A method for assisting in identifying heat tolerance in chinese cabbage and a06-14144455 locus used thereby
By using competitive allele-specific PCR technology and primer sets at the A06-14144455 locus to detect the genotype of Chinese cabbage, the problems of accuracy and efficiency in identifying the heat resistance of Chinese cabbage have been solved, realizing an efficient molecular breeding method and improving the accuracy and speed of the breeding process.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
- Filing Date
- 2022-08-23
- Publication Date
- 2026-07-10
Smart Images

Figure BDA0003810922190000041 
Figure BDA0003810922190000061 
Figure BDA0003810922190000071
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and in particular relates to a method for assisting in the identification of heat resistance of Chinese cabbage and the A06-14144455 site used therein. The A06-14144455 site is the nucleotide at position 101 from the 5' end of SEQ ID NO:1 in the Chinese cabbage genome. Background Technology
[0002] Chinese cabbage originated in my country and is one of the most widely planted and highest-yielding vegetable crops in the country. "Year-round production and supply" has become a major requirement for the development of the Chinese cabbage industry. However, Chinese cabbage prefers cool temperatures, with an optimal growth temperature of 15-20℃. When the temperature exceeds 25℃, it often exhibits phenomena such as excessive seedling growth, yellowing leaves, weak plants, severe viral diseases, bitterness, increased crude fiber content, and difficulty in head formation, posing significant challenges to spring and summer Chinese cabbage production. With the continuous development of molecular biology and bioinformatics, discovering and isolating major stress-resistance QTLs from different sources, identifying molecular markers linked to heat-resistant genes or QTLs, and efficiently integrating them through molecular design breeding to select stable and durable stress-resistant varieties has become one of the effective ways to cultivate highly resistant and high-quality Chinese cabbage varieties.
[0003] Molecular markers are used to select for target traits at the DNA level. They offer advantages such as high efficiency, speed, and independence from environmental influences, allowing selection to be performed during the seedling stage and accelerating the breeding process. Currently, a series of molecular markers related to heat tolerance in Chinese cabbage have been developed. Zheng Xiaoying et al. used isozyme and RAPD and AFLP molecular marker technologies to identify genetic markers related to heat tolerance in Chinese cabbage, obtaining nine molecular markers tightly linked to heat tolerance QTLs. Yu Shuancang et al. used AFLP and RAPD maps of Chinese cabbage with 352 marker loci and employed composite interval mapping to locate quantitative trait loci (QTLs) controlling heat tolerance in Chinese cabbage. Using the seedling heat injury index for heat tolerance phenotypic identification, they detected five heat tolerance QTL loci. Li Tingting first used the SRAP molecular marker method to conduct molecular marker research on heat tolerance traits in Chinese cabbage, obtaining a crossover value of 16.7% between the markers and heat tolerance genes, indicating a relatively tight linkage between the two.
[0004] SNPs are next-generation molecular markers, referring to DNA sequence polymorphisms caused by variations in a single nucleotide at the chromosomal genome level. Unlike first- and second-generation molecular markers, SNPs are characterized by high distribution density, good genetic stability, and diallelic genotypes. Sequencing and comparison of whole genomes across different species have shown that SNP genetic analysis or gene diagnosis exhibits superior reproducibility, accuracy, and stability compared to SSRs. Currently, there are few reports on the use of SNP molecular markers for screening heat tolerance in Chinese cabbage; therefore, developing SNP molecular markers related to heat tolerance in Chinese cabbage is of great significance.
[0005] KASP (Kompetitive Allele Specific PCR) is a commonly used method for SNP typing. It features high stability, accuracy, and low cost, and has been widely applied in high-throughput molecular-assisted breeding and variety identification. Summary of the Invention
[0006] The purpose of this invention is to assist in identifying the heat resistance of the Chinese cabbage under test.
[0007] This invention first protects the primer set. The primer set may consist of upstream primer A06-14144455-X, upstream primer A06-14144455-Y, and downstream primer A06-14144455-C;
[0008] The upstream primer A06-14144455-X may consist of fluorescent tag sequence A and the DNA fragment shown in positions 21 to 51 from the 5' end of SEQ ID NO:2;
[0009] The upstream primer A06-14144455-Y may consist of fluorescent tag sequence B and the DNA fragment shown in positions 22 to 52 from the 5' end of SEQ ID NO:3;
[0010] The nucleotide sequence of the downstream primer A06-14144455-C is shown in SEQ ID NO:4.
[0011] In the primer set, the nucleotide sequence of fluorescent tag sequence A may be as shown in SEQ ID NO:2 from position 1 to 20 starting from the 5' end. The nucleotide sequence of fluorescent tag sequence B may be as shown in SEQ ID NO:3 from position 1 to 21 starting from the 5' end.
[0012] This invention also protects the application of any of the primer sets described above, which may be any of the following b1)-b3):
[0013] b1) To assist in the identification of the heat resistance of the Chinese cabbage under test;
[0014] b2) Assist in screening for cabbage varieties that are or are suspected of being heat-resistant;
[0015] b3) Chinese cabbage breeding.
[0016] This invention also protects the application of DNA fragment 1 of SEQ ID NO:1 or DNA fragment 2 shown at positions 71-140 from the 5' end of SEQ ID NO:1, which may be any one of the following b1)-b4):
[0017] b1) To assist in the identification of the heat resistance of the Chinese cabbage under test;
[0018] b2) Assist in screening for cabbage varieties that are or are suspected of being heat-resistant;
[0019] b3) Chinese cabbage breeding.
[0020] b4) as a molecular marker to assist in identifying the heat resistance of the Chinese cabbage being tested.
[0021] This invention also protects a method for assisting in the identification of heat resistance in Chinese cabbage, which may include the following steps: detecting the genotype of the Chinese cabbage to be tested based on the A06-14144455 locus, and then making the following judgment:
[0022] If the genotype of the Chinese cabbage to be tested is TT homozygous or CT heterozygous based on the A06-14144455 locus, then the Chinese cabbage to be tested has or is suspected of having heat resistance.
[0023] If the genotype of the Chinese cabbage to be tested is CC homozygous based on the A06-14144455 locus, then the Chinese cabbage to be tested does not have or is suspected of not having heat resistance.
[0024] The A06-14144455 position is the nucleotide at position 101 from the 5' end of SEQ ID NO:1 in the Chinese cabbage genome.
[0025] In the above method, the step of detecting the genotype of the Chinese cabbage to be tested based on the A06-14144455 locus can be as follows:
[0026] (1) Using the genomic DNA of the Chinese cabbage to be tested as a template, PCR amplification was performed using any of the primer sets described above to obtain PCR amplification products;
[0027] (2) After completing step (1), the fluorescence signal of the PCR amplification product is detected by an instrument, and the genotype of the Chinese cabbage to be tested based on the A06-14144455 site is obtained according to the color of the fluorescence signal.
[0028] In the above method, the step of detecting the genotype of the Chinese cabbage to be tested based on the A06-14144455 locus can be as follows:
[0029] (1) Using the genomic DNA of the Chinese cabbage to be tested as a template, PCR amplification was performed using any of the primer sets described above to obtain PCR amplification products;
[0030] (2) Take the PCR amplification product obtained in step (1) and sequence it;
[0031] (3) Based on the sequencing results obtained in step (2), the genotype of the Chinese cabbage to be tested based on the A06-14144455 site is obtained.
[0032] This invention also protects a reagent kit. The reagent kit includes substances for detecting the genotype of a Chinese cabbage sample based on the A06-14144455 locus;
[0033] The A06-14144455 site could be the nucleotide at position 101 from the 5' end of SEQ ID NO:1 in the Chinese cabbage genome.
[0034] The kit may specifically consist of substances that detect the genotype of the Chinese cabbage to be tested based on the A06-14144455 locus.
[0035] In any of the above-described kits, the substance used to detect the genotype of the Chinese cabbage to be tested based on the A06-14144455 locus can be any of the above-described primer sets.
[0036] This invention also protects the application of any of the above-described reagent kits, which may be any of the following b1)-b3):
[0037] b1) To assist in the identification of the heat resistance of the Chinese cabbage under test;
[0038] b2) Assist in screening for cabbage varieties that are or are suspected of being heat-resistant;
[0039] b3) Chinese cabbage breeding.
[0040] Chinese cabbage inbred line 256 was used as the female parent and Chinese cabbage inbred line 255 was used as the male parent to cross and obtain hybrid F1; then the hybrid F1 was self-crossed to obtain an F2 segregating population consisting of 154 F2 generation plants. Based on the genotype and heat tolerance identification results of 154 F2 generation plants at the A06-14144455 locus, it was found that among the 34 F2 generation plants with the TT homozygous genotype at the A06-14144455 locus, 32 F2 generation plants were heat-tolerant and 2 F2 generation plants were heat-sensitive, with an identification accuracy rate of 94%; among the 50 F2 generation plants with the CC homozygous genotype at the A06-14144455 locus, 40 F2 generation plants were heat-sensitive and 10 F2 generation plants were heat-tolerant, with an identification accuracy rate of 80%; and among the 70 F2 generation plants with the CT heterozygous genotype at the A06-14144455 locus, 61 F2 generation plants were heat-tolerant and 9 F2 generation plants were heat-sensitive, with an identification accuracy rate of 87%. Therefore, it is evident that the genotype at the A06-14144455 locus can assist in identifying the heat resistance of Chinese cabbage with high accuracy. This invention has significant application value. Attached Figure Description
[0041] Figure 1 The results are from genotyping of a portion of the F2 generation segregating population based on the genotype at the A06-14144455 locus. Detailed Implementation
[0042] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0043] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0044] Example 1: Discovery of the A06-14144455 locus on chromosome A06 of Chinese cabbage and establishment of a genotyping method for Chinese cabbage based on the A06-14144455 locus.
[0045] I. Discovery of locus A06-14144455 on chromosome A06 of Chinese cabbage
[0046] Through extensive experiments, the inventors of this invention discovered a SNP site on chromosome A06 of Chinese cabbage, named A06-14144455. The A06-14144455 site is the 101st nucleotide from the 5' end of SEQ ID NO:1 in the Chinese cabbage genome, with genotypes of CC homozygous and TT homozygous. SEQ ID NO:1: CCACTCTTGATCTCTGCAAGTTAAGATGAGCACATTTACTGATTTTTGTCTCTCTTAGTTTCTTAACTTTTCAGATCTGCACTTATTTTTCTATAAAATGYAGTTAAGAGTTAACTAATACGTTTAGTGTCATAACCTTCATGAATTTTACATTTTTTCTTCATATACAAAACTCGTCGATAATCTTACATTTAGTTACAT (Y represents C / T).
[0047] Since genomic DNA is a double-stranded DNA molecule composed of two single-stranded DNA molecules that are antisense complements, the DNA molecule that encodes proteins is generally named the sense DNA molecule, and the DNA molecule that is antisense complement to the sense DNA molecule is named the antisense DNA molecule. The genotypes at loci A06-14144455 are all sense DNA genotypes.
[0048] II. Synthesis of primer sets for amplifying the target sequence including the A06-14144455 site.
[0049] A primer set suitable for allelic competitive specific PCR was designed and synthesized for amplifying the target sequence including the A06-14144455 locus. The primer set consists of three primer sequences: upstream primer A06-14144455-X, upstream primer A06-14144455-Y, and downstream primer A06-14144455-C. The nucleotide sequences of each primer are shown in Table 1. The target sequence amplified by the primer set is shown in SEQ ID NO:1, positions 71-140 from the 5' end.
[0050] Table 1
[0051]
[0052] Note: A single underscore indicates a FAM fluorescent tag sequence, and a double underscore indicates a HEX fluorescent tag sequence.
[0053] III. Establishment of a Genotyping Method for Chinese Cabbage Based on the A06-14144455 Locus
[0054] 1. Obtaining genomic DNA from the Chinese cabbage sample
[0055] Genomic DNA was extracted from the Chinese cabbage sample using the CTAB method.
[0056] The quality and concentration of the genomic DNA from the Chinese cabbage to be tested must meet the requirements of PCR. The standards are as follows: agarose gel electrophoresis shows a single DNA band without obvious diffusion; the A260 / A280 ratio detected by a Nanodrop 2100 (Thermo) spectrophotometer is between 1.8 and 2.0 (the DNA sample is free of protein contamination), the A260 / A230 ratio is between 1.8 and 2.0 (the DNA sample has a low salt ion concentration), and there is no obvious light absorption at 270 nm (the DNA sample is free of phenol contamination); the concentration of the genomic DNA from the Chinese cabbage to be tested is 20-50 ng / μL.
[0057] 2. Competitive allele-specific PCR
[0058] Competitive allele-specific PCR was performed according to the standard experimental procedure provided by LGC (Laboratory of the Government Chemist) Ltd., UK. This procedure is based on competitive allele-specific PCR technology. Unless otherwise specified, all reagents were supplied by LGC. The reagent dosage, usage, and overall experimental procedure followed LGC's operating instructions, GenetypingAssay, Manual Part #15004070 Rev. B. Reactions were performed in 384-well or 1536-well plates (Cat. No. 04729749001, Roche), with a reaction volume of 3 μl or 1 μl. The specific steps are as follows:
[0059] (1) Add 1.5 μL of the genomic DNA of Chinese cabbage to be tested to a microplate using a K-pette dispensing station and dry at 60 °C. Then, under the Kraken operating system, use a Meridian dispensing station to add 1×Mastermix (KBS-1016-002 or Cat.No.KBS-1016-011, Laboratory of the Government Chemist) and primer premix (made by mixing upstream primer A06-14144455-X, upstream primer A06-14144455-Y and downstream primer A06-14144455-C at a molar ratio of 2:2:5, with a final concentration of 10 μM for each primer) to each well. Immediately after mixing, place the microplate on a Kube heat sealer and a Fusion laser sealer to seal it. PCR reactions were performed in a high-throughput water bath system called Hydrocycler. The specific program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 61℃-55℃ (using the touchdown program, decreasing by 0.6℃ per cycle) for 1 min, amplification for 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing & extension for 1 min, and continued amplification for 26 cycles.
[0060] (2) After completing step (1), when the temperature of the PCR amplification product drops below 40℃, the fluorescence value is read by scanning the FAM and HEX beams of the BMG PHERAstar instrument (the FAM fluorescent tag sequence is observed at an excitation wavelength of 485nm and an emission wavelength of 520nm, and the HEX fluorescent tag sequence is observed at an excitation wavelength of 528nm and an emission wavelength of 560nm). The genotype of the Chinese cabbage to be tested based on the A06-14144455 site is determined according to the fluorescence signal color. The specific judgment principles are as follows: If the tested cabbage shows a blue fluorescent signal at the A06-14144455 locus, then the genotype of the tested cabbage at the A06-14144455 locus is TT homozygous; if the tested cabbage shows a red fluorescent signal at the A06-14144455 locus, then the genotype of the tested cabbage at the A06-14144455 locus is CC homozygous; if the tested cabbage shows a green fluorescent signal at the A06-14144455 locus, then the genotype of the tested cabbage at the A06-14144455 locus is CT heterozygous.
[0061] It should be noted that after amplification, the fluorescence signal is detected and the genotyping results are checked using a BMG PHERAstar instrument. If the fluorescence signal is weak after PCR amplification, affecting data analysis, additional cycles can be added (94℃ denaturation for 20s, 55℃ annealing and extension for 1min, 3 cycles) until genotyping is complete.
[0062] Example 2: Association analysis between genotype of Chinese cabbage based on locus A06-14144455 and heat tolerance of Chinese cabbage.
[0063] I. Genotyping of Chinese cabbage based on the A06-14144455 locus
[0064] The Chinese cabbage inbred line 256 (also known as small eight-leaf tumbleweed) was purchased from the Molv Horticulture Specialty Store on JD.com. Chinese cabbage inbred line 256 is a heat-resistant variety of Chinese cabbage.
[0065] The Chinese cabbage inbred line 255 (also known as Huainan Xueli Cangjin) was purchased from the Molv Horticulture Specialty Store on JD.com. Chinese cabbage inbred line 255 is a heat-sensitive variety of Chinese cabbage.
[0066] Chinese cabbage inbred line 256 was used as the female parent and Chinese cabbage inbred line 255 was used as the male parent to obtain the hybrid F1. Then, the hybrid F1 was self-pollinated to obtain the F2 segregating population. The F2 segregating population consisted of 154 F2 plants, which were named ZM1-ZM154.
[0067] Genotyping was performed on Chinese cabbage inbred line 256, Chinese cabbage inbred line 255, and 154 F2 generation plants based on the A06-14144455 locus using the method described in step three of Example 1. Some test results are shown below. Figure 1.
[0068] The genotypic results of Chinese cabbage inbred line 256, Chinese cabbage inbred line 255, and 154 F2 generation plants based on the A06-14144455 locus are shown in column 2 of Table 2. The results show that the genotype of Chinese cabbage inbred line 256 based on the A06-14144455 locus is homozygous TT; the genotype of Chinese cabbage inbred line 255 based on the A06-14144455 locus is homozygous CC; among the 154 F2 generation plants, 34 F2 generation plants are homozygous TT based on the A06-14144455 locus, 50 F2 generation plants are homozygous CC based on the A06-14144455 locus, and 70 F2 generation plants are heterozygous CT based on the A06-14144455 locus.
[0069] Table 2
[0070]
[0071]
[0072]
[0073]
[0074]
[0075] Note: Chinese cabbage inbred lines 256-1 to 256-5 are all Chinese cabbage inbred lines 256, and Chinese cabbage inbred lines 255-1 to 255-5 are all Chinese cabbage inbred lines 255.
[0076] 2. Test of heat resistance of Chinese cabbage
[0077] The heat resistance of Chinese cabbage was assessed using the total wilting rate. The specific testing steps are as follows:
[0078] (1) Spread the cabbage seeds of similar size on filter paper and incubate them at 25°C in the dark for 2 days (keep the filter paper moist during the incubation period) to obtain the germinating cabbage seeds.
[0079] (2) After completing step (1), select the cabbage seeds with basically the same germination status and sow them in flower pots containing an equal amount of nutrient soil. Sow 4 seeds in each flower pot.
[0080] (3) After completing step (2), place the flowerpot in a greenhouse and cultivate it at 22°C with alternating light and dark conditions (16 hours of light and 8 hours of darkness) for 20 days.
[0081] (4) After completing step (3), place the flowerpot in a greenhouse and cultivate it at 40°C with alternating light and dark conditions (16 hours of light and 8 hours of darkness) for 7 days, which is to carry out heat treatment.
[0082] (5) After completing step (4), investigate the wilting rate of each leaf and the total number of leaves for each cabbage plant to be tested; then
[0083] The total wilting rate of the cabbage to be tested is calculated using the following formula: Total wilting rate = ∑ 待测白菜每片叶片的萎蔫率 / Total number of leaves of the cabbage to be tested. Based on the total wilting rate of the cabbage to be tested, the following judgment is made: if the total wilting rate of the cabbage to be tested is <0.5, then the cabbage to be tested is heat-resistant; if the total wilting rate of the cabbage to be tested is ≥0.5, then the cabbage to be tested is heat-sensitive, that is, it does not have heat resistance.
[0084] The standards for recording leaf wilting rate are as follows: If the leaves show no symptoms, the wilting rate is 0.00; if only the leaf edges show slight curling or yellowing and wilting, the wilting rate is 0.25; if the leaves show obvious curling deformity or yellowing and wilting in some areas, the wilting rate is 0.50; if the entire leaf shows wrinkling deformity or most of the leaves show yellowing and wilting, the wilting rate is 0.75; if the entire leaf yellows and dies, the wilting rate is 1.00.
[0085] The total wilting rate and heat tolerance of Chinese cabbage inbred line 256, Chinese cabbage inbred line 255, and 154 F2 generation plants are shown in columns 3 and 4 of Table 2. The results show that Chinese cabbage inbred line 256 is heat-tolerant, while Chinese cabbage inbred line 255 is heat-sensitive, which is completely consistent with the expected results. Based on the genotype and heat tolerance identification results of 154 F2 generation plants at the A06-14144455 locus, it was found that among the 34 F2 generation plants with the TT homozygous genotype at the A06-14144455 locus, 32 F2 generation plants were heat-tolerant and 2 F2 generation plants were heat-sensitive, with an identification accuracy rate of 94%; among the 50 F2 generation plants with the CC homozygous genotype at the A06-14144455 locus, 40 F2 generation plants were heat-sensitive and 10 F2 generation plants were heat-tolerant, with an identification accuracy rate of 80%; and among the 70 F2 generation plants with the CT heterozygous genotype at the A06-14144455 locus, 61 F2 generation plants were heat-tolerant and 9 F2 generation plants were heat-sensitive, with an identification accuracy rate of 87%. The average accuracy rate of identification for the 154 F2 generation plants was 87%.
[0086] Therefore, the genotype at the A06-14144455 locus can be used to help identify the heat resistance of Chinese cabbage.
[0087] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. Primer set, consisting of upstream primer A06-14144455-X, upstream primer A06-14144455-Y and downstream primer A06-14144455-C; The upstream primer A06-14144455-X consists of fluorescent tag sequence A and the DNA fragment shown in positions 21 to 51 from the 5' end of SEQ ID NO:2; The upstream primer A06-14144455-Y consists of fluorescent tag sequence B and the DNA fragment shown in positions 22 to 52 from the 5' end of SEQ ID NO:3; The nucleotide sequence of the downstream primer A06-14144455-C is shown in SEQ ID NO:
4.
2. The primer set as described in claim 1, characterized in that: The nucleotide sequence of the fluorescent tag sequence A is shown as positions 1 to 20 from the 5' end of SEQ ID NO:2; The nucleotide sequence of the fluorescent tag sequence B is shown as positions 1 to 21 from the 5' end of SEQ ID NO:
3.
3. The application of the primer set according to claim 1 or 2 is any one of the following b1)-b3): b1) To assist in the identification of the heat resistance of the Chinese cabbage under test; b2) Assist in screening for cabbage varieties that are or are suspected of being heat-resistant; b3) Chinese cabbage breeding.
4. The application of DNA fragment 1 of SEQ ID NO:1 or DNA fragment 2 shown at positions 71-140 from the 5' end of SEQ ID NO:1 is any one of the following b1)-b4): b1) To assist in the identification of the heat resistance of the Chinese cabbage under test; b2) Assist in screening for cabbage varieties that are or are suspected of being heat-resistant; b3) Chinese cabbage breeding; b4) as a molecular marker to assist in identifying the heat resistance of the Chinese cabbage being tested.
5. A method for assisting in the identification of heat resistance in Chinese cabbage, comprising the following steps: detecting the genotype of the Chinese cabbage to be tested based on the A06-14144455 locus, and then making the following judgment: If the genotype of the Chinese cabbage to be tested is TT homozygous or CT heterozygous based on the A06-14144455 locus, then the Chinese cabbage to be tested has or is suspected of having heat resistance. If the genotype of the Chinese cabbage to be tested is CC homozygous based on the A06-14144455 locus, then the Chinese cabbage to be tested does not have or is suspected of not having heat resistance. The A06-14144455 position is the nucleotide at position 101 from the 5' end of SEQ ID NO:1 in the Chinese cabbage genome.
6. The method as described in claim 5, characterized in that: The steps for detecting the genotype of the Chinese cabbage to be tested based on the A06-14144455 locus are as follows: (1) Using the genomic DNA of the Chinese cabbage to be tested as a template, PCR amplification was performed using the primer set described in claim 1 or 2 to obtain the PCR amplification product; (2) After completing step (1), the fluorescence signal of the PCR amplification product is detected by an instrument, and the genotype of the Chinese cabbage to be tested based on the A06-14144455 site is obtained according to the color of the fluorescence signal.
7. The method as described in claim 5, characterized in that: The steps for detecting the genotype of the Chinese cabbage to be tested based on the A06-14144455 locus are as follows: (1) Using the genomic DNA of the Chinese cabbage to be tested as a template, PCR amplification was performed using the primer set described in claim 1 or 2 to obtain the PCR amplification product; (2) Take the PCR amplification product obtained in step (1) and sequence it; (3) Based on the sequencing results obtained in step (2), the genotype of the Chinese cabbage to be tested based on the A06-14144455 site is obtained.
8. A kit comprising a substance for detecting the genotype of a Chinese cabbage sample based on the A06-14144455 locus; The A06-14144455 position is the 101st nucleotide from the 5' end of SEQ ID NO:1 in the Chinese cabbage genome; The substance used to detect the genotype of the Chinese cabbage to be tested based on the A06-14144455 locus is the primer set described in claim 1 or 2.
9. The application of the kit according to claim 8 is any one of the following: b1)-b3) b1) To assist in the identification of the heat resistance of the Chinese cabbage under test; b2) Assist in screening for cabbage varieties that are or are suspected of being heat-resistant; b3) Chinese cabbage breeding.