A co-dominant SSR marker tightly linked to tobacco leaf number gene qLN and its application

Abstract

The present invention discloses a co-dominant SSR marker tightly linked to a tobacco leaf number gene qLN and an application thereof. The co-dominant SSR marker tightly linked to the tobacco leaf number gene qLN is numbered PT51248 and TM51844, and the nucleotide sequences of the PCR amplification products thereof are shown in SEQ ID No.1 and SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4, respectively. The application is the application of the co-dominant SSR marker tightly linked to the tobacco leaf number gene qLN in detecting whether the tobacco leaf number gene qLN exists in tobacco genomic DNA. The co-dominant SSR marker of the present invention is stable, reliable, simple, fast and low-cost, so the molecular marker can be used as an application of molecular marker-assisted selection of the leaf number gene qLN in tobacco yield breeding.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a co-dominant SSR marker tightly linked to a tobacco leaf number gene qLN and an application thereof. Background Art

[0002] Tobacco is a leaf-type cash crop, and the number of its leaves is an important factor in economic yield. Studies have shown that the number of plant leaves is a quantitative trait controlled by multiple genes and affected by the growth environment. It is difficult to genetically transfer the leafy trait to the mainstream varieties currently cultivated on a large scale in production to increase leaf yield. In order to increase tobacco leaf yield, Lewis et al. used wild tobacco (Tomentosa) with multi-leaf traits to perform distant hybridization with cultivated tobacco, and then obtained tobacco materials with genetically stable multi-leaf traits through chromosome doubling technology and multiple generations of backcrossing. Based on this material, the major QTLs controlling the multi-leaf trait were located in the 3.1 cM region between AFLP markers M1 and M5, and AFLP markers M1 and M5 were used for molecular marker-assisted selection breeding of the multi-leaf trait at the seedling stage (Lewis RS, Milla SR, Kernodle SP, Analysis of an introduced Nicotiana tomentosa genomic region affecting leaf number and correlated traits in Nicotiana tabacum. Theor Appl Genet, 2007, 114: 841-854). However, the accuracy of the QTL positioning results is not high, and the positioning range of the leafy gene is relatively large (the genetic distance between the markers on both sides (M1 and M5) linked to it is as high as 3.1cM), and the AFLP markers are too cumbersome and expensive in practical application. As a result, the leaf number gene / QTL-related markers have not been used in tobacco high-yield (leafy) traits so far. Summary of the invention

[0003] The first purpose of the present invention is to provide a co-dominant SSR marker tightly linked to the tobacco leaf number gene qLN; the second purpose is to provide the application of the co-dominant SSR marker tightly linked to the tobacco leaf number gene qLN.

[0004] The present invention is implemented by the following technical solution.

[0005] A co-dominant SSR marker tightly linked to a tobacco leaf number gene qLN. The co-dominant SSR marker tightly linked to a tobacco leaf number gene qLN of the present invention is numbered PT51248 and TM51844, and the nucleotide sequences of the amplified products thereof are shown in SEQ ID No.1 and SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4, respectively.

[0006] The primer sequences of the two sites corresponding to the molecular markers described in the present invention are:

[0007] The T51248 sequence is:

[0008] PT51248F: 5'-TGGTAGAATTCGGTTTCGAGAT-3' (SEQ ID NO.5),

[0009] PT51248R: 5'-TCGAGTAGCGTTGATTTGGA-3' (SEQ ID NO. 6);

[0010] The TM51844 sequence is:

[0011] TM51844F: 5'-GCCACAACAACTCACCACTG-3' (SEQ ID NO.7),

[0012] TM51844R: 5'-GAAGGGCTGACAATCCAAGA-3' (SEQ ID NO. 8).

[0013] The application of the above-mentioned co-dominant SSR marker tightly linked to the tobacco leaf number gene qLN of the present invention is characterized in that the co-dominant SSR marker tightly linked to the tobacco leaf number gene qLN is used to detect whether the tobacco leaf number gene qLN exists in tobacco genomic DNA.

[0014] The application steps of the present invention include: respectively amplifying the tobacco genome DNA to be detected with primers of PT51248 sequence and primers of TM51844 sequence,

[0015] The T51248 sequence is:

[0016] PT51248F: 5'-TGGTAGAATTCGGTTTCGAGAT-3' (SEQ ID NO.5),

[0017] PT51248R: 5'-TCGAGTAGCGTTGATTTGGA-3' (SEQ ID NO. 6);

[0018] The TM51844 sequence is:

[0019] TM51844F: 5'-GCCACAACAACTCACCACTG-3' (SEQ ID NO.7),

[0020] TM51844R: 5'-GAAGGGCTGACAATCCAAGA-3' (SEQ ID NO. 8);

[0021] Detect PCR amplification products; analyze PCR amplification products.

[0022] The PCR amplification product of the present invention is: if the PCR amplification product contains a sequence as shown in SEQ ID No. 1 or SEQ ID No. 3, it indicates that the tobacco plant to be tested contains the dominant homozygous gene qLNqLN for leaf number that can increase tobacco yield.

[0023] The PCR amplification product of the present invention is: if the PCR amplification product contains the sequences shown in SEQ ID No. 2 and SEQ ID No. 4, it is the recessive homozygous allele qlnqln containing the normal leaf number.

[0024] The above-mentioned PCR amplification product of the present invention is: if the PCR amplification product is analyzed to contain the sequences shown in SEQ ID NO.1 and SEQ ID NO.2, or contains the sequences shown in SEQ ID NO.3 and SEQ ID NO.4, or contains the sequences shown in SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.4, or contains the sequences shown in SEQ ID NO.3, SEQ ID NO.1 and SEQ ID NO.2, it is a heterozygous gene qLNqln for high tobacco leaf number yield.

[0025] Compared with the prior art, the present invention has the following beneficial effects: in order to simply and efficiently select tobacco leaf number varieties with high yield potential, the present invention provides molecular markers PT51248 and TM51844 for detecting tobacco leaf number gene qLN, the molecular markers adopt quantitative trait linkage analysis (QTL) method, and screen and obtain co-dominant SSR markers linked to tobacco leaf number gene qLN in the whole tobacco genome, which can be used for auxiliary selection of leaf number trait gene qLN, so as to improve the efficiency of molecular marker assisted selection and the efficiency of breeding of leafy and high-yield tobacco varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The tobacco recombinant inbred line population (RILs_F 7：8 ; QTL analysis curve of leaf number traits of Honghua Dajinyuan×Beinhart1000-1).

[0027] Among them, the QTL positioning software is: WinQTLCart v2.5; parameter settings: positioning method is CIM: Composite Interval Mapping QTL, the number of iterations is 1000 (Permutation times = 1000), the significance is 0.01 (Significance = 0.01), and the step size is 0.5 cM (Walk speed = 0.5 cM). The horizontal axis in the figure is the genetic distance (unit: centimorgan cM); the vertical axis is the LOD value. The horizontal dotted line in the figure is the LOD value = 4.3 at the significance threshold of 0.01; the highest point of the LOD curve is the main effect gene / QTL (qLN17) of the tobacco leaf number trait. DETAILED DESCRIPTION

[0028] The present invention will be further described below in conjunction with the examples and drawings, but the present invention is not limited in any way, and any changes or substitutions made based on the teachings of the present invention belong to the protection scope of the present invention. If no specific techniques or conditions are indicated in the examples, the techniques or conditions described in the literature in this area or the product instructions are used. If the manufacturer of the reagents or instruments used is not indicated, they are all conventional products that can be purchased.

[0029] The present invention uses the cigar tobacco variety Beinhart1000-1 (having a stable multi-leaf trait) and the flue-cured tobacco variety Honghua Dajinyuan (having a normal number of leaves) to construct a tobacco recombinant inbred line (RILs_F) containing 341 strains. 7：8 ) was used as the mapping population and quantitative trait linkage analysis (QTL) was used to screen for co-dominant SSR markers linked to the tobacco leaf number gene qLN, so as to accelerate the use of molecular marker-assisted selection (MAS) in the breeding of leafy and high-yielding tobacco varieties.

[0030] The co-dominant SSR marker of the present invention is stable, reliable, simple, fast and low-cost, so the molecular marker can be used as a molecular marker-assisted selection for the qLN gene in tobacco leafy and high-yield breeding.

[0031] The co-dominant SSR markers tightly linked to the tobacco leaf number gene qLN of the present invention are numbered PT51248 and TM51844, and the nucleotide sequences of the PCR amplification products thereof are shown in SEQ ID No.1 and SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4, respectively.

[0032] The primer sequences of the two sites corresponding to the molecular markers are:

[0033] The PT51248 sequence is:

[0034] PT51248F: 5'-TGGTAGAATTCGGTTTCGAGAT-3',

[0035] PT51248R: 5'-TCGAGTAGCGTTGATTTGGA-3';

[0036] The TM51844 sequence is:

[0037] TM51844F: 5'-GCCACAACAACTCACCACTG-3',

[0038] TM51844R: 5'-GAAGGGCTGACAATCCAAGA-3'.

[0039] The application of the codominant SSR marker tightly linked to the tobacco leaf number gene qLN described in the present invention is the application of the codominant SSR marker tightly linked to the tobacco leaf number gene qLN in detecting whether the tobacco leaf number gene qLN exists in tobacco genomic DNA.

[0040] The application of the co-dominant SSR marker tightly linked to the tobacco leaf number gene qLN is to amplify the tobacco genomic DNA to be detected with primers of PT51248 sequence and primers of TM51844 sequence respectively, and detect the PCR amplification product. If the PCR amplification product contains the sequence shown in SEQ ID No.1 or SEQ ID No.3, it means that the tobacco plant contains the dominant homozygous gene qLNqLN for leaf number that can increase tobacco yield; if the PCR amplification product contains the sequence shown in SEQ ID No.2 or SEQ ID No.4, it means that the tobacco plant contains the recessive homozygous allele qlnqln for normal leaf number; if the PCR amplification product contains the sequence shown in SEQ ID NO.1 and SEQ ID NO.2, or contains the sequence shown in SEQ ID NO.3 and SEQ ID NO.4, or contains the sequence shown in SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.4, or contains the sequence shown in SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.4, The sequence shown in NO.2 is the heterozygous gene qLNqln for high tobacco leaf yield in the plant.

[0041] The present invention is further described below with specific implementation cases:

[0042] Example 1

[0043] Using quantitative trait linkage analysis (QTL) method, co-dominant SSR markers linked to the tobacco leaf number-related trait gene qLN were screened in the whole tobacco genome.

[0044] 1. Experimental Materials: Honghua Dajinyuan, a flue-cured tobacco variety with excellent comprehensive traits and normal leaf number, was used as the female parent, and Beinhart1000-1, a cigar tobacco variety with a large leaf number and high yield (its leafy trait is controlled by the qLN gene), was used as the male parent. Through hybridization and continuous self-pollination, 341 recombinant inbred lines (RILs_F 7：8 ) as a genetic mapping population.

[0045] 2. Parents and RILs_F 7：8 Obtaining phenotypic data of leaf number traits of population

[0046] The leaf number trait survey was conducted in accordance with the tobacco industry standard YC / T 369-2-10. The specific measurement method is as follows:

[0047] After the test materials are grown into seedlings, they are transplanted to the field. When the tobacco plants begin to bud, the number of natural leaves of the whole tobacco plant is counted, that is, the number of all leaves from the base of the tobacco plant to the first fruit branch (flower branch) is counted. The statistical results of the number of leaves in the field show that:

[0048] Normal number of leaves (i.e., equivalent to that of Red Flower Dajinyuan): 28 (variable range: 25-35);

[0049] Number of leaves (i.e., equivalent to the number of leaves of Beinhart1000-1): 52 (range: 46-68);

[0050] Plants with 30 or less leaves (≤30) were defined as normal-leaf plants, and plants with 50 or more leaves (≥50) were defined as multi-leaf plants.

[0051] 3. SSR marker analysis

[0052] Extraction of tobacco genomic DNA: Either the conventional CTAB method or a plant tissue DNA extraction kit can be used. The method can be referred to in existing literature or the instructions in the kit.

[0053] PCR amplification and electrophoresis detection: The PCR amplification system is a conventional system and can refer to published literature; in the PCR amplification procedure, the annealing temperature of the above two pairs of primers is 57°C, and the specific PCR amplification procedure information can be referred to relevant literature; electrophoresis detection also adopts conventional methods, and can refer to published relevant literature.

[0054] Using SSR markers developed in our laboratory, 341 RILs_F 7：8 The samples were subjected to genotyping and linkage analysis, and a high-quality tobacco SSR genetic linkage map was drawn, which contained 24 linkage groups and 1974 evenly distributed SSR markers, covering a tobacco genome length of 3213.138 cM. This map and the genotype values ​​of SSR markers were used as RILs_F7：8 The genotype values ​​of the population were used for the next step of QTL linkage analysis.

[0055] 4. Genome-wide QTL analysis of tobacco leaf number trait gene (qLN)

[0056] The QTL location analysis software WinQTLCart v2.5 was used to analyze the RILs_F 7：8 The genotype and phenotypic data of the population were used to perform a genome-wide QTL scan on the tobacco leaf number trait gene qLN. Among them, the relevant parameters were set as follows: the positioning method selected CIM: Composite Interval Mapping QTL, the number of iterations was 1000 (Permutation times = 1000), the significance was 0.01 (Significance = 0.01), and the step size was 0.5cM (Walk speed = 0.5cM). Finally, under the condition of LOD = 4.3 in the whole genome, a major effect QTL (named qLN17) for tobacco leaf number traits for three consecutive years (2020, 2021 and 2022) was located at 86.90cM in linkage group 17. This major QTL can explain about 12.55% (qLN17, 2022) to 21.46% (qLN17, 2020) of the phenotypic variation, and the LOD value is about 13.57 (qLN17, 2022) to 27.08 (qLN17, 2020). For details, see Figure 1 and Table 1.

[0057] Table 1 Statistics of QTL (qLN) information for tobacco leaf number traits

[0058]

[0059] Example 2

[0060] Co-dominant linkage markers in RILs_F 8：9 Verification in individual plants of the population

[0061] Firstly, codominant SSR markers PT51248 and TM51844, which were closely linked to the leaf number trait gene qLN on both sides of the tobacco seedlings, were used to identify RILs_F 8：9 The genotype of each plant in the population (Honghua Dajinyuan×Beinhart1000-1) was analyzed to obtain RILs_F 8：9 The genotype data of each individual plant in the population were obtained. Secondly, the leaf number traits of each strain were measured according to the tobacco industry standard YC / T 369-2-10. Finally, 341 RILs_F 8：9The genotype data of the population and the phenotypic value of the leaf number trait found that the genotype values ​​and phenotypic values ​​of the two co-dominant SSR markers PT51248 and TM51844 published in the present invention were completely consistent with each other, that is, the consistency rate reached 100%. The specific analysis method is: when the natural leaf number phenotypic value of each strain obtained by measurement is higher than or equal to the high-value parent Beinhart1000-1, the genotype of the strain also simultaneously presents the sequences shown in SEQ ID NO.1 (147bp) and SEQ ID NO.3 (254bp), that is, the strain contains the dominant homozygous gene qLNqLN for leaf number that can increase tobacco yield; when the natural leaf number phenotypic value of each strain obtained by identification is equal to or lower than the low-value parent Honghua Dajinyuan, the genotype of the strain also simultaneously presents the sequences shown in ID NO.2 (143bp) and SEQ ID The sequence shown in NO.4 (251bp) means that the strain contains the recessive homozygous allele qlnqln of normal leaf number; and when the natural leaf number phenotypic values ​​of each strain obtained by identification are between the low-value parent Honghua Dajinyuan and the high-value parent Beinhart1000-1, that is, close to the first generation (F1), the genotype of the strain also simultaneously presents the sequences shown in SEQ ID NO.1 and SEQ ID NO.2, or contains the sequences shown in SEQ ID NO.3 and SEQ ID NO.4, or contains the sequences shown in SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.4, or contains the sequences shown in SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.4, or contains the sequences shown in SEQ ID NO.3, SEQ ID NO.1 and SEQ ID NO.2, which means that the strain contains the heterozygous gene qLNqln of high tobacco leaf number.

[0062] The above results show that the co-dominant markers PT51248 and TM51844 are closely linked to the tobacco leaf number trait gene qLN, respectively. The two markers are located on both sides of the target gene / QTL (qLN17), and the genetic distance between the two markers is about 0.61cM. Using the above two co-dominant closely linked SSR markers, not only can the leaf number trait of tobacco seedlings be accurately, efficiently, conveniently and at low cost identified, but also the leaf number trait genotype status in the tested plants can be clearly identified, which not only improves the scientificity and predictability of the breeding of new tobacco varieties with multi-leaf and high-yield traits, but also accelerates the breeding process.

[0063] SEQ ID NO.1:

[0064] TGGTAGAATTCGGTTTCGAGATCAGAATTCTATCACTACTTTTTCGATGAATTCGAAATCTATTTTATATATATATATATATATATATATACTTACTAAATAAATCTTTTAACATATATATAATATCCAAATCAACGCTACTCGA

[0065] SEQ ID NO.2:

[0066] TGGTAGAATTCGGTTTCGAGATCAGAATTCTATCACTACTTTTTCGATGAATTCGAAATCTATTTTATATATATATATATATATATACTTACTAAATAAATCTTTTAACATATATATAATATCCAAATCAACGCTACTCGA

[0067] SEQ ID NO.3:

[0068] GCCACAACAACTCACCACTGTAAAATATCATAAACTACCTTCAAATATGTTCACAAACTCCATATAAAATCACTTTCACCGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAAGAGGAGGAAAATGTTTGAAGCTGTTTAAAAAGTAGGTACAAGTTAAAAAAAAAATAAAAAATGAGTACATATTAATGAGGACGACCAAATAACGCGCCGGTGCAATTTTTACACTCTTGGATTGTCAGCCCTTC

[0069] SEQ ID NO.4:

[0070] GCCACAACAACTCACCACTGTAAAATATCATAAACTACCTTCAAATATGTTCACAAACTCCATATAAAATCACTTTCACCGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAAGAGGAGGAAAATGTTTGAAGCTGTTTAAAAAGTAGGTACAAGTTAAAAAAAAAATAAAAAATGAGTACATATTAATGAGGACGACCAAATAACGCGCCGGTGCAATTTTTACACTCTT

[0071] GGATTGTCAGCCCTTC

[0072] SEQ ID NO.5:

[0073] TGGTAGAATTCGGTTTCGAGAT

[0074] SEQ ID NO.6:

[0075] TCGAGTAGCGTTGATTTGGA

[0076] SEQ ID NO.7:

[0077] GCCACAACAACTCACCACTG

[0078] SEQ ID NO.8:

[0079] GAAGGGCTGACAATCCAAGA

[0080] The above are only some specific embodiments of the present invention. The known specific contents or common sense in the scheme are not described in detail here (including but not limited to abbreviations, abbreviations, and units commonly used in the art). It should be pointed out that the above embodiments do not limit the present invention in any way. For those skilled in the art, all technical solutions obtained by equivalent replacement or equivalent transformation fall within the protection scope of the present invention. The scope of protection required by this application shall be based on the content of its claims, and the specific implementation methods and other records in the specification can be used to interpret the content of the claims.

Claims

1. A co-dominant SSR marker tightly linked to the tobacco leaf number gene qLN, characterized in that: The co-dominant SSR markers tightly linked to the tobacco leaf number gene qLN are numbered PT51248 and TM51844, and their nucleotide sequences are shown in SEQ ID No. 1 and SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4, respectively.

2. The co-dominant SSR marker tightly linked to the tobacco leaf number gene qLN according to claim 1, characterized in that: The primer sequences of the two sites corresponding to the molecular markers are: The primer sequence of PT51248 is: PT51248F: 5'-TGGTAGAATTCGGTTTCGAGAT-3'; PT51248R: 5'-TCGAGTAGCGTTGATTTGGA-3'; The primer sequence of TM51844 is: TM51844F: 5'-GCCACAACAACTCACCACTG-3'; TM51844R: 5'-GAAGGGCTGACAATCCAAGA-3'.

3. The use of a co-dominant SSR marker tightly linked to the tobacco leaf number gene qLN as claimed in claim 1 or 2, characterized in that: The co-dominant SSR marker tightly linked to the tobacco leaf number gene qLN is used in detecting whether the tobacco leaf number gene qLN exists in tobacco genomic DNA.

4. The use of a co-dominant SSR marker tightly linked to the tobacco leaf number gene qLN according to claim 3, characterized in that: The application steps include: respectively amplifying the tobacco genome DNA to be detected with primers of PT51248 sequence and primers of TM51844 sequence, Detect PCR amplification products; analyze PCR amplification products.

5. The use according to claim 4, characterized in that: The analysis of the PCR amplification product is: if the PCR amplification product contains a sequence as shown in SEQ ID No. 1 or SEQ ID No. 3, it indicates that the tobacco plant to be tested contains the dominant homozygous gene qLNqLN for leaf number that can increase tobacco yield.

6. The use according to claim 4, characterized in that: The analysis of the PCR amplification product is: if the PCR amplification product contains the sequences shown in SEQ ID No. 2 and SEQ ID No. 4, it is a recessive homozygous allele qlnqln containing a normal number of leaves.

7. The use according to claim 4, characterized in that: The analysis of the PCR amplification product is: if the PCR amplification product contains the sequences shown in SEQ ID NO.1 and SEQ ID NO.2, or contains the sequences shown in SEQ ID NO.3 and SEQ ID NO.4, or contains the sequences shown in SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.4, or contains the sequences shown in SEQ ID NO.3, SEQID NO.1 and SEQ ID NO.2, it contains the heterozygous gene qLNqln for high tobacco leaf number yield.

Images