A chimeric antigen receptor targeting human CD47, macrophages expressing the chimeric antigen receptor and uses thereof

By designing a chimeric antigen receptor targeting human CD47 and transfecting it into macrophages, the treatment difficulties caused by the widespread expression of CD47 and the insignificant efficacy of CAR-T cell therapy for solid tumors have been solved. This approach achieves specific targeted phagocytosis of CD47-overexpressing tumor cells and activation of T lymphocytes, providing a safe and effective tumor treatment option.

CN116063579BActive Publication Date: 2026-02-27ANHUI MEDICAL UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202211472879.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-17
Publication Date
2026-02-27
Estimated Expiration
2042-11-17

AI Technical Summary

Technical Problem

In existing technologies, the widespread expression of CD47 in the human body leads to the need for high-dose drugs during targeted therapy, which can easily induce adverse events. Furthermore, existing CAR-T cell therapies are not significantly effective for solid tumors, and the application of chimeric antigen receptor macrophages in solid tumors is not yet mature.

Method used

A chimeric antigen receptor targeting human CD47 was designed, comprising an anti-CD47 single-chain variable fragment (scFv)-CD8-4-1BB-CD3ζ structure. This receptor was transfected into macrophages via an adenovirus vector, conferring upon macrophages the ability to specifically recognize and kill CD47-overexpressing tumor cells and promote T lymphocyte activation.

Benefits of technology

It achieves specific targeted phagocytosis and killing of CD47-overexpressing tumor cells, promotes the activation of tumor-specific T lymphocytes, significantly inhibits tumor growth, and provides a safe and effective tumor treatment option.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116063579B_ABST
    Figure CN116063579B_ABST
Patent Text Reader

Abstract

The application discloses a chimeric antigen receptor targeting human CD47, macrophages expressing the chimeric antigen receptor and application of the chimeric antigen receptor and the macrophages. The specific structure of the chimeric antigen receptor targeting human CD47 is anti-CD47(scFv)-CD8-4-1BB-CD3zeta. The chimeric antigen receptor is transferred into the macrophages by the adenovirus infection mode, and the macrophages are endowed with the ability of specifically recognizing CD47 antigens and killing CD47 overexpressing tumor cells. The application is a new emerging adoptive cell tumor immunotherapy, and the killing effect on tumor cells is obvious, thereby providing a new selection for the field.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering, and particularly relates to a chimeric antigen receptor targeting human CD47, macrophages expressing the chimeric antigen receptor and application thereof. BACKGROUND

[0002] CD47 is a membrane protein in the immunoglobulin superfamily, also known as integrin-associated protein [1] . CD47 contains an N-terminal IgV-like extracellular domain, a 5-transmembrane helix domain and a small C-terminal domain and is divided into four subtypes due to the difference in the C-terminal structure [2] . CD47 is ubiquitously expressed in human cells, and is found to be abundantly expressed on the surface of various malignant cells such as hematological tumors and solid tumors [3] . The increase of CD47 expression is associated with the low survival rate of cancer patients. In the human immune system, CD47 is involved in integrin and cadherin signal transduction to regulate the phagocytosis of macrophages, the activation of T cells and B cells, etc. by interacting with thrombosis response protein (TSP-1) and signal regulatory protein alpha (SIRPα) [4] . Among them, the CD47-SIRPα signaling pathway is considered to be a key mechanism for cancer cells to escape innate immune surveillance [5] . These findings make CD47 a valuable target for cancer immunotherapy.

[0003] In recent years, the development of targeted anti-tumor drugs against CD47 has become a hot spot. At present, the targeted therapy strategies based on CD47 mainly focus on CD47-SIRPa signaling pathway inhibitors, including blocking CD47 on target cells to inhibit the pathway, inhibiting SIRPa molecules on immune cells to inhibit the pathway, and blocking the pathway by inhibiting the QPCTL enzyme required for CD47 maturation [6 , 7] . The main drugs such as CD47 monoclonal antibody, QPCTL enzyme inhibitor, etc. all aim to block the CD47-SIRPα axis to restore or enhance the phagocytosis of macrophages on tumor cells [8] . On this basis, researchers have also found that macrophages can act as antigen-presenting cells to present cancer cell antigens to T cells through MHCII and activate CD8+ T cells [9] . However, due to the wide expression of CD47 in the human body, a higher dose of drug is needed to ensure efficacy in treatment, and high-dose drugs are more likely to induce more adverse events related to CD47

[10] .

[0004] Adoptive cell immunotherapy refers to a treatment method of infusing anti-tumor immune effector cells into a tumor-bearing body to produce or enhance anti-tumor immune response to kill tumor cells

[11] There are three main types of adoptive immune cells: tumor infiltrating lymphocytes, T cell receptor (TCR) gene edited T cells and chimeric antigen receptor modified T cells

[12] Tumor infiltrating lymphocyte therapy is to extract the lymphocytes infiltrated in the tumor tissue of the patient, and to amplify them in vitro, and then to reinfuse them into the patient to generate anti-tumor effect. This method is often used for the treatment of melanoma and has achieved certain effect in clinical practice

[13] TCR gene edited T cells are to introduce a new TCR into T cells to achieve the recognition of specific tumor antigens to target and kill tumor cells. This therapy kills tumor cells in a major histocompatibility complex (MHC)-dependent manner

[14] However, both of these therapies are limited in application due to the high heterogeneity of tumor cells, complex in vitro culture system and long production cycle

[15] .

[0005] Chimeric antigen receptor (CAR) is a synthetic receptor, which includes a single-chain variable fragment or an antigen recognition binding domain, a transmembrane domain providing a scaffold and signal transduction, and a co-stimulatory domain from TCR and T cell activation

[16] CAR can bind to cancer cell surface antigens, directly activate T cells, and kill cancer cells in an MHC-independent manner

[17] In current research and clinical trials, CAR-T cell therapy has shown excellent therapeutic effect on hematological malignancies

[16] However, due to the tumor microenvironment of solid tumors inhibiting CAR-T cell activity, and the difficulty of CAR-T cells to infiltrate solid tumors, the efficacy of CAR-T cell therapy for solid tumors is not significant

[18] Although researchers have tried various methods to enhance the efficacy of CAR-T cell therapy for solid tumors, such as deleting inhibitory receptors, overexpressing auxiliary genes, and combining with other therapies, no breakthrough has been made so far.

[0006] Macrophages are an important part of innate immunity and play a key role in inflammation and host defense

[19] In solid tumors, macrophages are the most infiltrated immune cells. In fact, macrophages can phagocytose tumor cells, but cancer cells can express a "don't eat me" signal to inhibit this phagocytosis; and under the influence of the tumor microenvironment, these macrophages are polarized into M2 anti-inflammatory macrophages which play an important role in tumor development and metastasis [19 ,20] Considering the unique phagocytic function and the ability to infiltrate solid tumors of macrophages, some researchers have attempted to construct chimeric antigen receptor macrophages to fight solid tumors. Michael Klichinsky et al. of the University of Pennsylvania first constructed chimeric antigen receptor macrophages to fight solid tumors and confirmed the targeted phagocytosis of chimeric antigen receptor macrophages on solid tumor cells and the activation of adaptive immunity in a humanized mouse model

[21] Based on the research of Michael Klichinsky et al., Mikyung Kang et al. programmed macrophages expressing CAR targeting anaplastic lymphoma kinase (ALK) and proinflammatory phenotype in vivo by using nanomaterial-mediated gene delivery and confirmed its effectiveness

[22] .

[0007] There is no report on the use of chimeric antigen receptor macrophages targeting human CD47 to treat tumors.

[0008] Reference:

[0009] [1]BROWN E, HOOPER L, HO T, et al. Integrin-associated protein: a 50-kD plasma membrane antigen physi cally and functionally associated with integrins [J]. The Journal of cell biology, 1990, 111(6 Pt 1): 2785-94.

[0010] [2]FENALTI G, VILLANUEVA N, GRIFFITH M, et al. Structure of the human marker of self 5-transmembrane receptor CD47 [J]. Nature communications, 2021, 12(1): 5218.

[0011] [3]HAYAT S M G, BIANCONI V, PIRRO M, et al. CD47: role in the immune system and application to cancer therapy [J]. Cellular oncology (Dordrecht), 2020, 43(1): 19-30.

[0012] [4]LOGTENBERG M E W,SCHEEREN F A,SCHUMACHER TN.The CD47-SIRPα Immune Checkpoint[J].Immunity,2020,52(5):742-52.

[0013] [5]VEILLETTEA,CHEN J.SIRPα-CD47 Immune Checkpoint Blockade in Anticancer Therapy[J].Trends in immunology,2018,39(3):173-84.

[0014] [6]WEISKOPF K,RINGAM,HO C C,et al.Engineered SIRPα variants as immunotherapeutic adjuvants to anticancer antibodies[J].Science(New York,NY),2013,341(6141):88-91.

[0015] [7]MAJETI R,CHAO M P,ALIZADEHAA,et al.CD47 is an adverse prognostic factor and therapeutic antibody target on human acute myeloid leukemia stem cells[J].Cell,2009,138(2):286-99.

[0016] [8]JAISWAL S,JAMIESON C H,PANG W W,et al.CD47 is upregulated on circulating hematopoietic stem cells and leukemia cells to avoid phagocytosis[J].Cell,2009,138(2):271-85.

[0017] [9] LIU X, PU Y, CRON K, et al. CD47 blockade triggers T cell-mediated destruction of immunogenic tumors [J]. Nature medicine, 2015, 21(10): 1209-15.

[0018]

[10] SIKIC B I, LAKHANI N, PATNAIKA, et al. First-in-Human, First-in-Class Phase I Trial of the Anti-CD47 Antibody Hu5F9-G4 in Patients With Advanced Cancers [J]. Journal of clinical oncology: official journal of the American Society of Clinical Oncology, 2019, 37(12): 946-53.

[0019]

[11] ROHAAN M W, WILGENHOF S, HAANEN J. Adoptive cellular therapies: the current landscape [J]. Virchows Arch, 2019, 474(4): 449-61.

[0020]

[12] JUNE C H, RIDDELL S R, SCHUMACHER T N. Adoptive cellular therapy: a race to the finish line [J]. Science translational medicine, 2015, 7(280): 280ps7.

[0021]

[13] SPIESS P J, YANG J C, ROSENBERG S A. In vivo antitumor activity of tumor-infiltrating lymphocytes expanded in recombinant interleukin-2 [J]. Journal of the National Cancer Institute, 1987, 79(5): 1067-75.

[0022]

[14] Rosenberg SA, Restifo NP. Adoptive cell transfer as personalized immunotherapy for human cancer[J]. Science (New York, NY), 2015, 348(6230): 62-8.

[0023]

[15] Houot R, Schultz LM, Marabelle A, et al. T-cell-based Immunotherapy: Adoptive Cell Transfer and Checkpoint Inhibition[J]. Cancer immunology research, 2015, 3(10): 1115-22.

[0024]

[16] Neelapu SS, Locke FL, Bartlett NL, et al. Axicabtagene ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma[J]. The New England journal of medicine, 2017, 377(26): 2531-44.

[0025]

[17] Stern er RC, Stern er RM. CAR-T cell therapy: current limitations and potential strategies[J]. Blood cancer journal, 2021, 11(4): 69.

[0026]

[18] Beatty GL, O'Hara. Chimeric antigen receptor-modified T cells for the treatment of solid tumors: Defining the challenges and next steps[J]. Pharmacology & therapeutics, 2016, 166(30-9.

[0027]

[19] SICA A, MANTOVANIA. Macrophage plasticity and polarization: in vivo veritas[J]. J Clin Invest, 2012, 122(3): 787-95.

[0028]

[20] WU K, LIN K, LI X, et al. Redefining Tumor-Associated Macrophage Subpopulations and Functions in the Tumor Microenvironment[J]. Frontiers in immunology, 2020, 11(1731.

[0029]

[21] KLICHINSKY M, RUELLA MA, SHESTOVA O, et al. Human chimeric antigen receptor macrophages for cancer immunotherapy[J]. Nat Biotechnol, 2020, 38(8): 947-53.

[0030]

[22] KANG M, LEE S H, KWON M, et al. Nanocomplex-Mediated In Vivo Programming to Chimeric Antigen Receptor-M1 Macrophages for Cancer Therapy[J]. Adv Mater, 2021, 33(43): e2103258. SUMMARY

[0031] The purpose of the present application is to provide a new effective choice for the anti-tumor technical field, and for this purpose the present application provides a chimeric antigen receptor targeting human CD47, macrophages expressing chimeric antigen receptor and application thereof.

[0032] The chimeric antigen receptor targeting human CD47 of the present application is sequentially spliced from the nitrogen end to the carbon end, including an anti-CD47 single-chain variable fragment and a chimeric antigen receptor intracellular structure sequence, and the specific structure is

[0033] anti-CD47(scFv)-CD8-4-1BB-CD3ζ.

[0034] Further, the amino acid sequence of the chimeric antigen receptor targeting human CD47 is shown as SEQ ID NO: 4.

[0035] The application also provides a gene encoding a chimeric antigen receptor targeting human CD47, the nucleotide sequence of which is shown in SEQ ID NO: 3.

[0036] The expression vector containing the gene encoding the chimeric antigen receptor is an adenovirus vector.

[0037] The application also provides a macrophage expressing the chimeric antigen receptor, containing the gene encoding the chimeric antigen receptor or the expression vector of the gene encoding the chimeric antigen receptor.

[0038] Specifically, the expression vector is transfected into the macrophage by adenovirus infection, thereby obtaining a genetically engineered macrophage capable of expressing the chimeric antigen receptor. The application transfers the chimeric antigen receptor into the macrophage by adenovirus infection, and endows the macrophage with the ability to specifically recognize CD47 antigen and kill CD47 overexpressing tumor cells.

[0039] The macrophage is a human monocyte-macrophage THP-1 cell line.

[0040] The application of the macrophage expressing the chimeric antigen receptor of the application is for preparing an anti-tumor drug.

[0041] The beneficial results of the application are embodied in:

[0042] The application creatively utilizes a newly designed scFv fragment of anti-CD47 with high affinity and specificity obtained by genetic engineering technology to obtain a chimeric antigen receptor. The chimeric antigen receptor is transferred into an adenovirus vector, and high-efficiency expression of CAR on the surface of macrophages is achieved by infection, thereby transforming the non-specific mononuclear or macrophage into a specific macrophage capable of recognizing human CD47 and mediating targeted killing of tumor cells overexpressing CD47. Moreover, the chimeric antigen receptor macrophage can promote the activation of tumor-specific T lymphocyte cells, and kill tumor cells in multiple ways. After specifically recognizing tumor cells overexpressing CD47, the CD47-targeted chimeric antigen receptor modified macrophage can play an anti-tumor role through targeted phagocytosis and promotion of CTL effect. The application designs a new genetically engineered macrophage, and provides a new safe and effective tumor treatment scheme. BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1 Proportion of PMA-stimulated THP-1 differentiated into macrophages. Blank: THP-1 cells without any treatment; Unstimulated: THP-1 cells without PMA stimulation labeled with CD68 antibody; PMA: PMA-stimulated THP-1 cells labeled with CD68 antibody.

[0044] Figure 2 Chimeric antigen receptor gene expression. Un-transfected: macrophages without adenovirus; Vehicle control: macrophages infected with empty adenovirus; CAR: macrophages infected with chimeric antigen receptor adenovirus.

[0045] Figure 3 Macrophage phagocytosis of tumor cells after infection with chimeric antigen receptor adenovirus. SKOV3, A2780 are both CD47 overexpressing cells. Vehicle control: macrophages infected with empty adenovirus and tumor cells co-culture group; CAR-M: macrophages infected with chimeric antigen receptor adenovirus and tumor cells co-culture group.

[0046] Figure 4 Macrophage activation of T cells after phagocytosis of tumor cells. Vehicle control: macrophages infected with empty adenovirus and tumor cells co-culture group; CAR-M: macrophages infected with chimeric antigen receptor adenovirus and tumor cells co-culture group.

[0047] Figure 5 Expression of several major T cell-related anti-tumor inflammatory factors in the supernatant and T cell surface Fasl expression after 24 hours of CAR-M and tumor cell co-culture and 48 hours of CD3+T cell co-culture. Vehicle control: macrophages infected with empty adenovirus, tumor cells and CD3+T cells co-culture group; CAR-M: macrophages infected with chimeric antigen receptor adenovirus, tumor cells and CD3+T cells co-culture group.

[0048] Figure 6 Tumor growth curve and statistical analysis of tumor weight after CAR-M and tumor cell mixture subcutaneous tumor formation experiment. Vehicle control: macrophages infected with empty adenovirus and tumor cell mixture group; CD47 CAR-M: macrophages infected with chimeric antigen receptor adenovirus and tumor cell mixture group.

[0049] Figure 7 Sequencing results of empty vector EFla.

[0050] Figure 8 Sequencing results of CD47 scFv-CD8-4-1BB-CD3ζ. DETAILED DESCRIPTION

[0051] The design of the CAR provided by the application is optimized after multiple explorations, and each fragment of the chimeric antigen receptor plays a different function. The conditions for CAR to infect macrophages in the application are obtained after multiple explorations, so as to efficiently transfect the anti-CD47 chimeric antigen receptor gene into macrophages, and make it correctly expressed on the cell membrane of macrophages, successfully transforming non-specific macrophages into specific macrophages capable of recognizing human CD47 and mediating targeted killing of cancer cells with high expression of CD47. The chimeric antigen receptor macrophage cells of the application show significant antitumor effect in in vitro and in vivo experiments, and can be used as an antitumor drug, having good application prospect.

[0052] Sequence description:

[0053] SEQ ID NO: 1 is the empty vector EF1a nucleotide sequence of the application.

[0054] SEQ ID NO: 2 is the empty vector EF1a amino acid sequence of the application.

[0055] SEQ ID NO: 3 is the CD47scFv-CD8-4-1BB-CD3zeta nucleotide sequence of the application.

[0056] SEQ ID NO: 4 is the CD47scFv-CD8-4-1BB-CD3zeta amino acid sequence of the application.

[0057] Example 1: Obtaining of CD47 targeted CAR gene and construction of adenovirus vector

[0058] The gene sequence CD47scFv-CD8-4-1BB-CD3zeta and the empty vector EF1a were synthesized by Shanghai Heyuan Biotechnology (Shanghai) Co., Ltd. and adenovirus coated. Among them:

[0059] The upstream primer for amplifying EF1a is: CATGGTCCTGCTGGAGTTCGTG;

[0060] The downstream primer for amplifying EF1a is: GAAATTTGTGATGCTATTGC;

[0061] The upstream primer for amplifying scFv(CD47)CAR is: TCAAGCCTCAGACAGTGGTTC;

[0062] The downstream primer for amplifying scFv(CD47)CAR is: GAAATTTGTGATGCTATTGC.

[0063] The experimental results are as follows: after extracting the gene sequence CD47scFv-CD8-4-1BB-CD3 zeta and the empty vector EF1a plasmid, the restriction enzyme NheI / HindlII is used for identification and sequencing. The sequencing results are consistent with the expected structure of the constructed CAR and the structure of the empty vector.

[0064] Example 2: Transfection and expression detection of macrophages

[0065] 1. Experimental route

[0066] 1) Culture of macrophages

[0067] In this experiment, the human monocyte-macrophage THP-1 cell line was selected and cultured in 1640 culture medium containing 10% serum. 100 ng / ml of PMA was used to stimulate for 48 hours to induce THI-1 to differentiate into macrophages, and then 100 ng / ml of GM-CSF was used to stimulate for 48 hours.

[0068] 2) Infection of macrophages

[0069] ①Collect the cultured macrophages and count the cells using a cell counting plate to make the number of transfected cells 1×10 6 .

[0070] ②According to the virus titer, add the corresponding amount of virus, and after 12 hours of culture, replace it with complete culture medium for continuous culture for 48 hours.

[0071] 3) Flow cytometry detection of CAR expression on the membrane of macrophages

[0072] After 48 hours of infection of macrophages, the expression of CAR on the cell membrane after transfection was detected by CAR gene connection GFP expression.

[0073] ①Centrifugal collection of cells after infection in the previous experiment and normally cultured macrophages, discard the supernatant. Wash twice with PBS phosphate buffer, and count the cells to make about 2×10 5 cells per tube;

[0074] ②Each add 2 μl of anti-HER2 flow cytometry antibody, avoid light incubation for 30 min;

[0075] ③Centrifuge at 1500 rpm for 3 min, discard the supernatant, add 500 μL PBS for washing, repeat twice, and detect on the machine.

[0076] 2. Experimental results

[0077] Figure 1 The results show that after 48 hours of stimulation with 100 ng / ml of PMA, most of the THP-1 cells have been polarized into macrophages. Figure 2The results show that 73.7% of CAR can be expressed on the surface of THP-1 cells after 48 hours of adenovirus infection of macrophages.

[0078] Example 3: Detection of in vitro killing activity of chimeric antigen receptor macrophages

[0079] In this experiment, CD47-positive tumor cells were labeled with CMPTX fluorescent probes and co-cultured with the constructed CD47-targeting chimeric antigen receptor macrophages, and the phagocytosis percentage was detected.

[0080] 1. Experimental route

[0081] 1) Select human ovarian cancer cell lines SKOV3 and A2780 as CD47 expression positive cells, digest the two cells conventionally, label the fluorescent probes, and then place 1 x 10 5 cells in a 24-well plate;

[0082] 2) Collect THP-1 cells 48 hours after infection, count the cells, and add 1 x 10 5 cells per well to the plated cancer cells.

[0083] 3) After 4 hours of co-culture, digest the cells, resuspend them with PBS, and detect phagocytosis by flow cytometry.

[0084] 2. Experimental results

[0085] To verify whether the anti-CD47 CAR-M constructed in this experiment can target phagocytosis of tumor cells, CAR-M was co-cultured with SKOV3 or A2780, and phagocytosis was detected by flow cytometry. The experimental results show that macrophages transfected with empty vector do not have obvious phagocytosis of CD47 overexpressing cell lines SKOV3 and A2780, while CAR-expressing macrophages can produce specific targeted phagocytosis of SKOV3 and A2780. The above experimental results show that CAR-modified macrophages can strongly kill CD47 overexpressing tumor cells.

[0086] Example 4: Detection of in vitro activation of CD8+IFN-γ+T cells by chimeric antigen receptor macrophages

[0087] In this experiment, CD47 CAR-M was co-cultured with CD47-positive tumor cells for 24 hours, PBMC was extracted from human blood, CD3+T cells were sorted from PBMC by magnetic beads, and CAR-M was added to the co-culture system with tumor cells for direct co-culture for 48 hours. Flow cytometry was used to detect the percentage of CD8+T cells.

[0088] 1. Experimental route

[0089] 1) Select human ovarian cancer cell lines SKOV3, A2780 as CD47 expression positive cells, digest the two cells regularly, and put 1x10 5 cells in a 24-well plate;

[0090] 2) Collect THP-1 cells infected for 48 hours, count the cells, and add 1x10 5 cells per well to the plated cancer cells, and co-culture for 24 hours;

[0091] 3) Extract PBMC from human blood, obtain CD3+T cells in PBMC by magnetic bead sorting, count the cells, and add 1x10 5 cells per well to the CAR-M and tumor cell co-culture system for direct co-culture for 48 hours, and detect the percentage of CD8+T cells by flow cytometry.

[0092] 2, Experimental results

[0093] In order to verify whether the anti-CD47 CAR-M constructed in this experiment can specifically activate CTL cells, CD3+T cells are added to the co-culture system of CAR-M and tumor cells, and the activation of CD8+T cells is detected by flow cytometry after co-culture for 48 hours. The experimental results show that after co-culture of macrophages transfected with empty vector and CD47 overexpressing cell lines SKOV3 or A2780 for 24 hours, and then co-cultured with CD3+T cells for 48 hours, the proportion of CD8+IFN-γ+cells is low, while the macrophages expressing CAR can obviously stimulate the activation of CD8+IFN-γ+cells. The above experimental results show that CAR modified macrophages can significantly stimulate the differentiation of CD4+T cells to CTL.

[0094] Example 5: The main mechanism of CD47 CAR-M promoting CD8+T cells to kill cancer cells

[0095] 1, The contents of IL-2 / TNF-α / IL-α / IFN-γ and perforin and granzyme in the supernatant of the co-culture system in Example 4 are determined by enzyme-linked immunosorbent assay (ELisa), and the expression of T cell surface receptor Fasl is detected by flow cytometry.

[0096] 1) Collect the supernatant of anti-CD47 CAR-M and CD47 overexpressing cell lines SKOV3 or A2780 co-cultured for 24 hours, and then co-cultured with CD3+T cells for 48 hours;

[0097] 2) Dilute the supernatant according to the requirements of the Elisa instruction, and detect the relative expression of the corresponding inflammatory factors according to the steps of the instruction.

[0098] 2, Experimental results

[0099] After co-cultured with two CD47 over-expression cell lines and then co-cultured with T cells, the Elisa results show that CAR modified macrophages can present tumor cell antigens to T cells and stimulate T cells to secrete IL-2 / TNF-α / IL-α / IFN-γ and perforin, granulysin to kill tumor cells. The results of flow cytometry show that the expression of Fasl on the surface of T cells increases after co-culture. These data show that CAR-M can promote CTL to effectively kill tumor cells.

[0100] Example 6: CD47 CAR-M inhibits CD47 positive tumor growth in vivo

[0101] In this experiment, CD47 CAR-M and empty vector were mixed with CD47 positive tumor cell mixture and implanted subcutaneously in nude mice to evaluate the inhibitory effect of CD47 CAR-M on CD47 positive tumor cells in vivo.

[0102] 1. Experimental route

[0103] 1) Select human ovarian cancer cell line A2780 as CD47 positive expression cell, digest the cells routinely;

[0104] 2) Mix the constructed CD47 CAR-M and empty vector with A2780 cells 1:1, resuspend in 100 μl PBS, and implant into the left and right axillary of nude mice respectively;

[0105] 3) Observe the tumor formation and tumor volume change of nude mice every 2 days.

[0106] 2. Experimental results

[0107] The results show that the empty vector and A2780 mixture group has 100% tumor formation, and the CD47 CAR-M and A2780 mixture group has 80% tumor formation rate. The tumor volume and tumor weight of the empty vector and A2780 mixture group are significantly larger than those of the CD47 CAR-M and A2780 mixture group. These results suggest that CD47 CAR-M can inhibit the growth of CD47 positive tumor cells in vivo.

Claims

1. A chimeric antigen receptor targeting human CD47, characterized in that: The chimeric antigen receptor targeting human CD47 is spliced ​​sequentially from the nitrogen end to the carbon end, including an anti-CD47 single-chain variable fragment and a chimeric antigen receptor intracellular structural sequence, specifically anti-CD47(scFv)-CD8-4-1BB-CD3ζ. The amino acid sequence of the chimeric antigen receptor targeting human CD47 is shown in SEQ ID NO:

4.

2. A gene encoding a chimeric antigen receptor targeting human CD47, characterized in that... Its nucleotide sequence is shown in SEQ ID NO:

3.

3. An expression vector containing the chimeric antigen receptor encoding gene as described in claim 2, characterized in that... The expression vector is an adenovirus vector.

4. A macrophage expressing a chimeric antigen receptor targeting human CD47, characterized in that: An expression vector containing the encoding gene of the chimeric antigen receptor as described in claim 2 or the encoding gene of the chimeric antigen receptor as described in claim 3.

5. The macrophage according to claim 4, characterized in that: The macrophages are the human mononuclear-macrophage THP-1 cell line.

6. The use of macrophages expressing chimeric antigen receptors targeting human CD47 as described in claim 4 or 5 in the preparation of antitumor drugs.

Citation Information

Patent Citations

  • Engineered immune cells targeting CD47 and with suicide gene switches

    CN109897114A

  • CAR and CAR-M cells targeting hepatocellular carcinoma and construction method and application thereof

    CN118530370A

  • Downregulation of membrane-bound proteins by receptor TAC technology

    WO2022053036A1

  • Transformed antigen-specific professional antigen-presenting cells comprising chimeric antigen receptor (CAR) and use thereof

    WO2022215920A1