A cotton chilling injury-related natural antisense transcript gene CAN1 and its application

Abstract

The invention discloses a cotton cold injury-related natural antisense transcript gene CAN1 (Cold-associated NAT 1), which is transcribed from the antisense strand of SnRK2.8, ​​and its sequence is shown as SEQ ID NO.2 in tetraploid upland cotton (G.hirsutum) TM-1, as shown in SEQ ID NO.3 in tetraploid sea island cotton (G.barbadense) H7124, and the conserved sequence between upland cotton and sea island cotton is shown as SEQ ID NO.1. The gene CAN1 of the invention can participate in the molecular regulation of cotton cold tolerance adaptability by regulating the expression of SnRK2.8, ​​and the chilling injury index and leaf damaged area of ​​upland cotton plants with VIGS silencing GhCAN1 are significantly reduced.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology application and relates to a cotton chilling injury-related natural antisense transcript gene CAN1 and an application thereof. Background Art

[0002] Cotton (Gossypium spp.), genus Gossypium, Malvaceae, is one of the most important cash crops in the world. It is an important strategic material related to my country's national economy and people's livelihood and an industrial raw material for the cotton textile industry. Although my country's cotton has certain comparative advantages in cost and output, as a major cotton producer and consumer in the world, the development prospects of my country's cotton industry are still not optimistic. In 2020, my country's cotton planting area fell to 3.17 million hectares, the lowest in nearly seven years. Cold stress is a common natural disaster in agricultural production, which can cause serious harm to plants, especially to cotton originating in tropical and subtropical areas. At present, in my country's main cotton producing areas, the early spring cold weather can cause large-scale replanting at the least, and reseeding at the worst, which seriously threatens the safety of cotton production. Chilling damage can change the permeability of plant cell membranes, resulting in different ion concentrations inside and outside cells; it can also induce a large amount of reactive oxygen in plant cells, causing peroxidation of DNA, lipids and other substances in plants, destroying metabolic balance, and causing metabolic disorders in plants. Freezing damage can cause ice to form inside and outside plant cells. The cell membrane is punctured by ice crystals and causes protein denaturation. In severe cases, it can lead to the death of plant tissues and organs. Low temperature stress has an important impact on the morphological characteristics, antioxidant system, osmotic regulation substances and key enzyme gene expression of plants. Therefore, how to improve the tolerance of cotton varieties to adverse stresses such as cold stress is of great significance to expanding the cotton planting area in my country. Breeding cotton varieties with tolerance to cold damage is an urgent requirement for cotton production in my country.

[0003] LncRNAs (long noncoding RNAs, lncRNAs) are a group of heterogeneous RNA molecules with a length ranging from 200nt to 100,000nt that are transcribed from intergenic regions or introns. Natural antisense transcripts (NATs) are an important class of long noncoding RNA molecules, usually 100 to several thousand base pairs in length, naturally generated from the antisense strand of sense transcripts (sense transcripts, STs), and usually regulate the expression of sense transcripts. NATs are widely present in animals, fungi, bacteria and plants. The latest studies have shown that NATs regulate the expression of coding genes at the transcriptional or post-transcriptional level. For transcriptional regulation, NATs and their paired genes may compete with RNA polymerase II (RNA Pol II) and transcription factors for effective binding, collide with RNA Pol II complexes during the elongation phase, or recruit DNA and histone modification complexes. For post-transcriptional regulation, NATs may affect the decay of mRNA by masking the bidding sites of miRNA or producing endogenous siRNA to perform RNA interference. Previous studies have shown that a large number of NATs are expressed under low temperature induction and play an important role in plant growth, development and stress response. For example, cold-induced FLC antisense transcripts play an early role in FLC epigenetic silencing, and the induction of these antisense transcripts is earlier than other vernalization marks and independent of other vernalization marks. MAF4 is a cold-responsive gene that participates in the prevention of precocious vernalization response. MAS activation of MAF4 depends on a complex involved in histone H3K4me3 modification, the COMPASS-like complex. MAS can bind to WDR5a, a core protein component in the COMPASS-like complex, and assist the complex in recruiting to the MAF4 gene locus, promoting H3K4me3 modification, thereby promoting MAF4 expression. In addition, both MAS and MAF4 are activated by low temperature and have the effect of inhibiting precocious flowering. SVALKA is a cold-responsive lncRNA transcribed on the antisense strand between CBF3 and CBF1, which can affect the expression and cold tolerance of CBF1 in Arabidopsis mutants. Mutations in SVALKA affect the expression of the CBF1 gene and the plant's cold resistance. SVALKA is mainly produced by the CBF1 proximal promoter, thereby inhibiting the transcription of CBF1 through RNA transcriptase II collision. The expression of chrysanthemum DglncTCP1 (a NAT of DgTCP1) is positively correlated with its homologous gene DgTCP1, and overexpression of DgTCP1 improves the cold tolerance of chrysanthemum.DglncTCP1 acts as a scaffold to recruit histone methyltransferase DgATX to DgTCP1 to increase the H3K4me3 level of DgTCP1, thereby activating the expression of DgTCP1, and DgTCP1 can directly target DgPOD, promote the expression of DgPOD, reduce the accumulation of ROS, and thus improve the cold tolerance of chrysanthemum. Therefore, analyzing the molecular function of NATs in cotton seedlings under low temperature stress is of great significance for improving the cold tolerance of cotton and guiding the improvement and breeding of cold-resistant cotton varieties. Summary of the invention

[0004] The purpose of the present invention is to provide a natural antisense transcript gene CAN1 which has a direct regulatory function on the cold tolerance of cotton, and to adjust the expression activity of the gene through genetic engineering to effectively achieve the purpose of improving the cold tolerance of cotton.

[0005] One of the purposes of the present invention is to provide a cotton natural antisense transcript cold tolerance adaptation regulatory gene CAN1, whose sequence is shown as SEQ ID NO.2 in tetraploid upland cotton (G. hirsutum) TM-1, as shown in SEQ ID NO.3 in tetraploid sea island cotton (G. barbadense) H7124, and the conserved sequence between upland cotton and sea island cotton is shown as SEQ ID NO.1.

[0006] The second purpose of the present invention is to provide a cloning method for the gene CAN1 and a recombinant plasmid.

[0007] The third purpose of the present invention is to provide engineering applications of the gene CAN1.

[0008] Specifically, the present invention provides the application of the gene CAN1 in improving the cold tolerance of cotton.

[0009] More specifically, the present invention provides the use of gene CAN1 in breeding new cold-resistant cotton varieties.

[0010] The purpose of the present invention is achieved through the following technical solutions:

[0011] A cotton chilling injury-related natural antisense transcript gene CAN1, the sequence of which is shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.

[0012] The present invention also provides a method for amplifying the gene CAN1, providing a set of primer pairs for amplifying the gene CAN1, and the amplification primer pairs used are as follows:

[0013] GL010F:ATTTCAATGCAGAAGCGAGGA

[0014] (as shown in SEQ ID NO.4);

[0015] GL010R:AGTGTGATAGTATTTATCCATGGCTTTC

[0016] (as shown in SEQ ID NO.5).

[0017] The present invention also provides a recombinant plasmid, which silences the cotton chilling injury-related natural antisense transcript gene CAN1 in cotton plants.

[0018] Furthermore, the vector of the recombinant plasmid is VIGS-TRV2, that is, the gene CAN1 sequence is connected to the intermediate vector VIGS-TRV2 to obtain the recombinant plasmid VIGS-TRV2-CAN1.

[0019] The present invention also provides the application of the gene CAN1, the amplification primer pair or the recombinant plasmid VIGS-TRV2-CAN1 in genetic engineering, especially in improving the cold resistance of cotton or in breeding new cold-resistant cotton varieties. The application of improving the cold resistance of cotton is specifically:

[0020] The cold tolerance of cotton is improved by silencing or knocking out the cotton cold damage-related natural antisense transcript gene CAN1 in cotton plants.

[0021] The application in breeding new cold-tolerant cotton varieties is specifically: constructing a silencing or knocking out vector of the cotton cold damage-related natural antisense transcript gene CAN1, transfecting wild-type cotton plants through transgenic or gene editing technology, and constructing new cold-tolerant cotton varieties.

[0022] In the method for constructing transgenic cotton of the present invention, the amplification primer pair used for amplifying the CAN1 gene is:

[0023] GL010F:ATTTCAATGCAGAAGCGAGGA

[0024] (as shown in SEQ ID NO.4);

[0025] GL010R:AGTGTGATAGTATTTATCCATGGCTTTC

[0026] (as shown in SEQ ID NO.5).

[0027] Beneficial effects of the present invention:

[0028] The molecular mechanism of plant cold tolerance mainly relies on the regulatory network with CBFs (C-repeat-binding factors) as the core. The sucrose non-fermenting 1-related proteinkinase family (SnRK) is closely related to abiotic stress adaptation. For example, OST1 / SnRK2.6 is induced to express by cold, which can phosphorylate ICE1 to enhance its stability and ability to bind to the CBF promoter, thereby promoting the expression of CBF. The natural antisense transcript in the present invention is transcribed from the antisense chain of SnRK2.8. SnRK2.8 is induced to express by cold stress in grapes, tea trees and wheat, and is positively correlated with cold tolerance. CAN1 improves the cold tolerance of cotton by regulating SnRK2.8.

[0029] The cloned gene is located in chromosome A02 of allotetraploid upland cotton and sea island cotton genomes, with a length of 4,104 bp in upland cotton and 4,039 bp in sea island cotton, and a conserved full length of 3,778 bp in upland and sea island cotton, located in the antisense strand of SnRK2.8. The gene structure is fully displayed for the first time.

[0030] After 48 hours of chilling treatment of upland cotton, plants with GhCAN1 silenced by VIGS showed obvious chilling tolerance phenotypes, as shown by reduced leaf damage area, fewer charred leaves after rewarming, and low plant wilting, while plants with GhSnRK2.8 silenced by VIGS showed obvious chilling sensitivity phenotypes. Further analysis of expression changes revealed that the expression level of GhCAN1 decreased in plants with GhCAN1 silenced by VIGS, while the expression level of GhSnRK2.8 increased. These preliminary data indicate that the natural antisense transcript gene GhCAN1 can regulate GhSnRK2.8 to participate in the molecular regulation of cotton cold tolerance adaptation, and that cotton chilling tolerance can be improved by silencing or knocking out GhCAN1. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 :Gene structure and expression abundance of CAN1 and sense strand gene SnRK2.8 in upland cotton (GhCAN1 and GhSnRK2.8) and sea island cotton (GbCAN1 and GbSnRK2.8);

[0032] Figure 2 : Sequence similarity of CAN1 in G. hirsutum (GhCAN1) and G. barbadense (GbCAN1);

[0033] Figure 3: Expression characteristics of CAN1 and sense strand gene SnRK2.8 before and after chilling injury in upland cotton (GhCAN1 and GhSnRK2.8) and sea island cotton (GbCAN1 and GbSnRK2.8);

[0034] Figure 4 :q-PCR detection of the expression changes of GhCAN1 and GhSnRK2.8 after VIGS silencing in upland cotton;

[0035] Figure 5 : Phenotypic changes of upland cotton plants silencing GhCAN1 and GhSnRK2.8 by VIGS after cold treatment;

[0036] Figure 6 : Changes in leaf damage phenotype of upland cotton plants with VIGS silencing of GhCAN1 and GhSnRK2.8 under cold treatment;

[0037] Figure 7 :Determination of cotton chilling injury indexes and leaf damage area after inhibiting the expression of GhCAN1 and GhSnRK2.8 in upland cotton. DETAILED DESCRIPTION

[0038] Example 1 Obtaining genes

[0039] The data of chain-specific total RNA sequencing of leaf tissues of allotetraploid upland cotton (G. hirsutum, AD1) and sea island cotton (G. barbadense, AD2) after control (28℃) and cold treatment (4℃) were analyzed. After filtering the raw sequencing data, a total of 305.92 and 320.08 million high-quality sequencing sequences (clean reads) were obtained from upland cotton and sea island cotton, respectively. 91.27% and 88.92% of cleads reads could be completely aligned to their respective reference genomes, and 82,144 and 83,366 genomic sites were aligned, respectively. After filtering low-expression transcripts, 38,054 coding genes, 3,596 long non-coding RNAs and 815 natural antisense transcripts were obtained in upland cotton, and 36,461 coding genes, 2,839 long non-coding RNAs and 689 natural antisense transcripts were obtained in sea island cotton, respectively. Based on sequence homology comparison and genome-wide colinearity analysis, a total of 1,123 homologous lncRNAs and 224 homologous NATs were obtained in the genomes of upland cotton and sea island cotton. It was found that one of the highly expressed NAT genes, CAN1 ( Figure 1) is cold-induced in both upland cotton and sea island cotton. CAN1 is located in the antisense strand of the gene encoding serine / threonine protein kinase (SnRK2.8). The SnRK family has been previously reported to be associated with cold tolerance. According to the spliced ​​CAN1 full-length sequence, its sequence GhCAN1 in tetraploid upland cotton (G. hirsutum) TM-1 is shown as SEQ ID NO.2, and GbCAN1 in tetraploid sea island cotton (G. barbadense) H7124 is shown as SEQ ID NO.3.

[0040] Example 2 Gene structure of cotton natural antisense transcript gene CAN1

[0041] CAN1 has no introns in the genomes of upland cotton and sea island cotton ( Figure 1 ), the full length in upland cotton is 4,104 bp as shown in SEQ ID NO.2, the full length in sea island cotton is 4,039 bp as shown in SEQ ID NO.3, and the conservative sequence length is 3,778 bp as shown in SEQ ID NO.1 ( Figure 2 ). This gene is located in the A subgroup of the genome of allotetraploid upland cotton and sea island cotton, and the corresponding position of diploid Asiatic and allotetraploid upland cotton and sea island cotton D subgroups cannot produce active transcripts, indicating that the natural antisense transcript may be produced from the A subgroup after tetraploid cotton hybridization and polyploidization.

[0042] Example 3 Expression characteristics of CAN1 in tetraploid cotton genome

[0043] CAN1 is located on chromosome A02 of the allotetraploid upland cotton genome. CAN1 is located on the antisense strand of SnRK2.8 ( Figure 1 SnRK2.8 encodes a serine / threonine protein kinase, which belongs to the sucrose non-fermenting 1-related protein kinase (SnRK) family. SnRK is widely present in plants and participates in the regulation of various endogenous hormone signals, especially in ABA signal transduction, and plays an important role in plant drought tolerance, salt tolerance and cold tolerance. OST1 / SnRK2.6 modifies ICE1 by phosphorylation, enhances its protein stability, and promotes ICE1 to bind to the CBF promoter to activate CBF expression, thereby enhancing plant cold tolerance.

[0044] Analysis of cotton leaf transcriptome expression data before and after cold treatment showed that in both sea island cotton and upland cotton, SnRK2.8 was actively expressed before cold treatment, while CAN1 was expressed at a low level. After cold treatment, CAN1 was actively expressed, while the expression level of SnRK2.8 was significantly reduced ( Figure 1 and Figure 3). This result indicates that CAN1 responds to cold stress and may interfere with the expression of SnRK2.8, ​​thereby playing an important role in the regulation of cold tolerance.

[0045] Example 4 Effects of genes on cold tolerance in cotton

[0046] 1. Cold-tolerant phenotype of cotton seedlings by transient transgenic silencing of GhCAN1 and GhSnRK2.8 expression

[0047] 1.1 Experimental Materials

[0048] The plant material was the allotetraploid upland cotton genetic standard line TM-1 (G. hirsutum, Texas Marker-1, TM-1). The plant growth chamber conditions were 22°C, and the photoperiod conditions were 14 hours of light / 10 hours of darkness. The experimental treatments were selected from seedlings that were 7-10 days after germination, with fully expanded cotyledons but no true leaves. The treatment was carried out with Agrobacterium strain GV3101. Escherichia coli DH5α was used in the vector construction stage.

[0049] 1.2 Experimental methods

[0050] 1.2.1 Construction of virus induced gene silencing (VIGS) vector.

[0051] Primers (primers and sequences) were designed based on the conserved region of GhCAN1, and PCR amplification was performed using cotton leaf cDNA as a template.

[0052] Primer sequences:

[0053] GL010F: 5'ATTTCAATGCAGAAGCGAGGA 3' (as shown in SEQ ID NO. 4)

[0054] GL010R: 5'AGGTGATAGTATTTATCCATGGCTTTC 3' (as shown in SEQ ID NO. 5)

[0055] Primers (primers and sequences) were designed based on the conserved region of GhSnRK2.8, ​​and PCR amplification was performed using cotton leaf cDNA as a template.

[0056] Primer sequences:

[0057] GL011F: 5'GACCCATGCTTCCTCTCATGG 3' (as shown in SEQ ID NO.6)

[0058] GL011R: 5'AGAATAACTATACCAGAAATTAGAAGCCA 3' (as shown in SEQ ID NO.7)

[0059] PCR reaction system:

[0060]

[0061] PCR amplification conditions: 94°C pre-denaturation for 2 min, 98°C denaturation for 10 sec, 57°C annealing for 5 sec, 68°C extension for 20 sec, for a total of 34 cycles.

[0062] After sequencing to confirm that the amplified DNA fragments were correct, they were digested with restriction endonucleases EcoRI and BamHI, and connected to the VIGS-TRV2 vector for transformation of Escherichia coli DH5α. After the positive clones obtained by transformation were confirmed to be correct by PCR and sequencing, the vectors were named VIGS-TRV2-GhCAN1 and VIGS-TRV2-GhSnRK2.8, ​​and plasmid DNA was extracted and transformed into Agrobacterium strain GV3101 as the next experimental strain. Each group of treatment and control group materials was designed with 16 individual strains. The experiment was repeated 3 times, one of which was a double-blind experiment, that is, the experimenter was not clear about the experimental vector information.

[0063] 1.2.2 Agrobacterium infection

[0064] The GV3101 bacterial solution transformed with VIGS-TRV2-GhCAN1 vector and VIGS-TRV2-GhSnRK2.8 was cultured overnight until the bacterial concentration reached OD 600 =1.5-2.0, and then mixed with TRV1 carrier bacterial solution at equal concentrations. The positive control of the experiment used CLA1 vector and PGF vector, which have inhibitory effects on chlorophyll synthesis and cotton gland formation respectively. The mixed bacterial solution was injected into the back of the cotyledons of the cotton seedlings with a syringe. The culture was carried out in an artificial climate room with a constant temperature of 22°C and long daylight (light period of 14h, dark period of 10h).

[0065] 1.2.3 Observation of gene silencing phenotype

[0066] After 3-4 weeks of Agrobacterium infection, the plants in the positive control CLA1 group began to show whitening of the main leaf veins and the positive control PGF group showed the phenomenon of gland-free stems, and the growth and development of the plants were observed. For plants with consistent growth conditions, primers were designed according to the VIGS silencing fragment region, and the expression of GhCAN1 and GhSnRK2.8 was detected by relative quantitative PCR. Plants with significantly inhibited expression of GhCAN1 and GhSnRK2.8 were screened out, and low-temperature treatment of 4°C was adopted. The appearance of the plants was observed after 2 days of low-temperature treatment.

[0067] 1.2.4 Identification of chilling injury phenotype

[0068] According to the morphological characteristics of the plants and the degree of leaf damage and shedding, the chilling injury grade of each plant was counted, and the chilling injury plants in a group of treatments were calculated. The second unfolded leaf of each plant was selected, and the damaged area of ​​the leaf was counted using imageJ.

[0069] Grading standard: The chilling injury symptoms of cotton leaves were graded according to Semeniuk's method. Grade 0: No damage symptoms, cotton seedling leaves are normal; Grade 1: About 10% of the seedling leaves are dehydrated or wilted; Grade 2: Less than half of the seedling leaves are dehydrated or wilted; Grade 3: More than half of the seedling leaves are dehydrated or wilted; Grade 4: All seedling leaves are wilted or dehydrated.

[0070] 1.3 Experimental Results

[0071] Virus induced gene silencing (VIGS) was used to interfere with the expression of GhCAN1 and GhSnRK2.8 in cotton seedlings to achieve transient transgenic effects, and the VIGS-treated cotton seedlings were subjected to a low temperature treatment of 4°C. qRT-PCR analysis showed that after transgenic interference with GhCAN1 expression by VIGS, GhCAN1 expression was relatively reduced ( Figure 4 a), and the expression level of GhSnRK2.8 increased after silencing GhCAN1 ( Figure 4 b); After GhSnRK2.8 expression was interfered by transgenic VIGS, the expression of GhSnRK2.8 was relatively reduced ( Figure 4 b), and the expression level of GhCAN1 was significantly reduced after silencing GhSnRK2.8 ( Figure 4 a). These results indicate that VIGS technology successfully silenced the target gene and that GhCAN1 may negatively regulate the expression of GhSnRK2.8. After 2 days of low temperature, the plants with VIGS interference with GhCAN1 showed stronger cold tolerance than the control group ( Figure 5 ), the damaged area of ​​plant leaves was reduced ( Figure 5 ); Plants with VIGS interference with GhSnRK2.8 showed weaker cold tolerance than the control group ( Figure 5 ), the damaged area of ​​plant leaves increased significantly ( Figure 6 ).

[0072] 2. Determination of chilling injury indicators in plants with silencing of GhCAN1 and GhSnRK2.8 expression

[0073] After the low-temperature treatment of each cotton seedling was completed, it was placed at room temperature to recover for 2 days. Then the number of cotton leaves at each level was recorded according to the chilling injury symptom grading standard, and the chilling injury index of each cotton variety (line) was calculated.

[0074] The calculation formula of chilling damage index is: Among them, S in the formula i is the chilling injury level, n is the number of leaves corresponding to the chilling injury level, and N is the total number of leaves investigated. ImageJ was used to calculate the percentage of damaged area of ​​the second leaf of the chilling injury plant. The results showed that the chilling injury index of the plant after silencing GhCAN1 was significantly lower than that of the control, indicating that silencing GhCAN1 improved the chilling tolerance of plants ( Figure 7 a). Moreover, the percentage of damaged leaf area in the second leaf after silencing GhCAN1 was significantly lower than that in the control ( Figure 7 b). These results indicate that GhCAN1 negatively regulates cotton cold tolerance. In addition, after silencing GhSnRK2.8, ​​the chilling injury index and damaged area of ​​the plants increased significantly, indicating that the plants were more chilling sensitive ( Figure 7 ).

[0075] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the present invention.

Claims

1. Silencing cotton chilling injury-related natural antisense transcript genes CAN1 Application in improving the cold tolerance of tetraploid upland cotton, specifically: silencing the cotton cold injury-related natural antisense transcript gene in the cotton plant CAN1 , improve the cold tolerance of cotton; the cotton cold injury related natural antisense transcript gene CAN1 The sequence is shown as SEQ ID NO.

2.

2. Application of a recombinant plasmid in improving the cold tolerance of tetraploid upland cotton, characterized in that: The recombinant plasmid silences cotton chilling injury-related natural antisense transcript genes in cotton plants CAN1 , the cotton chilling injury-related natural antisense transcript gene CAN1 The sequence is shown as SEQ ID NO.

2.

3. The use according to claim 2, characterized in that: The vector of the recombinant plasmid is VIGS-TRV2.

4. Silencing cotton chilling injury-related natural antisense transcript genes CAN1 The application in breeding new cold-resistant cotton varieties is characterized by: Silencing of cotton chilling injury-related natural antisense transcripts in tetraploid upland cotton plants CAN1 , improve the cold tolerance of cotton; the cotton cold injury related natural antisense transcript gene CAN1 The sequence is shown as SEQ ID NO.

2.

5. A method for constructing a new cold-tolerant tetraploid upland cotton variety, characterized in that: Specifically: Construction of cotton chilling injury-related natural antisense transcript genes CAN1 Silencing or knocking out the vector, transfecting tetraploid upland cotton through transgenic or gene editing technology, and constructing a new cold-resistant tetraploid upland cotton variety; the cotton cold injury-related natural antisense transcript gene CAN1 The sequence is shown as SEQ ID NO.2.

Images