase BB type ( P =0.003) and luteal phase + + type ( P =0.003). (YU Jia rui et al. 2018) Studies on nutritional control factors of ovulation rate have identified leptin as a possible candidate. Fasting during the follicular phase leads to reduced leptin concentrations and also to reduced ovulation rate. Ewes with high body mass scores and those fed supplemented diets had increased leptin levels and ovulation rates. Ewes homozygous for either mutation were also more likely to fail to lamb early in the lambing season.
[0006] SNP A( P <0.001) and SNP B( P<=0.001) showed a strong correlation between LEPR genotype and reproductive phenotype. In the LEPR gene, ewes carrying the homozygous mutation were less likely to reach reproductive age at weeks of age compared to ewes without the mutation. The heterozygous mutation also reduced the likelihood of ewes reaching reproductive age before weeks of age, but the effect was not as significant as for ewes carrying the homozygous mutation. Concordance between SNPs The concordance between SNP B and SNP C was very high, with these SNPs being linked in more than 99% of animals; therefore, further analysis was limited to SNP A and SNP B, recognizing that the genotype of SNP B also reflected the genotype of SNP C. For SNP A and SNP B in the Davisdale sheep line, ewes with the CC and CT genotypes had similar ovulation rates, while ewes with the TT genotype had a significantly reduced ovulation rate ( P <0.001). In the flock with SNP A genotype, ovulation rate increased with increasing body weight. There was no interaction between body weight and genotype in the commercial ewes. This pattern was not evident in ewes with the TT genotype, as the negative effect of SNP A on ovulation rate was most pronounced in very light and heavier ewes. In the commercial flock, ovulation rate and genotype were both associated with SNP A ( P <0.05) and SNP B( P =0.075). The ovulation rate of ewes with CC and CT genotypes of SNP A and SNP B was similar, while the ovulation rate of ewes with TT genotype was significantly reduced. (Jennifer L et al. 2015) The effect of mutations in LEPR may explain the variability in the level of effect of the putative major gene for ovulation rate (FECD) on ovulation rate. The number of ewes with homozygous LEPR mutations depends largely on the mutation frequency of the ewe's offspring and the genotype of the paternal line. These mutations may also suppress the average ovulation rate of the putative homozygous FECD group.
[0007] LEPR mutations found in the Davisdale sheep line are associated with different ages at reproduction and adult weight, and with different reproductive phenotypes in adult sheep. The multifaceted effects of LEPR mutations on reproductive traits in both young and adult sheep highlight the fundamental role that leptin signalling may play in regulating reproductive efficiency. Most animals grew at similar rates between pre-weaning and post-weaning and May. The exception to this was a potential differential effect in ewes born in third-parity groups, in which ewes homozygous for the amino acid 62 mutation grew at increased weight before weaning. Genotype in ewes was weakly associated with birth weight (SNP A for P =0.027,SNP B P =0.075), and was strongly associated with adult weight (assessed at 18 months) (SNP A and SNP B P<0.001). Ewes that are heterozygous or homozygous for the mutation are slightly smaller at birth but larger at maturity than their wild-type contemporaries. Summary of the invention
[0008] The purpose of the present invention is to provide a specific primer for the molecular marker of Mongolian sheep gene LEPR.
[0009] Another object of the present invention is to provide a method for improving the fertility of Mongolian sheep based on mutation of the non-coding region of the LEPR gene.
[0010] Another object of the present invention is to provide applications of the above-mentioned specific primers.
[0011] The present invention adopts DNA sequencing technology to detect whether there is a T→C mutation at 43174682 in the 8th intron region of the LEPR gene in the Mongolian sheep genome, and determines the genotype of the Mongolian sheep individual at the site, performs single nucleotide polymorphism detection on the LEPR gene g.43174682T / C site, compares the polymorphism of the LEPR gene g.43174682T / C in Mongolian sheep breeds, and determines that g.43174682T / C is a molecular marker related to the Mongolian sheep's multiple birth trait.
[0012] The nucleotide sequence of the Mongolian sheep LEPR gene g.43174682T / C is the NCBI Reference Sequence NC_040252.1, which is the region from 43174479 bp to 43175484 bp on chromosome 1 of sheep.
[0013] According to the specific primers of the molecular marker of Mongolian sheep gene LEPR in a specific embodiment of the present invention, the primer sequences are as follows:
[0014] SEQ ID NO.1: 5' - CCTTCCTTTCCATCTCAGGA - 3';
[0015] SEQ ID NO. 2: 5' - TGCTTCCTACCCAGCCTTAC - 3'.
[0016] The specific primers of the molecular marker of the Mongolian sheep gene LEPR of the present invention can be applied to a kit for detecting the Mongolian sheep's fetal trait, or can be applied to assisting Mongolian sheep breeding.
[0017] According to a specific embodiment of the present invention, the method for improving the fertility of Mongolian sheep comprises the step of amplifying the genomic DNA of Mongolian sheep using the above-mentioned specific primers.
[0018] (1) Extracting genomic DNA from Mongolian sheep to be tested;
[0019] (2) using the genomic DNA of Mongolian sheep extracted in step (1) as a template, performing PCR amplification with specific primers to obtain an amplified product;
[0020] (3) Determine whether there is a g.43174682 T / C mutation site in the intron 8 region of the LEPR gene in the Mongolian sheep genome in the amplified product to determine the genotype of the Mongolian sheep at the 43174682 bp site, and select Mongolian sheep with a TC or CC genotype at the 43174682 bp in the intron 8 region of the LEPR gene as breeding parents.
[0021] The detection method of the g.43174682T / C SNP of the LEPR gene in the Mongolian sheep genome is:
[0022] The PCR method was used to amplify the fragment of nucleotides 43174479 to 43175484 of the Mongolian sheep LEPR gene GenBank Accession Number NC_040252.1, and the amplified product was sequenced;
[0023] If a single peak appears at the 43174682nd base position of chromosome 1 and the genotype is T, then the genotype is TT. If a double peak appears at the 43174682nd base position of chromosome 1, then the genotype is TC. If a single peak appears at the 43174682nd base position of chromosome 1 and the genotype is C, then the genotype is CC.
[0024] The average lamb number of Mongolian sheep with TC and CC genotypes was higher than that with TT genotype.
[0025] In the present invention, the fertility of Mongolian sheep is specifically embodied in the number of lambs produced per litter.
[0026] According to the method for improving the fertility of Mongolian sheep in a specific embodiment of the present invention, during the PCR amplification in step (2), the total volume of the amplification system is 20 μL, including 1 μL of each upstream and downstream primers, 1 μL of template, 10 μL of premix, and 7 μL of deionized water.
[0027] According to the method for evaluating the fertility of high Mongolian sheep in a specific embodiment of the present invention, the PCR amplification program in step (2) is 95°C pre-denaturation for 3 minutes, 98°C denaturation for 10 seconds, 58°C annealing for 30 seconds, 72°C extension for 15 seconds, 35 cycles, 72°C extension for 10 minutes, 4°C storage, and then sequencing.
[0028] Beneficial effects of the present invention:
[0029] The present invention finds that a molecular marker related to the Mongolian sheep fecundity trait exists in a fragment region of nucleotides 43174479 to 43175484 of chromosome 1 of sheep whose nucleotide sequence NCBI Reference Sequence is NC_040252.1 of LEPR gene g.43174682T / C.
[0030] The present invention designs specific primers, adopts DNA sequencing technology to detect whether there is a T→C mutation at g.43174682T / C in the 8th intron region of the LEPR gene in the Mongolian sheep genome, determines the genotype of the Mongolian sheep individual at the site, realizes the single nucleotide polymorphism detection of the LEPR gene g.43174682T / C, and compares the polymorphism of the LEPR gene g.43174682T / C site in Mongolian sheep breeds.
[0031] The statistical results show that the specific primers of the present invention can detect the molecular marker, and thus can be used to assist Mongolian sheep breeding and increase the number of lambs born by Mongolian sheep. The method of the present invention can be used as an effective method to assist in improving the multi-birth trait of Mongolian sheep. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0033] Figure 1 It is a PCR product diagram of the NC_040252.1: g.43174682T / C site of the Mongolian sheep gene LEPR in the present invention;
[0034] Figure 2 This is a diagram showing the sequencing results of the NC_040252.1: g.43174682T / C site of the Mongolian sheep gene LEPR in the present invention. DETAILED DESCRIPTION
[0035] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention; it is obvious that the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments, and all other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making creative work are within the scope of protection of the present invention.
[0036] The main reagents used in the following examples were purchased from Takara Corporation.
[0037] Example 1 Establishment of a method for detecting molecular markers for the fecundity trait of Mongolian sheep
[0038] 1) Formwork material preparation
[0039] Blood samples were collected from Mongolian sheep and their fertility and parity were recorded. The Mongolian sheep were from Sunite Left Banner and Dongwuzhumuqin Banner of Xilin Gol League, Inner Mongolia Autonomous Region. The blood samples were stored in anticoagulant tubes for later use.
[0040] 2) PCR product sequencing
[0041] 250 Mongolian sheep were randomly selected for PCR product sequencing, and a SNP site located in the non-coding region of the LEPR gene was found, namely NC_040252.1: g.43174682T / C.
[0042] 3) Primer design
[0043] According to the sheep gene sequence reported by GeneBank (GeneBank accession number: NC_040252.1), the upstream and downstream primers F and R were designed by the present invention.
[0044] F: 5' - CCTTCCTTTCCATCTCAGGA - 3';
[0045] R: 5' - TGCTTCCTACCCAGCCTTAC - 3'.
[0046] The genome extracted from Mongolian sheep experimental materials was used as a template and amplified using the above primers.
[0047] The amplification system of the upstream and downstream primers was consistent, and the total volume of the amplification system was 20 μL, including 1 μL of each upstream and downstream primers, 1 μL of template, 10 μL of premix, and 7 μL of deionized water.
[0048] The amplified products were sequenced after 35 cycles of pre-denaturation at 95°C for 3 min, denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 72°C for 15 s, and extension at 72°C for 10 min. The products were stored at 4°C.
[0049] The PCR amplification results of LEPR NC_040252.1: g.43174682T / C are shown in Figure 1 .
[0050] The nucleotide sequence of the PCR product is shown in SEQ ID NO.3:
[0051] ccttcctttccatctcaggaatgtcccattaccacttatgatctttattttaaaaatcgatcactgagctatattagcatagcttccaaagtggtgtaagtcctatctctaattggatccttctctccttattagaaaaattgtcatttacttcaattgcatactgacttactgtcaagtgaaatatttaataagcgttttcta tttttatggaaagattgtaatagagctgggaattcagaaatgccttttcaataagaacaacaacttttagacagagcaaaaactgtctattttaaacaaca aagaagtcttctcagatatcttattgctttcatcattgctgtatacttattgattgttttgtatcttttaaggagcagcctgtactgttctgatgttcc atctgttcatcctgtatctgaacctaaagattgccacttgcagagagatggtttttatgaatgcatatttcagccaatctttctattatctggctataca atgtggattagaattaatcacacgttgggctcactggactctccaccagtttgtgtcattcctgattctgtgggtacgtcaaaaactatatgtatgtcttc atttttattagcagatttggattcagactgattcagggtaacagttgaattttgctattttctgatcacactagattaaaaaattattttcttatttgcagtgggattgaaaagaaaatcagccttagacaattttacaatttttattttacttatagcacaatttttaacaatagggatatgtttagcacataatttg ctgagttatattggttatactgggtttgaaatttggtgctaatattattctaaataatacactattttatgtttttttctcaatatacatatggcaacatctgatgtttttaatttaaaagtttaatttggatattctgatggtttttgaaatctgagtagtcataactcaaagcttaaatttgtaaggctgggtaggaagca
[0052] The sequencing results are shown in Figure 2 If a single peak appears at the 43174682nd base position of chromosome 1 and the genotype is T, then the genotype is TT. If a double peak appears at the 43174682nd base position of chromosome 1, then the genotype is TC. If a single peak appears at the 43174682nd base position of chromosome 1 and the genotype is C, then the genotype is CC.
[0053] Example 2 Statistical analysis of LEPR genotypes and their relationship with the fecundity traits of Mongolian sheep populations
[0054] The Mongolian sheep were tested for genes using the primers designed in Example 1, and the genotype frequencies and allele frequencies of the Mongolian sheep were calculated. The statistical results are shown in Table 1.
[0055]
[0056] The results are shown in Table 1. The genotype frequencies of TT, TC and CC of Mongolian sheep were 0.688, 0.216 and 0.096, respectively. The frequencies of T and C alleles were 0.796 and 0.204, respectively. T allele was the dominant allele.
[0057] The LEPR genotype and its association with the fecundity of Mongolian sheep were analyzed. The specific experiment is as follows:
[0058] (1) Individual genotype analysis was performed on some loci in the selected test sample population, and allele frequencies and genotype frequencies were calculated. 2 test.
[0059] (2) The gene frequency and genotype frequency of the locus were calculated based on the test results, and the distribution of the genotype of the locus was subjected to the chi-square fitness test of Hardy-Weinberg equilibrium. SPSS 19.0 software was used to analyze the association between the fecundity trait and the genotype of the Mongolian sheep population. The statistical model included genotype as a fixed effect and ram as a random effect, and a mixed linear model (MLM) was constructed as follows:
[0060] Y = µ + G + R + e;
[0061] Among them: Y is the recorded value of the fecundity trait; µ is the population average; G is the genotype effect, R is the ram effect; and e is the random residual effect.
[0062] The estimated values and standard errors of reproductive capacity of Mongolian sheep with different genotypes are shown in Table 2.
[0063]
[0064] The results are shown in Table 2. The TC and CC genotypes had 0.41 and 0.4 higher lamb numbers than the TT genotype, respectively. This indicates that the mutation of the T allele to the C allele has a certain effect on the lambing traits of Mongolian sheep, and the differences in the number of lambs produced by different genotypes at this site are extremely significant ( P <0.01). The results showed that the genetic diversity of this locus could be used to screen for breeding sheep with improved fecundity traits in Mongolian sheep.
[0065] Embodiment 3 Method for improving the fertility of Mongolian sheep
[0066] The method for improving the fertility of Mongolian sheep of the present embodiment comprises the following steps:
[0067] (1) Extracting genomic DNA from Mongolian sheep to be tested;
[0068] (2) PCR amplification using specific primers:
[0069] The genome extracted from the Mongolian sheep experimental material was used as a template, and the primers described in Example 1 were used for amplification. The total volume of the amplification system was 20 μL, including 1 μL of each upstream and downstream primers, 1 μL of template, 10 μL of premix, and 7 μL of deionized water;
[0070] After 35 cycles of pre-denaturation at 95°C for 3 min, denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 72°C for 15 s, and extension at 72°C for 10 min, the DNA was stored at 4°C and sequenced.
[0071] (3) Determine the genotype of nucleotide 43174682 of the LEPR gene in the Mongolian sheep genome:
[0072] If a single peak appears at the 43174682nd base position of chromosome 1 and the genotype is T, then the genotype is TT. If a double peak appears at the 43174682nd base position of chromosome 1, then the genotype is TC. If a single peak appears at the 43174682nd base position of chromosome 1 and the genotype is C, then the genotype is CC.
[0073] Mongolian sheep with TC and CC genotypes at position 43174682 intron 8 of the LEPR gene were selected as breeding parents.
[0074] The present invention found that the number of lambs born by the TC genotype at the g.43174682T / C site was 0.41 more than that of the TT genotype, an increase of 31%; the number of lambs born by the CC genotype at the g.43174682T / C site was 0.4 more than that of the TT genotype, an increase of 31%.
[0075] Therefore, the molecular markers of the present invention can be used to screen Mongolian sheep reserve rams, and individuals with genotypes that can promote the number of lambs born in the above-mentioned sites can be selected as Mongolian sheep reserve rams for genetic selection, thereby achieving the breeding goal of promoting the number of lambs born in Mongolian sheep.
[0076] The above are only preferred specific implementations of the present invention; however, the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical solutions and improved concepts of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.
Claims
1. The application of specific primers of the molecular marker of Mongolian sheep gene LEPR in assisting the determination of the fertility of Mongolian sheep is characterized by: The specific primer is a specific primer for the LEPR gene NC_040252.1g.43174682T / C site, Its nucleotide sequence is as follows: SEQ ID NO.1: 5'-CCTTCCTTTCCATCTCAGGA-3'; SEQ ID NO. 2: 5'-TGCTTCCTACCCAGCCTTAC-3'.
2. A method for selecting high-fertility Mongolian sheep, characterized in that: The method comprises the steps of amplifying Mongolian sheep genomic DNA using the specific primers described in claim 1, The specific primer is a specific primer for the NC_040252.1g.43174682T / C site of the LEPR gene, Its nucleotide sequence is as follows: SEQ ID NO.1: 5'-CCTTCCTTTCCATCTCAGGA-3'; SEQ ID NO.2: 5'-TGCTTCCTACCCAGCCTTAC-3'; The method comprises the following steps: (1) Extracting genomic DNA from Mongolian sheep to be tested; (2) using the genomic DNA of Mongolian sheep extracted in step (1) as a template, performing PCR amplification with specific primers to obtain an amplified product; (3) Determine whether there is a g.43174682T / C mutation site in the intron 8 region of the LEPR gene in the Mongolian sheep genome in the amplified product to determine the genotype of the Mongolian sheep at the 43174682bp site, and select Mongolian sheep with a TC or CC genotype at the 43174682bp site in the intron 8 region of the LEPR gene as breeding parents.
3. The method for screening high-fertility Mongolian sheep according to claim 2, characterized in that: During the PCR amplification in step (2), the total volume of the amplification system is 20 μL, including 1 μL of each specific primer, 1 μL of template, 10 μL of premix, and 7 μL of deionized water.
4. The method for screening high-fertility Mongolian sheep according to claim 2, characterized in that: The amplification program of step (2) was as follows: pre-denaturation at 95°C for 3 min, denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 72°C for 15 s, 35 cycles, and extension at 72°C for 10 min.