A glycosyltransferase mutant and its application in the synthesis of icariin D2

Abstract

The present invention provides a glycosyltransferase mutant and its application in catalyzing the biosynthesis of icariin D2, belonging to the field of biopharmaceutical technology of traditional Chinese medicine. The glycosyltransferase mutant has an amino acid sequence as shown in SEQ ID No.1 in the sequence table. The present invention uses glycosyltransferase Bl-YjiC derived from Bacillus licheniformis as a parent, mutates methionine Met (M) at position 112 to aspartic acid Asp (D), and improves the regioselectivity of catalyzing tyrosol to synthesize icariin D2. After the transformation, the glycosyltransferase mutant has a regioselectivity of 98% (wild type 49%) for synthesizing icariin D2, with only 2% of the by-product salidroside, and the product is relatively single, which helps to reduce the subsequent separation steps, streamline the product purification process, and is more suitable for the industrial production of icariin D2.

Description

Technical Field

[0001] The invention belongs to the technical field of biopharmaceuticals of traditional Chinese medicine, and specifically relates to the application of a glycosyltransferase Bl-YjiC mutant derived from Bacillus licheniformis in the enzymatic preparation of icariin D2. Background Art

[0002] Icariside D2, molecular formula: C 14 H 20 O 7 , molecular weight 300.30, is the active ingredient of plants such as Epimedium brevicornum Maxim, has good anti-cancer, anti-inflammatory, hypotensive and other pharmacological activities, and has important medicinal value. Epimedium D2 is usually extracted from the roots and stems of plants such as wild epimedium, facing problems such as low extraction content, complex extraction process, and long production cycle. The chemical method of synthesizing epimedium D2 requires selective protection, activation or the use of expensive metal catalysts, which is not conducive to industrial production. Therefore, we urgently need to develop a green, efficient and large-scale method for producing epimedium D2.

[0003] Glycosyltransferases (EC 2.4.xy) can directly catalyze the glycosylation reaction of the alcoholic hydroxyl group of tyrosol to produce epimedin D2. The reaction has strong specificity, mild conditions and high yield, so it has the advantages of low cost, high efficiency and green process. The key to the enzymatic synthesis of glycoside compounds is the selection of glycosyltransferases. Since most natural products with important pharmacological effects are found in plants, plant-derived glycosyltransferases have become the main research object. Compared with plant-derived glycosyltransferases, microbial-derived glycosyltransferases are easy to express heterologously using model strains such as Saccharomyces cerevisiae, Escherichia coli, and Bacillus subtilis, and are easier to achieve industrial production. However, in the face of the non-natural substrate molecule tyrosol, microbial-derived glycosyltransferases catalyze tyrosol to produce epimedin D2 and a byproduct salidroside. The production of a large number of byproducts will not only reduce the yield of epimedin D2 but also greatly increase the subsequent separation and purification costs. Summary of the invention

[0004] The object of the present invention is to provide a microbial glycosyltransferase mutant and its application in catalyzing the biosynthesis of icariin D2. The glycosyltransferase mutant has the characteristics of high regional selectivity and is conducive to the industrial biological method for producing icariin D2.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a glycosyltransferase mutant having an amino acid sequence as shown in SEQ ID No. 1 in the sequence list.

[0007] The present invention provides the glycosyltransferase mutant encoding gene, which has a nucleotide sequence as shown in SEQ ID No. 2 in the sequence table.

[0008] The invention provides a glycosyltransferase recombinant plasmid, wherein the recombinant plasmid comprises the glycosyltransferase mutant encoding gene.

[0009] The invention provides a glycosyltransferase recombinant strain, wherein the recombinant strain is an expression vector transformed with the recombinant plasmid.

[0010] The present invention provides the use of the glycosyltransferase mutant or the glycosyltransferase recombinant strain in catalyzing the synthesis of icariin D2 from a substrate.

[0011] Preferably, the catalytic substrates are tyrosol and UDP-glucose.

[0012] Preferably, the catalytic temperature is 25-35°C.

[0013] Preferably, in the process of the glycosyltransferase recombinant strain catalyzing the synthesis of icariin D2 from the substrate, the glycosyltransferase recombinant strain is induced under the conditions of 0.05-1 mmol / L isopropyl-β-D-thiogalactopyranoside solution for 12-24 hours.

[0014] The present invention provides a glycosyltransferase mutant having an amino acid sequence as shown in SEQ ID No.1 in the sequence table. The present invention uses the glycosyltransferase Bl-YjiC derived from Bacillus licheniformis as a parent, mutates the methionine Met (M) at position 112 to aspartic acid Asp (D) (glycosyltransferase mutant shown in SEQ ID No.1), and improves the regioselectivity of catalytic synthesis of icariin D2. The present invention provides the use of the glycosyltransferase mutant or the glycosyltransferase recombinant strain in catalyzing the biosynthesis of icariin D2. The modified glycosyltransferase mutant Bl-YjiC M112D shown in SEQ ID No.1 catalyzes the conversion of tyrosol into icariin D2 with a regioselectivity of 98%, while the parent has only 49%, and the mutant is more suitable for the industrial production of icariin D2. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the protein electrophoresis diagram of mutant Bl-YjiC M112D of Example 3, wherein M is the protein marker, Lane 1 is the control without the addition of inducer, Lane 2 is the precipitate after disruption, and Lane 3 is the supernatant after disruption.

[0016] Figure 2 The figure is a comparison of the conversion rates of 2 mM and 5 mM substrates catalyzed by the mutant recombinant strain and the parent recombinant strain in Example 4, respectively.

[0017] Figure 3 The HPLC spectrum of the standard product in Example 5 is shown in FIG. Figure 3 a is the peak time of icariin D2, Figure 3 b is the peak time of salidroside. Figure 3 c is the tyrosol peak time.

[0018] Figure 4 The HPLC spectrum of selective identification of the parent recombinant strain and mutant strain and the transformed and synthesized icariin D2 in Example 6; wherein Figure 4 a is the HPLC profile of tyrosol conversion by the parental recombinant strain in vitro; Figure 4 b HPLC profile of tyrosol conversion by the mutant strain in vitro. DETAILED DESCRIPTION

[0019] Example 1: This example illustrates the cloning of glycosyltransferase Bl-YjiC

[0020] Microbial strain genome extraction: Using the standard strain Bacillus licheniformis ATCC14580 as the starting strain, the target genome was extracted according to the extraction method of the microbial genome extraction kit, and after agarose gel electrophoresis detection, it was used as a cloning template.

[0021] The target glycosyltransferase gene in the genome information of Bacillus licheniformis ATCC14580 in the NCBI database was used as a template to design cloning primers. The extracted Bacillus licheniformis genome was used as a template, and the target glycosyltransferase gene fragment Bl-YjiC was obtained by PCR amplification using cloning primers Bl-YjiC-F and Bl-YjiC-R (Table 1). The target glycosyltransferase gene fragment Bl-YjiC obtained by PCR amplification was verified by agarose gel electrophoresis, and the target gene fragment was purified and recovered by referring to the AxyPrep DNA gel recovery kit method, and stored in a refrigerator at 20°C for a short period of time. The nucleotide sequence of glycosyltransferase Bl-YjiC is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2.

[0022] Table 1 Cloning primers

[0023] Bl-YjiC-F (SEQ ID NO: 5) aagaaggagatatactgcagATGGGACATAAACATATCGCGA Bl-YjiC-R (SEQ ID NO: 6) cggagctcgaattcggatccTTATTTTACTCCTGCGGGTGC 28a-NcoI-R (SEQ ID NO: 7) CTGCAGTATATCTCCTTCTTAAAGTTAAAC 28a-BamHI-F (SEQ ID NO: 8) GGATCCGAATTCGAGCTCCGT

[0024] Using pET28a plasmid as template and 28a-BamHI-F and 28a-NcoI-R (Table 1) as primers, the linearized plasmid was amplified. The target glycosyltransferase gene fragment Bl-YjiC obtained by PCR was verified by agarose gel electrophoresis, and then the target gene fragment was purified and recovered according to the AxyPrep DNA gel recovery kit method and stored in a 20°C refrigerator for a short term.

[0025] Recombination ligation was performed using a recombinase, and the ligation reaction system is shown in Table 2. The ligation was carried out at 37°C for 30 minutes. The recombinant ligation reaction solution was then introduced into the competent cells of E. coli BL21 (DE3) using the heat shock method. The colonies on the plate were selected using colony PCR. The positive clones were sent to the company for sequencing verification. The strain with the correct sequencing was the engineered bacterial strain expressing the target glycosyltransferase, named E. coli BL21 (DE3) / pET28a-Bl-YjiC.

[0026] Table 2 Recombination ligation system

[0027] Connecting components Volume (μL) 5×buffer 2 Recombinase 1 Linearization of pET28a 1 Bl-YjiC PCR product 1 <![CDATA[ddH 2 The]]> 5

[0028] Example 2: This example illustrates the site-directed mutagenesis of glycosyltransferase Bl-YjiC

[0029] Design site-directed mutagenesis primers M112D-F and M112D-R (Table 3); use the expression plasmid pET28a-Bl-YjiC containing the parent Bl-YjiC gene as a template and perform PCR amplification with the site-directed mutagenesis primers to obtain a PCR product; digest the obtained PCR product to remove the pET28a-Bl-YjiC template to obtain a digested PCR product; transform the digested PCR product into Escherichia coli BL21 (DE3), pick the transformant, culture it, extract the plasmid, perform DNA sequencing, and perform sequence analysis to obtain a mutant encoding gene with the correct mutation.

[0030] The present invention has no particular limitation on the method for designing primers for site-directed mutagenesis, and a primer design method well known to those skilled in the art can be used. In the present invention, the site of site-directed mutagenesis is the 112th amino acid residue of the glycosyltransferase. In the present invention, the 112th Met codon ATG is mutated to the high-frequency codon GAT of Asp.

[0031] In the present invention, the site-directed mutagenesis primers used for mutation to Asp are preferably M112D-F and M112D-R. The M112D-F has a nucleotide sequence as shown in SEQ ID No.3 in the sequence table. The M112D-R has a nucleotide sequence as shown in SEQ ID No.4 in the sequence table. SEQ ID No.3-4 are shown in Table 3, wherein the lowercase part is the base after the mutation.

[0032] Table 3 Mutation primers

[0033] Primer name Primer sequences M112D-F (SEQ ID No. 3) TGACTTTgatGCCATGGCGGGAAAACTGCTGG M112D-R (SEQ ID No. 4) CCATGGCatcAAAGTCAAAAAGGATAAGGTCTGGC

[0034] After obtaining the site-directed mutagenesis primers, the present invention uses the expression plasmid pET28a-Bl-YjiC containing the parent Bl-YjiC gene as a template and the site-directed mutagenesis primers to perform PCR amplification to obtain a PCR product. The PCR reaction system is shown in Table 4.

[0035] Table 4 Site-directed mutagenesis PCR system

[0036] Reaction components Volume (μL) M112D-F 1 M112D-R 1 2×PrimeSTAR Max DNA Polymerase 5 pET28a-Bl-YjiC 1 <![CDATA[ddH 2 The]]> 2

[0037] The site-directed mutation PCR amplification conditions are preferably as follows: 94°C for 2 min; 98°C for 10 s; 60°C for 15 s; 72°C for 40 s; 30 cycles; 72°C for 5 min. After obtaining the PCR product, the present invention digests the PCR product to remove the pET28a-Bl-YjiC template to obtain a digested PCR product. The digestion enzyme is preferably Dpn I enzyme. The enzyme digestion conditions of the Dpn I enzyme are preferably as follows: take 8 μL of the amplified PCR product, add 1 μL QuickCut buffer 1 μL and 1 μL Dpn I enzyme, and digest at 37°C for 30 min. After obtaining the digested PCR product, the present invention transforms the digested PCR product into Escherichia coli BL21 (DE3), cultures and picks transformants, extracts plasmids, sends them for testing, and obtains a mutant in which the 112th Met codon ATG is mutated to the high-frequency codon GAT of Asp through sequence analysis.

[0038] Example 3: This example illustrates the inducible expression of glycosyltransferase Bl-YjiC and its mutants

[0039] Pick the mutant strain and the parent strain and culture them in a liquid LB medium containing 50 mg / L kanamycin at 37°C overnight, then inoculate 50 mL of liquid LB medium containing 50 mg / L kanamycin at a ratio of 1:100 (v / v), culture at 37°C until the OD is 0.6-0.8, add 0.1 mM IPTG (isopropyl-β-D-thiogalactopyranoside) and induce culture at 16°C for 20 hours. Collect the cells by centrifugation at 4°C, 3000 rpm for 10 minutes, and resuspend in 10 mL of buffer (50 mM Tris-HCl, pH = 8.0). Resuspend the cells and ultrasonically disrupt them with parameters of 200 W, break for 3 seconds, stop for 3 seconds, and the total disruption time is 15 minutes. After the disruption, centrifuge at 10000×g, 4°C for 20 minutes, collect the supernatant and precipitate, and perform SDS-PAGE detection on the supernatant and precipitate. The detection results are as follows: Figure 1As shown. It shows that IPTG can effectively induce the expression of mutants. The concentration range of IPTG can be 0.05~1.0mmol / L.

[0040] Example 4: Comparison of transformation efficiency between mutant Bl-YjiC M112D and parent Bl-YjiC

[0041] The enzymatic reaction temperature was 30°C, the reaction system was 500 μL, containing 50 mM Tris / HCl (pH=8.0), 500 μg crude enzyme (supernatant obtained in Example 3), 2 mM and 5 mM tyrosol concentrations, 2.5 times the substrate concentration of UDP-glucose, the reaction time was 48 h, and 4 μL 10 wt% TFA was added to terminate the enzyme reaction. The reaction product was centrifuged at 10000 × g for 10 min, 50 μL of supernatant was taken for HPLC analysis, and the conversion rate was calculated. The results are shown in 2. It can be seen that the mutant Bl-YjiC M112D and the parent Bl-YjiC48h can convert all the substrates.

[0042] Example 5: This example illustrates the detection conditions of tyrosol and icariin D2

[0043] Waters liquid chromatograph, determination conditions: C18 column (4.6×250 mm); detection wavelength 275 nm; mobile phase A = water (containing 0.1% volume formic acid), B = methanol; flow rate = 1 ml / min; gradient elution conditions: 0-15 min 20% volume B; injection volume 10 μL. The detection results of substrate tyrosol, product icariin D2 and byproduct salidroside are as follows Figure 3 shown.

[0044] Example 6: This example illustrates the regioselectivity of glycosyltransferase Bl-YjiC and its mutants

[0045] The enzymatic reaction temperature was 30°C, the reaction system was 500 μL, containing 50 mM Tris / HCl (pH=8.0), 100 μg crude enzyme (supernatant obtained in Example 3), 2 mM tyrosol concentration, 5 mM UDP-glucose concentration, the reaction time was 3 h, and 4 μL 10 wt% TFA was added to terminate the enzyme reaction. The reaction product was centrifuged at 10000×g for 10 min, and 50 μL of the supernatant was taken for HPLC analysis to determine the selectivity of synthesizing icariin D2. The test results are as follows: Figure 4 The results showed that the selectivity of mutant Bl-YjiC M112D in converting substrate tyrosol into icariin D2 in vitro was 98%, which was much higher than 49% of the parent. The product composition was simple, which could greatly reduce the cost of subsequent separation and purification and had broad application prospects in the biopharmaceutical industry.

[0046] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the present invention.

Claims

1. A glycosyltransferase mutant, characterized in that: The glycosyltransferase mutant is obtained by mutating the methionine Met at position 112 in the amino acid sequence shown in SEQ ID No. 1 in the sequence table to aspartic acid Asp.

2. The glycosyltransferase mutant encoding gene according to claim 1, characterized in that: The glycosyltransferase mutant encoding gene is obtained by mutating the bases ATG at positions 334-336 in the nucleotide sequence shown in SEQ ID No. 2 in the sequence list into bases GAT.

3. A glycosyltransferase recombinant plasmid, characterized in that: The recombinant plasmid comprises the gene encoding the glycosyltransferase mutant according to claim 2.

4. A glycosyltransferase recombinant strain, characterized in that: The recombinant strain comprises the expression vector of the recombinant plasmid according to claim 3.

5. Use of the glycosyltransferase mutant according to claim 1 or the glycosyltransferase recombinant strain according to claim 4 in catalyzing the synthesis of icariin D2 from substrates, wherein the substrates are tyrosol and UDP-glucose.

6. The use according to claim 5, characterized in that: The catalytic temperature is 25-35°C.

7. The use according to claim 6, characterized in that: In the process of the glycosyltransferase recombinant strain catalyzing the synthesis of epimedin D2 from the substrate, the glycosyltransferase recombinant strain is induced for 12 to 24 hours under the condition of 0.05 to 1.0 mmol / L isopropyl-β-D-thiogalactopyranoside solution.

Images