Osteoporosis marker circRNA and application thereof
By using circBBS9 markers and siRNA technology, osteoclast multinucleation is inhibited, solving the problem of indistinguishable osteoclast lineage inhibition in existing technologies and achieving effective treatment for osteoporosis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-04-28
- Publication Date
- 2026-04-21
AI Technical Summary
Existing technologies for treating osteoporosis suffer from the problem of not distinguishing osteoclast lineages, leading to atypical femoral fractures and imbalances in bone remodeling, and lack spatiotemporally selective strategies to inhibit osteoclast multinucleation.
Using circBBS9 as a biomarker for osteoporosis, we knocked down its expression level with siRNA and delivered siRNA to osteoclasts using biomimetic bone-targeting nanoparticles, which inhibited their multinucleation and reduced bone resorption, while preserving the differentiation capacity of osteoclast precursor cells.
It effectively inhibits osteoclast multinucleation, reduces bone resorption area, increases bone density, alleviates osteoporosis symptoms, and prevents atypical femoral fractures.
Smart Images

Figure CN116024210B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to an osteoporosis biomarker circRNA and its applications. Background Technology
[0002] The overactivation of multinucleated cells plays a crucial role in the pathogenesis of many diseases. Osteoclasts (OCs) are typical multinucleated cells, differentiating from monocyte / macrophage lineages through stimulation of macrophage colony-stimulating factor (M-CSF) and nuclear factor-κB ligand receptor activator. Multinucleated cells possess high transcriptional activity, and mature multinucleated osteoclasts transform into the primary bone resorption cells through transcription, synthesis, and secretion of large amounts of enzymes and acids. However, excessive multinucleation of osteoclasts ultimately leads to an imbalance in bone remodeling, resulting in osteolytic diseases such as osteoporosis. Therefore, understanding the regulatory processes of osteoclast multinucleation is key to studying the pathogenesis and regulatory mechanisms of osteoporosis.
[0003] Currently, first-line treatments for osteolytic diseases, such as bisphosphonates, can significantly inhibit the osteoclast lineage, leading to apoptosis of all bone resorption cells, inhibiting necessary bone turnover, and consequently causing atypical femoral fractures. With a deeper understanding of osteoclast differentiation, the classification of osteoclast lineages has become increasingly clear. The RANKL-induced osteoclast differentiation process includes monocyte precursors, membrane raft assembly, initiation of RNA metabolism, terminal differentiation of pre-osteoclasts (pOCs), and finally fusion into mOCs. Compared to mOCs, pOCs do not undergo multinucleation but retain a certain level of bone resorption activity, maintaining positive communication with osteoblasts and preserving normal osteoogenesis. Therefore, developing a spatiotemporally selective strategy to inhibit the osteoclast lineage in pOCs and prevent its multinucleation process can avoid the shortcomings of current clinical drugs that "don't differentiate lineages and treat all cases the same."
[0004] Therefore, based on the above background, this patent discovers an osteoclast-specific circBBS9 and its human homology hsa_circ_0134188, which are specifically expressed during osteoclast multinucleation and osteoporosis; and through siRNA... circBBS9 It can effectively inhibit osteoclast multinucleation and bone resorption without affecting osteoclast precursor cell differentiation. Simultaneously, miR-423-3p acts as a downstream of circBBS9. Corresponding in vivo experiments confirmed that siRNA designed targeting this circRNA can effectively increase bone mineral density in osteoporotic mice. In conclusion, circBBS9 has the potential to serve as a biomarker for osteoporosis and can be used in clinical osteoporosis drug research. Summary of the Invention
[0005] In view of the shortcomings of the prior art, this invention proposes an osteoporosis biomarker circRNA and its application.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] An osteoporosis biomarker, circRNA, is described, comprising circBBS9 and its human homolog, with nucleotide sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2. Upregulation of circBBS9 expression leads to increased osteoclast multinucleation and bone resorption.
[0008] The application of circRNA, an osteoporosis biomarker, as a target for osteoporosis intervention, with miR-423-3p as its downstream target.
[0009] The application of circRNA, an osteoporosis marker, as a drug for the prevention and treatment of osteoporosis, involves knocking down the expression level of circBBS9 to obtain siRNA. The nucleotide sequence of the siRNA is shown in SEQ ID NO.7 and SEQ ID NO.8. The application of siRNA in the preparation of drugs for the prevention and treatment of osteoporosis is also discussed.
[0010] The application of circRNA, an osteoporosis marker, as a drug for the prevention and treatment of osteoporosis, involves knocking down the expression level of circBBS9 to obtain siRNA. The nucleotide sequence of the siRNA is shown in SEQ ID NO.7 and SEQ ID NO.8. The application of the siRNA expression vector in the preparation of drugs for the prevention and treatment of osteoporosis is also discussed.
[0011] As a preferred option, the expression vector for siRNA is biomimetic bone-targeting nanoparticles.
[0012] The beneficial effects of this invention are:
[0013] The osteoporosis biomarker circBBS9 of this invention exhibits elevated expression levels in osteoporosis patients and mice, and displays a stage-specific expression form in osteoclasts, and can be expressed via siRNA. circBBS9 It can effectively inhibit osteoclast multinucleation, reduce bone resorption area, and preserve the differentiation capacity of osteoclast precursor cells. This can achieve the therapeutic effect of osteoporosis. Attached Figure Description
[0014] Figure 1Expression of circBBS9 in osteoporosis. (a) Heatmap analysis of differentially expressed circRNAs in RNA-seq. (b) RT-qPCR showed that circBBS9 expression increased significantly after RANKL stimulation, with the most significant increase occurring during the third day of multinucleation. (c) Changes in circBBS9 expression during osteoclast multinucleation.
[0015] Figure 2 Differential expression of has-circBBS9. (a) The expression of the human homolog of circBBS9 was elevated in the lumbar spine of patients with osteoporosis, suggesting it may be a biomarker for osteoporosis. (b) The expression of the human homolog of circBBS9 was significantly higher in osteoclasts derived from human peripheral blood cells than in macrophages.
[0016] Figure 3 Transfecting siRNA circBBS9 The effects of subsequent marker gene expression on osteoclasts at different differentiation stages.
[0017] Figure 4 TRAP staining confirms siRNA circBBS9 It can inhibit the multinucleation of osteoclasts. (a, b) siRNA was used on the specified date. circBBS9 Representative images of TRAP-positive cells after 5 days of transfection and RANKL co-culture (c) Quantitative statistics of TRAP-positive cells
[0018] Figure 5 Bone resorption plate evidence of siRNA circBBS9 It reduced the bone resorption capacity of osteoclasts. (a) Using siRNA on a specified date circBBS9 Representative images and quantification of bone resorption area after 5 days of transfection and RANKL co-culture. Scale bar, 200 μm. (b) Quantitative statistics of bone resorption area.
[0019] Figure 6 Western blot analysis showed that siRNA circBBS9 It inhibited osteoclast-characterizing proteins.
[0020] Figure 7 RT-qPCR indicates siRNA circBBS9 It suppressed the expression levels of osteoclast characterization genes.
[0021] Figure 8 TRAP staining reversed the siRNA surface miR-423-3p sponge. circBBS9 The process of osteoclast multinucleation.
[0022] Figure 9 siRNA circBBS9In vivo inhibition of osteoclast multinucleation was achieved by analyzing H&E and TRAP staining images from patients in each group and quantitatively calculating the trabecular bone volume ratio (BV / TV), osteoclast number (OC.N / BS), and osteoclast area (OC.S / BS). The results showed that siRNA inhibited osteoclast multinucleation. circBBS9 The mice in this group exhibited fewer osteoclasts.
[0023] Figure 10 siRNA circBBS9 It can effectively reduce bone loss in osteoporotic mice. (a) Typical images of femoral and tibial sections. (b) Quantitative measurements of bone microstructure parameters in each group, including trabecular volume ratio (BV / TV), number of trabeculae (TB.N), trabecular thickness (Tb.Th), and intertrabecular spacing (Tb.Sp). Detailed implementation method:
[0024] The following detailed description, in conjunction with embodiments, illustrates an osteoporosis biomarker circRNA and its applications provided by the present invention, but these descriptions should not be construed as limiting the scope of protection of the present invention.
[0025] Example 1: Analysis of circBBS9 expression in osteoclasts
[0026] 1. This invention uses RNA-seq to detect differentially expressed circRNAs during osteoclast multinucleation.
[0027] 2. Specific primers were designed based on the obtained circRNA, and the expression levels of these primers were verified by PCR. The results showed that the expression level of circBBS9 increased significantly after RANKL stimulation.
[0028] 3. PCR was used to analyze the expression level of circBBS9 in osteoporotic mice and during osteoclast differentiation. The results showed that the most significant upregulation of circBBS9 expression occurred on day 3 after RANKL stimulation (the osteoclast multinucleation stage). Figure 1 The sequence of CircBBS9 is shown below (SEQ ID NO.1), and its PCR primers are shown below (SEQ ID NO.2) and (SEQ ID NO.3).
[0029] mmu_circ_0001757(SEQ ID NO.1)
[0030] GTGGCTGTACTCCAATCCCAGAGTCAGACCTAGAGGAAAGGTCACTAGATGACTCCACAGAGCTGTTTACCAAC CACAAGCACCTCATGACCGAGCCCCCCATGCCTGAAGTCTCAGCCCGCCAAGGAGTTTTGGAATAGTCTGGAGTAATGCTAATGAGTTGAGGGGAGAGGCCATTACAGAGGCTACCCTGTCTGGACACTGTGTTCCCATCCCGGTGCT GTGCCAAGCTCATCTCTGGAG
[0031] primer-circBBS9-F(SEQ ID NO.2)
[0032] TGGAGTAATGCTAATGAGTTGAGG
[0033] primer-circBBS9-R(SEQ ID NO.3)
[0034] GCTGAGACTTCAGGCATGG
[0035] Example 2: Expression level analysis of circBBS9 human homolog in osteoclasts
[0036] 1. The circBBS9 obtained in Example 1 was compared with the circBase database to obtain the human homolog has_circBBS9. The following specific primers were designed, and qPCR was used to detect its expression in the lumbar spine of osteoporotic patients and osteoclasts differentiated from human peripheral blood cells. It was found that has_circBBS9 was significantly upregulated. (See below) Figure 2 The sequence of has_circBBS9 is shown below (SEQ ID NO.4), and its PCR primers are shown in (SEQ ID NO.5) and (SEQ ID NO.6). hsa_circ_0134188 (SEQ ID NO.4)
[0037] GTGGTTGTACTACAATCCCAGAGTCAGACCTAGAAGAAAGATCAGTAGAACAA GACTCTACAGAACTGTTTACCAACCACAGACATCTCACTGCAGAGACACCCAGGCCTGAAGTTTCACCCCTCCAAGGAGTCTCGGAATAATTCAAGTAGAGTTGTTTG GTTGAGAGGAACATCCCCATCTCAAGGCCGAACCTGTGTGAACCTCATGCCAAGCACAGATATAGGGCTGGCGCAGGTGCTTCCTAAAGCTCACCTTCCTGGAGATGA CATGCATAGAAAGAGGGGTTGGGACTTTTTACTTCACTAGGAGAACTTGTAACACCATGGGGAAGTCAGCTGAAACTTGTCTTGTTTTGCCAGGAAAGGAAGTAGTTG CCTTTGGTCATCCATCTGCTAATAGTCACAGAATACAGTGAAATGACATAGTTTTGGGTTAGATTTTATAATGCAAAGATTCAGATCCAAAATAATTTCATACCCCATTT TTTCACAGAATTCTTATATAGTAAATGTATCAAGTTTAATAAAGCATCTCATTGTCAAATAATATCTTGGATTTTATTTATAATTAGAGGGATTTATGAGTGATTGCTCT ACATTATTTCTTCAAAGGAAAGGAAAGGAATTGAAGACTTTGCTACTCTCT
[0038] primer-has_circBBS9-F(SEQ ID NO.5)
[0039] AGAGGGATTTATGAGTGATTGCT
[0040] primer-has_circBBS9-R(SEQ ID NO.6)
[0041] AGGTCTGACTCTGGGATTGT
[0042] Example 3 Transfection of siRNA circBBS9 Effect on different differentiation stages of osteoclasts
[0043] A circBBS9-specific siRNA was designed, and its sequence is shown below. After RANKL stimulation of BMMs for three days, the siRNA was transfected into them. circBBS9 We used RT-qPCR to analyze marker genes at different differentiation stages of osteoclasts. We found that transfection with siRNA... circBBS9 Subsequently, marker genes in osteoclasts during the multinucleation phase were significantly suppressed, while marker genes in osteoclast precursor cells showed no significant changes. Figure 3 . siRNA-circBBS9-sense(SEQ ID NO.7):CUCUGGAGGUGGCUGUACUTT siRNA-circBBS9-antisense(SEQ ID NO.8):AGUACAGCCACCUCCAGAGTT
[0044] Example 4: Transfection with siRNA circBBS9 Effects on osteoclast formation and function
[0045] To further confirm the timeframe during which circBBS9 exerts its function, we transfected it with siRNA on days 1, 3, and 5 after RANKL stimulation. circBBS9 The sample was then stained with TRAP (PMID: 30378050) and the bone resorption area was measured (PMID: 26592521). The results indicated that siRNA transfection was performed on day 3. circBBS9 It can maximally inhibit the formation and function of multinucleated osteoclasts, with results as follows: Figure 4 , 5 .
[0046] Example 5: Transfection with siRNA circBBS9 Effects on osteoclast characterization gene expression
[0047] Western blot and qPCR were used to detect the siRNA transfection on day 3. circBBS9 The study investigated changes in the expression levels of osteoclast-characterizing genes, finding a significant downregulation of these genes. These results indicate at the molecular level that osteoclast differentiation and function are significantly inhibited. (Results are as follows...) Figure 6 , Figure 7 As shown.
[0048] Example 6: Co-transfection of miR-423-3p mimic and siRNA circBBS9 Effects on osteoclast multinucleation
[0049] To further investigate the mechanism of action of circBBS9, miR-423-3p was identified as a downstream miRNA of circBBS9. circBBS9The miR-423-3p sponge significantly inhibited osteoclast multinucleation; however, this effect was reversed, suggesting that miR-423-3p is a downstream target of circBBS9. The miR-423-3p sponge sequence is shown in (SEQ ID NO. 9). Results Figure 8 As shown.
[0050] siRNA-circBBS9-antisense(SEQ ID NO.9):
[0051] ACTGAGGGGCCTCAGACCGAGCT
[0052] Example 7: circBBS9 can reduce bone loss in ovariectomized mice.
[0053] To further clarify the functional effect of circBBS9 in osteoporosis, a biomimetic bone-targeting nanoparticle carrier (POCM-NPs@siRNA) was constructed. circBBS9 Sham and ovariectomized (OVX) osteoporosis models were established in mice, and the mice were divided into sham group and OVX+siRNA group. NC Group (injected with POCM-NPs@siRNA) NC (as a control) OVX+siRNA circBBS9 Group (injected with POCM-NPs@siRNA) circBBS9 Three groups were administered the drug via tail vein injection to mice one week after ovariectomy. Four weeks later, femurs were harvested for verification. TRAP and HE staining were used to observe the number and morphology of osteoclasts, and micro-CT was used to observe the histological condition of the tibia. Results showed that, compared with POCM-NPs@siRNA... NC In comparison, knocking down circBBS9 reduces the number of osteoclasts while preserving a more intact trabecular bone structure. Figure 9 and Figure 10 This study demonstrates that knocking down this circRNA can alleviate osteoporosis.
[0054] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention. sequence list <110> Sir Run Run Shaw Hospital, affiliated with Zhejiang University School of Medicine <120> An osteoporosis biomarker circRNA and its application <160> 9 <170> SIPOSequenceListing 1.0 <210> 1 <211> 243 <212> DNA <213> Artificial Sequence <400> 1 gtggctgtac tccaatccca gagtcagacc tagaggaaag gtcactagat gactccacag 60 agctgtttac caaccacaag cacctcatga ccgagccccc catgcctgaa gtctcagccc 120 gccaaggagt tttggaatag tctggagtaa tgctaatgag ttgaggggag aggccattac 180 agaggctacc ctgtctggac actgtgttcc catcccggtg ctgtgccaag ctcatctctg 240 gag 243 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <400> 2 tggagtaatg ctaatgagtt gagg 24 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <400> 3 gctgagactt caggcatgg 19 <210> 4 <211> 649 <212> DNA <213> Artificial Sequence <400> 4 gtggttgtac tacaatccca gagtcagacc tagaagaaag atcagtagaa caagactcta 60 cagaactgtt taccaaccac agacatctca ctgcagagac acccaggcct gaagtttcac 120 ccctccaagg agtctcggaa taattcaagt agagttgttt ggttgagagg aacatcccca 180 tctcaaggcc gaacctgtgt gaacctcatg ccaagcacag atatagggct ggcgcaggtg 240 cttcctaaag ctcaccttcc tggagatgac atgcatagaa agaggggttg ggacttttta 300 cttcactagg agaacttgta acaccatggg gaagtcagct gaaacttgtc ttgttttgcc 360 aggaaaggaa gtagttgcct ttggtcatcc atctgctaat agtcacagaa tacagtgaaa 420 tgacatagtt ttgggttaga ttttataatg caaagattca gatccaaaat aatttcatac 480 cccatttttt cacagaattc ttatatagta aatgtatcaa gtttaataaa gcatctcatt 540 gtcaaataat atcttggatt ttatttataa ttagagggat ttatgagtga ttgctctaca 600 ttatttcttc aaaggaaagg aaaggaattg aagactttgc tactctctg 649 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <400> 5 agagggattt atgagtgatt gct 23 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 aggtctgact ctgggattgt 20 <210> 7 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 7 cucuggaggu ggcuguacut t 21 <210> 8 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 8 aguacagcca ccuccagagt t 21 <210> 9 <211> twenty three <212> DNA <213> Artificial Sequence <400> 9 actgaggggc ctcagaccga gct 23
Claims
1. The application of a siRNA that knocks down circBBS9 expression in the preparation of drugs for the prevention and treatment of osteoporosis, characterized in that: Knockdown of circBBS9 expression yields siRNA, the nucleotide sequence of which is shown in SEQ ID NO. 7 and SEQ ID NO.
8. Drugs for preventing and treating osteoporosis are prepared using the siRNA shown.
2. The application of a siRNA that knocks down circBBS9 expression in the preparation of drugs for the prevention and treatment of osteoporosis, characterized in that: siRNA was obtained by knocking down the expression level of circBBS9. The nucleotide sequence of the siRNA is shown in SEQ ID NO: 7 and SEQ ID NO:
8. The expression vector of siRNA is used in the preparation of drugs for the prevention and treatment of osteoporosis.
3. The application of the siRNA that knocks down circBBS9 expression as described in claim 2 as a drug for preventing and treating osteoporosis, characterized in that: The expression vector for siRNA is a biomimetic bone-targeting nanoparticle.