Use of folic acid in prevention, diagnosis and treatment of biliary atresia
By using folic acid and its derivatives as diagnostic markers and therapeutic agents, the challenges of diagnosing and treating biliary atresia and neonatal infectious diseases have been solved. Effective prevention and treatment of biliary atresia, cholangitis, jaundice, etc. have been achieved, reducing liver inflammation and intestinal damage, and improving liver function and intestinal flora imbalance.
Patent Information
- Application Number
- CN202211377355.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-11-05
- Filing Date
- 2022-11-04
- Publication Date
- 2025-12-23
- Estimated Expiration
- 2042-11-04
AI Technical Summary
Biliary atresia is a serious disease in infants and young children. Current technology lacks effective drug treatments, diagnosis is difficult, and the prognosis is poor. It often leads to cirrhosis and liver failure, and neonatal infectious diseases have a high mortality rate. There is a lack of effective prevention and treatment methods.
Using folic acid and its derivatives as diagnostic markers and therapeutic agents, drugs and kits are prepared to diagnose and treat biliary atresia, cholangitis, jaundice, viral infections, etc. by regulating inflammatory responses, improving liver function, correcting intestinal flora imbalance, regulating iron ion metabolism, and inhibiting the expression of inflammatory factors.
Folic acid significantly reduces bilirubin levels in patients with biliary atresia, improves liver function, prolongs the autoimmune period, prevents and treats biliary atresia, cholangitis, and viral infections, reduces the incidence of jaundice, corrects intestinal flora imbalance, improves liver function, reduces liver inflammation, and treats neonatal infectious diseases.
Smart Images

Figure HDA0003927264370000011 
Figure HDA0003927264370000021 
Figure HDA0003927264370000031
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological medicine, and particularly relates to application of folic acid in prevention, diagnosis and treatment of biliary atresia. BACKGROUND
[0002] Biliary atresia (hereinafter sometimes referred to as "BA") is a common disease causing obstructive jaundice in infants. Due to factors such as viral infection (viruses known to be associated with the occurrence of BA include human herpes virus, cytomegalovirus, rotavirus, reovirus, etc.), an autoimmune response causing apoptosis or necrosis of biliary epithelial cells, damage to bile ducts, inflammation and fibrosis, etc. in the perinatal period (e.g., 28 weeks of gestation to 4 weeks after birth) of infants, the prognosis is poor, the mortality rate is high, and the etiology and pathogenesis are still unknown. The basic pathological changes of biliary atresia are, for example, progressive inflammation and liver fibrosis of intrahepatic and extrahepatic bile ducts, and the development of liver fibrosis is faster and more invasive than other adult diseases. Although the obstruction of extrahepatic bile duct can partially relieve symptoms and delay disease progression through Kasai surgery, most children still have progressive development of intrahepatic bile duct inflammation after surgery, eventually leading to cirrhosis and portal hypertension, and even liver failure, which is a serious disease that endangers the lives of children. Currently, biliary atresia is the primary reason for liver transplantation in childhood. In addition, biliary atresia disease is difficult to distinguish from other infants with persistent jaundice, and in clinical practice, it needs to be diagnosed by invasive methods such as liver biopsy, and there is no effective drug to treat it except for surgical methods such as Kasai surgery and liver transplantation. In China, more than 70% of children often die tragically due to the long delay in diagnosis and the missed best treatment window for surgery.
[0003] Neonatal infectious disease, also known as neonatal infection, is a common neonatal disease and an important factor leading to neonatal death, which includes pulmonary infection, umbilical cord infection, brain infection, skin infection, urinary system infection, oral infection, etc. The infection routes include intrauterine infection of the mother, infection during delivery, and postnatal infection, etc.
[0004] Folic acid, also known as vitamin M, vitamin Bc, and vitamin B9, is a water-soluble vitamin. The normal requirement of folic acid is 200-400 μg / d, the World Health Organization recommends at least 200 μg / d for adults, and 400 μg / d for pregnant women and breast-feeding women. Generally, 20 times the minimum requirement of adults will not cause poisoning. Folic acid, as a metabolic product of intestinal lactobacillus bifidus, plays an important physiological role in the body, including maintaining the production and function of red blood cells, etc. However, there is no report on the research of folic acid on biliary atresia disease. SUMMARY
[0005] To address the aforementioned problems, this invention has conducted in-depth research on the pathogenesis of hereditary, infectious, or allergic diseases, their associated intestinal dysfunction, liver fibrosis, and related diseases such as biliary atresia, cholangitis, jaundice, and viral infections, leading to the following results:
[0006] This invention reveals that folic acid levels are significantly reduced in the serum of patients with bronchiolitis (BA), making it a potential biomarker for the diagnosis or auxiliary diagnosis of BA. In a mouse model of viral-induced biliary atresia, folic acid significantly increased mouse body weight, reduced jaundice rate, improved liver function, inhibited the expression of inflammatory cytokines S100a8, S100a9, and IFN-γ in the intestine and liver, and promoted the expression of Nox2, a characteristic transcription factor of myeloid-derived suppressor cells. Simultaneously, folic acid significantly improved intestinal inflammation, regulated iron metabolism, corrected intestinal flora imbalance, and reduced liver and intestinal tissue damage. Therefore, folic acid can achieve diagnostic and preventative effects against biliary atresia, cholangitis, liver fibrosis, gastrointestinal flora imbalance, inflammatory bowel disease, and viral infections through mechanisms such as improved anti-inflammatory effects, regulation of iron metabolism, correction of intestinal flora imbalance, and improvement of liver damage. Folic acid can also reduce the concentrations of total bilirubin and direct bilirubin in patients with biliary atresia, achieving preventative and / or therapeutic effects against cholangitis. Simultaneously, folic acid supplementation can correct systemic iron overload and luminal iron deficiency, inhibit eosinophil infiltration in the small intestine, inhibit the production of IgG-Ro / SSA autoantibodies, increase the IgM / IgG4 ratio, prolong the autoimmune period, and improve liver function. This invention also demonstrates that calcium folinate (CF) supplementation can reduce the levels of INFβ and ROS in the liver, reduce the incidence of jaundice, and improve neonatal growth; increase the expression levels of Dhfr, Mthfr, Nrf2, and Slc40a1 in the small intestine, thereby restoring folic acid metabolism, oxidative stress, and iron homeostasis; and reduce CD4+ levels in the liver. + T cells, CD8 + This invention discloses for the first time the use of at least one of folic acid, S100a8, S100a9, IFN-γ, Nox2, and folic acid as a marker for the diagnosis or auxiliary diagnosis of biliary atresia, based on the expression of S100a8, S100a9, IFN-γ, Nox2, and folic acid in BA and non-BA patients. It also discloses the use of at least one of folic acid, S100a8, S100a9, IFN-γ, and Nox2 as a marker for the diagnosis or auxiliary diagnosis of biliary atresia, based on the expression of S100a8, S100a9, IFN-γ, and Nox2 in BA and non-BA patients.
[0007] The application also discloses the folate or its derivative alone or in combination with other vitamin B for preventing and treating biliary atresia, cholangitis, jaundice, food allergy, bacterial infection, viral infection and necrotizing enterocolitis, and has significant effects on jaundice caused by biliary atresia, liver inflammatory diseases, liver function damage, intestinal repair and the like.
[0008] The first aspect of the application aims to provide the use of folate or its derivative in the preparation of a medicament.
[0009] The second aspect of the application aims to provide the use of folate or its derivative in the preparation of a product for non-therapeutic purposes in vitro.
[0010] The third aspect of the application aims to provide a marker for diagnosing or assisting in diagnosing biliary atresia.
[0011] The fourth aspect of the application aims to provide the use of a reagent for detecting the marker of the third aspect of the application in the preparation of a product for diagnosing or assisting in diagnosing biliary atresia.
[0012] The fifth aspect of the application aims to provide a kit for diagnosing or assisting in diagnosing biliary atresia.
[0013] The sixth aspect of the application aims to provide the use of folate or its derivative in the preparation of a medicament for preventing and / or treating viral infection.
[0014] The sixth aspect of the application aims to provide the use of folate or its derivative in the preparation of a medicament for preventing and / or treating neonatal infection.
[0015] The seventh aspect of the application aims to provide the use of folate or its derivative in the preparation of a medicament for preventing and / or treating diseases caused by hepatointestinal circulation disorder.
[0016] The eighth aspect of the application aims to provide the use of folate or its derivative in the preparation of a medicament for preventing and / or treating inflammatory bowel disease.
[0017] The ninth aspect of the application aims to provide the use of folate or its derivative in the preparation of a product for regulating intestinal flora.
[0018] The tenth aspect of the application aims to provide the use of folate or its derivative in the preparation of a medicament for preventing and / or treating diseases caused by the increase of S100a8 or S100a9 expression.
[0019] The eleventh aspect of the application aims to provide the use of folate or its derivative in the preparation of a product for preventing and / or treating iron deficiency anemia.
[0020] The twelfth aspect of the present application aims to provide use of folic acid or a derivative thereof in the manufacture of a medicament for preventing and / or treating a disease caused by an increase in IFN-γ expression.
[0021] The thirteenth aspect of the present application aims to provide a method for manufacturing a product containing folic acid or a derivative thereof.
[0022] The fourteenth aspect of the present application aims to provide a medicament.
[0023] The fifteenth aspect of the present application aims to provide a diagnostic method.
[0024] The sixteenth aspect of the present application aims to provide a method for preventing and / or treating a disease.
[0025] To achieve the above technical solutions,
[0026] The first aspect of the present application provides use of folic acid or a derivative thereof in the manufacture of a medicament.
[0027] The medicament has at least one of the following functions (a1) to (a9):
[0028] (a1) preventing and treating biliary atresia;
[0029] (a2) preventing and treating cholangitis;
[0030] (a3) preventing and treating neonatal infectious diseases;
[0031] (a4) improving systemic iron overload;
[0032] (a5) inhibiting small intestinal eosinophil infiltration;
[0033] (a6) inhibiting expression of IgG-Ro / SSA autoantibodies;
[0034] (a7) IgM / IgG4 ratio;
[0035] (a8) prolonging autoimmune period;
[0036] (a9) improving liver function.
[0037] The second aspect of the present application provides use of folic acid or a derivative thereof in any one of (b1) to (b5).
[0038] (b1) manufacturing a product for inhibiting expression of inflammatory factors in vitro for non-therapeutic purposes;
[0039] (b2) manufacturing a product for promoting expression of transcription factors characteristic of myeloid-derived suppressor cells in vitro for non-therapeutic purposes;
[0040] (b3) preparing a product for promoting the expression of iron ion transporter SLC11A2 in vitro for non-therapeutic purposes;
[0041] (b4) preparing a product for inhibiting the expression of iron ion transporter SLC40A1 in vitro for non-therapeutic purposes;
[0042] (b5) preparing a product for promoting the expression of folate transporter in vitro for non-therapeutic purposes.
[0043] Preferably, the inflammatory factor comprises at least one of S100a8, S100a9 and IFN-γ.
[0044] Preferably, the myeloid-derived suppressor cell characteristic transcription factor comprises Nox2.
[0045] Preferably, the folate transporter comprises SLC46A1.
[0046] In a third aspect of the present application, a marker for diagnosing or aiding in the diagnosis of biliary atresia disease is provided, comprising at least one of folate, S100a8, S100a9, Nox2, IFN-γ.
[0047] Preferably, the marker comprises:
[0048] a) folate; and
[0049] b) at least one of S100a8, S100a9, Nox2, IFN-γ.
[0050] Preferably, the S100a8, S100a9, Nox2 and IFN-γ comprise protein and / or mRNA.
[0051] Preferably, the marker is from a body fluid, blood, tissue, cell or excrement; further preferably, the marker is from blood, tissue or excrement.
[0052] Preferably, the tissue comprises liver, intestinal tract, embryonic liver, embryonic intestinal tract.
[0053] Preferably, the excrement comprises feces, urine.
[0054] Preferably, the blood is whole blood, serum or plasma; further preferably, serum.
[0055] Preferably, the folate is from blood.
[0056] Preferably, the S100a8, S100a9, Nox2 and IFN-γ are from tissues; further preferably, the S100a8, S100a9, Nox2 and IFN-γ are from liver tissues or intestinal tissues; more preferably, the S100a8, S100a9, Nox2, IFN-γ are from intestinal tissues.
[0057] Preferably, when the subject to be tested satisfies at least one of (c1)-(c5), it is diagnosed as a patient with biliary atresia disease.
[0058] (c1) folate is significantly reduced relative to a reference level;
[0059] (c2) S100a8 is significantly increased relative to a reference level;
[0060] (c3) S100a9 is significantly increased relative to a reference level;
[0061] (c4) IFN-γ is significantly increased relative to a reference level;
[0062] (c5) Nox2 is significantly reduced relative to a reference level;
[0063] The reference level is the level of a subject of the same age who does not have biliary atresia disease; the subject of the same age is a healthy person or a patient with choledochal cyst.
[0064] In a fourth aspect of the present application, the use of a reagent for detecting the marker of the third aspect of the present application in the preparation of a product for diagnosing or assisting in the diagnosis of biliary atresia is provided.
[0065] Preferably, the product comprises a reagent, a kit, a gene chip, a protein chip.
[0066] Preferably, the product is used to perform at least one of the following detection methods:
[0067] (d1) colorimetric method; (d2) chemiluminescence method; (d3) atomic absorption spectrophotometry; (d4) polymerase chain reaction; (d5) micro-digital polymerase chain reaction; (d6) fluorescent polymerase chain reaction; (d7) loop-mediated isothermal amplification reaction; (d8) enzyme-linked immunosorbent assay; (d9) nucleotide sequence sequencing method; (d10) amino acid sequence sequencing method; (d11) denaturing gradient gel electrophoresis; (d12) nucleic acid typing chip detection; (d13) high performance liquid chromatography; (d14) in situ hybridization; (d15) biological mass spectrometry; (d16) high resolution melting curve analysis; (d17) single strand conformational isomerism polymorphism analysis; (d18) probe amplification block mutation system analysis.
[0068] Preferably, when the marker to be detected is mRNA of S100a8, S100a9, Nox2 and IFN-γ, the product contains primers for detecting the marker and / or internal reference mRNA, and / or detection probes.
[0069] Further preferably, when the marker to be detected is mRNA of S100a8, S100a9, Nox2 and IFN-γ, the product further comprises: sample processing reagents, including but not limited to sample lysis reagents, sample purification reagents and / or sample nucleic acid extraction reagents.
[0070] Still further preferably, when the marker to be detected is mRNA of S100a8, S100a9, Nox2 and IFN-γ, the product further comprises: one or more of RNA extraction reagents, dNTPs, DNA polymerase, double-strand specific fluorescent dyes and water.
[0071] Preferably, when the marker to be detected is S100a8 mRNA, the product comprises primers for detecting S100a8 mRNA, the nucleotide sequences of which are shown in SEQ ID NO. 1 and SEQ ID NO. 2.
[0072] Preferably, when the marker to be detected is S100a9 mRNA, the product comprises primers for detecting S100a9 mRNA, the nucleotide sequences of which are shown in SEQ ID NO. 3 and SEQ ID NO. 4.
[0073] Preferably, when the marker to be detected is IFN-γ mRNA, the product comprises primers for detecting IFN-γ mRNA, the nucleotide sequences of which are shown in SEQ ID NO. 5 and SEQ ID NO. 6.
[0074] Preferably, when the marker to be detected is Nox2 mRNA, the product comprises primers for detecting Nox2 mRNA, the nucleotide sequences of which are shown in SEQ ID NO. 7 and SEQ ID NO. 8.
[0075] Preferably, the sample to be detected or the sample of the subject of the product is from a body fluid, blood, tissue, cells or excrement of the subject to be tested; further preferably, the marker is from blood, tissue or excrement.
[0076] Preferably, the tissue comprises liver, intestinal tract, embryonic liver, embryonic intestinal tract.
[0077] Preferably, the excrement comprises feces, urine.
[0078] Preferably, the blood is whole blood, serum or plasma, dried blood spot; further preferably, serum, dried blood spot.
[0079] Preferably, the subject is an adult or a child.
[0080] Preferably, the child includes a neonate within 28 days of birth, an infant within 1 year of age, a toddler between 1 and 6 years of age, and a child between 6 and 8 years of age.
[0081] Preferably, the adult is selected from a female adult in gestation, a female adult in perinatal period, or a female adult in lactation.
[0082] Preferably, when the subject satisfies at least one of (c1) to (c5), the subject is diagnosed as a patient with biliary atresia;
[0083] (c1) folate is significantly decreased relative to a reference level;
[0084] (c2) S100a8 is significantly increased relative to a reference level;
[0085] (c3) S100a9 is significantly increased relative to a reference level;
[0086] (c4) IFN-γ is significantly increased relative to a reference level;
[0087] (c5) Nox2 is significantly decreased relative to a reference level;
[0088] The reference level is a level of a subject of the same age without biliary atresia; the subject of the same age is a healthy person or a patient with choledochal cyst.
[0089] In a fifth aspect, the present application provides a kit for diagnosing or aiding in the diagnosis of biliary atresia, comprising reagents for detecting the markers of the third aspect of the present application.
[0090] Preferably, when the markers to be detected are mRNAs of S100a8, S100a9, Nox2 and IFN-γ, the product contains primers and / or detection probes for detecting the markers and / or internal reference mRNAs.
[0091] Further preferably, when the markers to be detected are mRNAs of S100a8, S100a9, Nox2 and IFN-γ, the product further comprises: sample processing reagents, including but not limited to sample lysis reagents, sample purification reagents and / or sample nucleic acid extraction reagents.
[0092] Still further preferably, when the markers to be detected are mRNAs of S100a8, S100a9, Nox2 and IFN-γ, the product further comprises: one or more of RNA extraction reagents, dNTPs, DNA polymerase, double-stranded specific fluorescent dyes and water.
[0093] Preferably, when the detection marker is S100a8 mRNA, the product comprises primers for detecting S100a8 mRNA, the nucleotide sequences of the primers are shown as SEQ ID NO. 1 and SEQ ID NO. 2.
[0094] Preferably, when the detection marker is S100a9 mRNA, the product comprises primers for detecting S100a9 mRNA, the nucleotide sequences of the primers are shown as SEQ ID NO. 3 and SEQ ID NO. 4.
[0095] Preferably, when the detection marker is IFN-γ mRNA, the product comprises primers for detecting IFN-γ mRNA, the nucleotide sequences of the primers are shown as SEQ ID NO. 5 and SEQ ID NO. 6.
[0096] Preferably, when the detection marker is Nox2 mRNA, the product comprises primers for detecting Nox2 mRNA, the nucleotide sequences of the primers are shown as SEQ ID NO. 7 and SEQ ID NO. 8.
[0097] Preferably, the detection sample or the test sample of the product is from a body fluid, blood, tissue, cell or excrement of the subject to be tested; further preferably, the marker is from blood, tissue or excrement.
[0098] Preferably, the tissue comprises liver, intestinal tract, embryonic liver, embryonic intestinal tract.
[0099] Preferably, the excrement comprises feces, urine.
[0100] Preferably, the blood is whole blood, serum or plasma, dried blood spot; further preferably, serum or dried blood spot.
[0101] Preferably, the subject to be tested is an adult or a child.
[0102] Preferably, the child comprises a newborn within 28 days after birth, an infant within 1 year old, a toddler between 1 and 6 years old, and a child between 6 and 8 years old.
[0103] Preferably, the adult is selected from a female adult in gestation period, a female adult in perinatal period or a female adult in lactation period.
[0104] Preferably, when the subject to be tested satisfies at least one of (c1) to (c5), it is diagnosed as a patient with biliary atresia disease.
[0105] (c1) folate is significantly reduced relative to a reference level;
[0106] (c2) S100a8 is significantly increased relative to a reference level;
[0107] (c3) S100a9 is significantly elevated relative to a reference level;
[0108] (c4) IFN-γ is significantly elevated relative to a reference level;
[0109] (c5) Nox2 is significantly decreased relative to a reference level;
[0110] The reference level is that of a subject of the same age who does not have a biliary atresia disease; the subject of the same age is a healthy person or a patient with a choledochal cyst.
[0111] In a sixth aspect of the application, there is provided the use of folic acid or a derivative thereof in the preparation of a medicament for the prevention and / or treatment of a viral infection.
[0112] In a seventh aspect of the application, there is provided the use of folic acid or a derivative thereof in the preparation of a medicament for the prevention and / or treatment of a disease caused by a liver-intestine circulation disorder.
[0113] In an eighth aspect of the application, there is provided the use of folic acid or a derivative thereof in the preparation of a medicament for the prevention and / or treatment of inflammatory bowel disease.
[0114] In a ninth aspect of the application, there is provided the use of folic acid or a derivative thereof in the preparation of a product for modulating the intestinal microbiota.
[0115] Preferably, the product comprises a food, a nutritional formulation and a medicament.
[0116] Preferably, the product is used for the prevention, treatment or adjuvant treatment of intestinal inflammatory or infectious diseases such as candidal enteritis, staphylococcal enteritis, Clostridium perfringens acute necrotic enteritis, (neonatal) necrotic enterocolitis, septicemia, Pseudomonas aeruginosa intestinal infection, Proteus intestinal infection, Klebsiella pneumoniae intestinal infection, and for reducing the risk of premature birth caused by the aforementioned diseases.
[0117] In a tenth aspect of the application, there is provided the use of folic acid or a derivative thereof in the preparation of a medicament for the prevention and / or treatment of a disease caused by elevated expression of S100a8 and / or S100a9.
[0118] In an eleventh aspect of the application, there is provided the use of folic acid or a derivative thereof in the preparation of a product for the prevention and / or treatment of iron deficiency anemia.
[0119] Preferably, the product comprises a food, a nutritional formulation and a medicament.
[0120] In a twelfth aspect of the application, there is provided the use of folic acid or a derivative thereof in the preparation of a medicament for the prevention and / or treatment of a disease caused by elevated expression of IFN-γ.
[0121] In a thirteenth aspect of the present application, there is provided a method for preparing a product containing folic acid or a derivative thereof, wherein folic acid or a derivative thereof is mixed with an excipient in a proportion to obtain a product.
[0122] Preferably, the method for preparing further comprises preparing the obtained mixture into a corresponding form or dosage form as required.
[0123] Preferably, the product comprises food, a nutritional preparation, and a medicament.
[0124] In a fourteenth aspect of the present application, there is provided a medicament comprising: folic acid or a derivative thereof;
[0125] and other active ingredients, the other active ingredients comprising at least one of vitamin B, vitamin C, nicotinamide, zinc oxide, vitamin A, vitamin D, vitamin E, vitamin K, homocysteine, glutathione, and taurine.
[0126] Preferably, the other active ingredients comprise at least one of vitamin B6, vitamin B12.
[0127] Preferably, the medicament comprises: folic acid or a derivative thereof; and at least one of vitamin B6, vitamin B12, vitamin A, vitamin D, vitamin E, vitamin K, vitamin C, nicotinamide, zinc oxide, taurine.
[0128] Preferably, the medicament comprises folic acid or a derivative thereof and nicotinamide.
[0129] Preferably, the medicament comprises folic acid or a derivative thereof and vitamin E.
[0130] Preferably, the medicament comprises folic acid or a derivative thereof and vitamin A and vitamin E. Preferably, the medicament has at least one of functions (a1) to (a9):
[0131] (a1) preventing and treating biliary atresia;
[0132] (a2) preventing and treating cholangitis;
[0133] (a3) preventing and treating neonatal infectious diseases;
[0134] (a4) improving systemic iron overload;
[0135] (a5) inhibiting small intestinal eosinophil infiltration;
[0136] (a6) inhibiting expression of IgG-Ro / SSA autoantibodies;
[0137] (a7) IgM / IgG4 ratio;
[0138] (a8) prolonging autoimmune period;
[0139] (a9) improving liver function.
[0140] In a fourteenth aspect of the application, there is provided a method of diagnosing or aiding in the diagnosis of a biliary atresia disease, comprising at least one of the following steps:
[0141] (e1) detecting the level and / or activity of a marker of the third aspect of the application;
[0142] (e2) using a kit of the fifth aspect of the application.
[0143] In a fifteenth aspect of the application, there is provided a method, comprising at least one of the following steps:
[0144] (f1) administering folic acid or a derivative thereof to the subject;
[0145] (f2) administering a medicament of the thirteenth aspect of the application to the subject.
[0146] The method is for at least one of (a1) to (a16):
[0147] (a1) preventing or treating biliary atresia;
[0148] (a2) preventing or treating cholangitis;
[0149] (a3) preventing or treating neonatal infectious diseases;
[0150] (a4) improving systemic iron overload;
[0151] (a5) inhibiting small intestinal eosinophil infiltration;
[0152] (a6) inhibiting the expression of IgG-Ro / SSA autoantibodies;
[0153] (a7) IgM / IgG4 ratio;
[0154] (a8) prolonging the autoimmune phase;
[0155] (a9) improving liver function;
[0156] (a10) preventing or treating viral infections;
[0157] (a11) preventing or treating diseases caused by hepatointestinal circulation disorders;
[0158] (a12) preventing or treating inflammatory bowel disease;
[0159] (a13) modulating the intestinal microbiota;
[0160] (a14) preventing or treating diseases caused by elevated S100a8 or S100a9 expression;
[0161] (a15) preventing and treating iron deficiency anemia;
[0162] (a16) preventing and treating diseases caused by elevated IFN-γ expression.
[0163] Preferably, the method comprises at least one of the following steps:
[0164] (g1) administering to the subject an effective amount of folic acid or a derivative thereof;
[0165] (g2) administering to the subject an effective amount of the medicament of the thirteenth aspect of the present application.
[0166] Preferably, the method is for at least one of (a1) to (a9):
[0167] (a1) preventing and treating biliary atresia;
[0168] (a2) preventing and treating cholangitis;
[0169] (a3) preventing and treating neonatal infectious diseases;
[0170] (a4) improving systemic iron overload;
[0171] (a5) inhibiting small intestinal eosinophil infiltration;
[0172] (a6) inhibiting expression of IgG-Ro / SSA autoantibodies;
[0173] (a7) IgM / IgG4 ratio;
[0174] (a8) prolonging autoimmune period;
[0175] (a9) improving liver function.
[0176] According to the above aspects of the present application:
[0177] Preferably, the folic acid has a molecular formula of C 19 H 19 N7O6, a molecular weight of 441.4, and a CAS of 59-30-3.
[0178] Preferably, the derivative comprises a pharmaceutically acceptable salt, ester, hydrate, solvate, polymorph, tautomer, prodrug, and functional equivalent of folic acid; further preferably, the derivative comprises any one of (a1) to (a2): (a1) folinic acid, dihydrofolic acid, tetrahydrofolic acid, 5-methyltetrahydrofolic acid, 5,10-methylenetetrahydrofolic acid, 5,10-formimino tetrahydrofolic acid, 5-formyltetrahydrofolic acid, 10-formyltetrahydrofolic acid, and 10-methyltetrahydrofolic acid; (a2) a pharmaceutically acceptable salt of (a1), including but not limited to calcium, sodium, zinc, arginine, choline, acetylcholine, N-methyl amino ethanol, 2-amino-2-methyl-propanol, 1,1-dimethylbiguanide, phenylethylbiguanide, diamino guanidine, glucosamine, and dimethylamino ethanol.
[0179] Preferably, the derivative comprises at least one of a pharmaceutically acceptable salt of folic acid, folinic acid, and a pharmaceutically acceptable salt of folinic acid.
[0180] Preferably, the cholangitis comprises bacterial cholangitis, viral cholangitis.
[0181] Preferably, the neonatal infection comprises at least one of bacterial infection, viral infection.
[0182] Preferably, the virus comprises at least one of DNA virus and RNA virus.
[0183] Preferably, the RNA virus comprises at least one of antisense RNA virus and double-stranded RNA virus.
[0184] Preferably, the neonatal infectious disease comprises a disease caused by over-activation of the type I interferon pathway.
[0185] Preferably, the neonatal infectious disease comprises neonatal hepatitis syndrome, neonatal sepsis, neonatal pneumonia, and gastrointestinal disease caused by neonatal infection.
[0186] Preferably, the bacterial infectious disease comprises Escherichia coli, Staphylococcus aureus, or hemolytic streptococcus.
[0187] Preferably, the viral infectious disease comprises cytomegalovirus (CMV) infection, rotavirus infection, and herpes virus infection; wherein the viral infectious disease further comprises viral diarrhea.
[0188] The dosage form of the drug is a dosage form suitable for children or a dosage form suitable for adults.
[0189] Preferably, the children comprise neonates within 28 days of birth, infants within 1 year of age, toddlers between 1 and 6 years of age, and children between 6 and 18 years of age.
[0190] Preferably, the adult human includes a pregnant female adult human, a perinatal female adult human, and a lactating female adult human.
[0191] Preferably, the dosage form includes a capsule, a tablet, a microcapsule preparation, an injection, a suppository, a spray, a powder, a soft capsule, a dripping pill, a honeyed pill, a pill, a granule, a honeyed paste, a controlled release preparation, an oral liquid preparation, a chewable tablet, a buccal tablet, a transdermal patch, and an effervescent tablet.
[0192] Preferably, the unit dose of the folic acid or its derivative in the medicine is 0.1 mg to 1 g.
[0193] Preferably, the unit dose of the folic acid or its derivative in the medicine is 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg, or 1.0 mg.
[0194] Preferably, the unit dose of the folic acid or its derivative in the medicine is 0.2 mg, 0.4 mg, 0.8 mg, or 1.0 mg.
[0195] Preferably, the medicine further comprises other active ingredients, which are at least one of vitamin B, vitamin C, nicotinamide, zinc oxide, vitamin A, vitamin E, homocysteine, glutathione, and taurine, wherein the vitamin B is for protecting and preserving liver; vitamin C, also known as L-ascorbic acid, is an antioxidant and also a coenzyme; nicotinamide, also known as niacinamide, is an amide compound of nicotinic acid; zinc oxide is a zinc oxide; vitamin A is a fat-soluble vitamin; vitamin E, also known as tocopherol or tocopherol, is one of the main antioxidants; homocysteine, also known as homocysteine, is a sulfur-containing amino acid; glutathione (GSH) is a tripeptide containing γ-amide bond and thiol group, composed of glutamic acid, cysteine and glycine, and has antioxidant and detoxification effects; taurine protects and preserves liver, promotes gastrointestinal function, increases human immunity, improves body resistance, and has disease resistance; they are used in combination with folic acid to promote folic acid absorption and achieve the purpose of synergistic disease resistance.
[0196] Preferably, the vitamin B is at least one of vitamin B1 (thiamine), vitamin B2 (riboflavin), vitamin B3 (nicotinic acid), vitamin B5 (pantothenic acid), vitamin B6 (pyridoxine), vitamin B7 (biotin), and vitamin B12 (cobalamin).
[0197] Preferably, in one embodiment, the medicine comprises: folic acid or its derivative; and at least one of vitamin B6, vitamin B12, vitamin A, vitamin E, vitamin C, nicotinamide, zinc oxide, and taurine.
[0198] Preferably, the medicament further comprises a pharmaceutical excipient, including one or more of diluents, fillers, excipients, binders, humectants, disintegrants, absorption enhancers, surfactants, adsorptive carriers, lubricants, and flavoring agents.
[0199] Preferably, the carrier or excipient can be selected from one or more of lactose hydrate, microcrystalline cellulose, mannitol, sodium citrate, calcium phosphate, glycine, and starch; the disintegrant can be selected from one or more of cross-linked polyplvdone, copolyvidone, sodium starch glycolate, cross-linked sodium carboxymethylcellulose, and specific complex silicates; the binder can be selected from one or more of polyvinylpyrrolidone, hydroxypropyl methylcellulose (HPMC), hydroxypropyl cellulose (HPC), sucrose, gelatin, and gum arabic.
[0200] Preferably, the virus in the viral infection includes, but is not limited to, human herpes virus, cytomegalovirus, rotavirus, and reovirus.
[0201] Preferably, the disease caused by the hepatointestinal circulation disorder includes hypercholesterolemia, cholesterol stones, jaundice, and liver fibrosis.
[0202] Preferably, the inflammatory bowel disease includes undifferentiated colitis, ulcerative colitis, and Crohn's disease.
[0203] Preferably, the disease caused by the elevated expression of S100a8 and / or S100a9 includes, but is not limited to, systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), inflammatory bowel disease (IBD), primary glomerular disease, systemic sclerosis (SSc), multiple sclerosis (MS), experimental autoimmune encephalomyelitis (EAE), COPD, bone marrow leukopoiesis, myelodysplastic syndrome, tumorigenesis, gastric cancer, breast cancer, melanoma, periodontal inflammatory disease, obesity, type 2 diabetes mellitus (T2DM) and its complications, cardiovascular disease (myocardial cell dysfunction, myocardial infarction, atherosclerosis), and skin disease.
[0204] Preferably, the iron deficiency anemia includes pediatric iron deficiency anemia.
[0205] Preferably, the disease caused by the elevated expression of IFN-γ comprises an autoimmune disease in children or adults.
[0206] Preferably, the autoimmune disease comprises, but is not limited to, type I diabetes, aplastic anemia (AA), rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), autoimmune thyroid disease (AITD) (including Graves' disease (GD), Hashimoto's thyroiditis (HT)), myasthenia gravis (MG), insulin-dependent diabetes mellitus (IDDM), idiopathic thrombocytopenic purpura (ITP), ankylosing spondylitis, Sjogren's syndrome (SS), autoimmune liver disease (AILD), acute disseminated encephalomyelitis (ADE, experimental autoimmune encephalomyelitis MOG).
[0207] Preferably, the food, nutritional preparation comprises a conventional formula, a formula for special medical purposes, an enteral nutritional preparation and a parenteral nutritional preparation.
[0208] Preferably, the conventional formula comprises at least one of infant formula, formula for pregnant and lactating women.
[0209] Preferably, the formula for special medical purposes comprises at least one of formula for preterm / low birth weight infants, lactose-free or low-lactose formula, formula with partially hydrolyzed milk protein, formula with extensively hydrolyzed milk protein or amino acid formula, fortifier or nutritional supplement for breast milk and infant formula, formula for food intolerance, allergy, liver disease, formula for diseases and disorders; Food for Special Medical Purpose (FSMP) is a specially processed and prepared formula for the special needs of nutrients or diet for people with eating restrictions, digestive and absorption disorders, metabolic disorders or specific disease states. This type of product must be used under the guidance of a doctor or clinical nutritionist, either alone or in combination with other foods. Special medical purpose formula is a special dietary food. When the target population cannot eat ordinary food or cannot meet their nutritional needs with daily food, special medical purpose formula can be used as a nutritional supplement, which plays an important role in treatment, rehabilitation and body function maintenance.
[0210] Preferably, the parenteral nutrition preparation comprises at least one of a fat emulsion injection, a total nutrition solution, and an intravenous injection.
[0211] Preferably, the enteral nutrition preparation comprises at least one of an amino acid type enteral nutrition preparation, a short peptide type enteral nutrition preparation, an intact protein type enteral nutrition preparation, and a component type enteral nutrition preparation.
[0212] It should be noted that the administration form of folic acid or its derivative in the present application is not important, because the embodiments of the present application have proved that the component can achieve the effect by intraperitoneal injection, and thus the folic acid or its derivative can be added to formula milk powder, special medical use formula food, and other enteral, parenteral nutrition preparations or pharmaceutical excipients suitable for infants and pregnant and lying-in women, as long as an effective amount is administered to achieve the effect of preventing and treating diseases such as biliary atresia, liver fibrosis, cholangitis, gastrointestinal flora disorder, inflammatory bowel disease, viral infection, and neonatal infectious diseases.
[0213] According to the classification of the infection site, the neonatal infection further includes neonatal lung infection (such as neonatal pneumonia), neonatal umbilical infection, neonatal brain infection, neonatal skin infection, neonatal urinary system infection, neonatal oral cavity infection, neonatal eye infection, neonatal blood infection (such as neonatal sepsis), neonatal biliary tract infection, neonatal stomach infection, neonatal intestinal infection (such as gastrointestinal disease caused by neonatal infection), neonatal liver infection (such as neonatal hepatitis syndrome), or neonatal multiple-site concurrent infection, etc.
[0214] [1] Use of folic acid or its derivative in the preparation of a drug for preventing and / or treating genetic, infectious or allergic diseases, wherein the genetic disease includes biliary atresia, the infectious disease includes cholangitis, jaundice, neonatal infection, necrotizing enterocolitis, bacterial infectious disease, viral infectious disease, and the allergic disease includes food allergy.
[0215] [2] The use according to the above [1], wherein the biliary atresia includes viral-induced biliary atresia or biliary stasis-induced biliary atresia.
[0216] [3] The use according to the above [1], wherein the viral-induced biliary atresia further includes biliary atresia mainly caused by cytomegalovirus or biliary atresia mainly caused by rotavirus.
[0217] [4] The use according to the above [1], wherein the biliary atresia further exhibits food allergy caused by biliary atresia, jaundice caused by biliary atresia, cholangitis caused by biliary atresia, liver disease caused by biliary atresia, and intestinal disease caused by biliary atresia.
[0218] [5] The use according to the above [4], wherein the liver disease caused by biliary atresia includes liver function impairment caused by biliary atresia, and / or liver inflammatory disease caused by biliary atresia.
[0219] [6] The use according to the above [4], wherein the intestinal disease caused by biliary atresia includes intestinal inflammatory disease caused by biliary atresia.
[0220] [7] The use according to the above [1], wherein the jaundice includes pathological jaundice or infantile jaundice.
[0221] [8] The use according to the above [7], wherein the pathological jaundice includes viral-induced pathological jaundice, or infantile pathological jaundice.
[0222] [9] The use according to the above [7], wherein the pathological jaundice further includes viral-induced infantile pathological jaundice; or the viral-induced pathological jaundice includes cytomegalovirus jaundice.
[0223]
[10] The use according to the above [1], wherein the cholangitis includes bacterial cholangitis, viral cholangitis, cholangitis caused by biliary atresia, cholangitis complicated after biliary atresia surgery.
[0224]
[11] The use according to the above
[10] , wherein the bacterial cholangitis further includes bacterial cholangitis caused by biliary atresia, bacterial cholangitis complicated after biliary atresia surgery.
[0225]
[12] The use according to the above [1], wherein the neonatal infectious disease further includes neonatal bacterial infectious disease and neonatal viral infectious disease, neonatal mycoplasma or chlamydia infection; or, the neonatal infectious disease includes neonatal hepatitis syndrome, neonatal sepsis, neonatal pneumonia, gastrointestinal disease caused by neonatal infection.
[0226]
[13] The use according to the above
[12] , wherein the neonatal viral infection further includes RNA virus and DNA virus.
[0227]
[14] The use according to the above
[13] , wherein the RNA virus further includes antisense RNA virus, DNA virus.
[0228]
[15] The use according to the above
[12] , wherein the neonatal viral infection further includes neonatal cytomegalovirus (CMV) infection, neonatal rotavirus infection, neonatal herpes virus infection.
[0229]
[16] The use according to the above [1], wherein the bacterial infectious disease includes Escherichia coli infection, Staphylococcus aureus infection or hemolytic streptococcus infection.
[0230]
[17] The use according to the above [1], wherein the viral infectious disease includes cytomegalovirus (CMV) infection, rotavirus infection, and herpes virus infection.
[0231]
[18] The use according to the above
[17] , wherein the viral infectious disease further includes viral diarrhea.
[0232]
[19] The use according to the above [1], wherein the food allergy includes food allergy caused by or accompanied by biliary atresia, food allergy caused by or accompanied by choledochal cyst; or, the food allergy further includes skin disease caused by food allergy, gastrointestinal disease caused by food allergy, and respiratory disease caused by food allergy.
[0233]
[20] The use according to the above
[19] , wherein the gastrointestinal disease caused by food allergy includes inflammatory bowel disease caused by food allergy.
[0234]
[21] The use according to the above [1], wherein the folic acid derivative includes pharmaceutically acceptable salt, ester, hydrate, solvate, polymorph, tautomer, prodrug, and functional equivalent of folic acid.
[0235]
[22] The use according to the above [1], wherein the folic acid derivative includes any one of (a1) to (a2):
[0236] (a1) folinic acid, dihydrofolic acid, tetrahydrofolic acid, 5-methyltetrahydrofolic acid, 5,10-methylenetetrahydrofolic acid, 5,10-formimino tetrahydrofolic acid, 5-formyltetrahydrofolic acid, 10-formyltetrahydrofolic acid, and 10-methyltetrahydrofolic acid;
[0237] (a2) pharmaceutically acceptable salt of (a1).
[0238]
[23] The use according to the above
[21] or
[22] , wherein the pharmaceutically acceptable salt includes calcium, sodium, zinc, arginine, choline, acetylcholine, N-methyl amino ethanol, 2-amino-2-methyl-propanol, 1,1-dimethylbiguanide, phenylethylbiguanide, diamino guanidine, glucosamine, and dimethylamino ethanol.
[0239]
[24] The use according to the above [1], wherein the folic acid derivative includes calcium folinate.
[0240]
[25] The use according to the above [1], wherein the medicament further comprises other active ingredients, and the other active ingredients include at least one of vitamin B, vitamin C, nicotinamide, zinc oxide, vitamin A, vitamin E, vitamin D, vitamin K, homocysteine, glutathione, and taurine.
[0241]
[26] The use according to the above
[25] , wherein the vitamin B comprises at least one of vitamin Bl, vitamin B2, vitamin B3, vitamin B5, vitamin B6, vitamin B7, and vitamin B 12.
[0242]
[27] The use according to the above [1], wherein the drug comprises at least one of folic acid or a derivative thereof, and vitamin B6 and B 12; or the drug comprises: folic acid or a derivative thereof; and at least one of vitamin B6, vitamin B 12, vitamin A, vitamin E, vitamin C, nicotinamide, zinc oxide, taurine; or the drug comprises folic acid or a derivative thereof and nicotinamide; or the drug comprises folic acid or a derivative thereof and vitamin E.
[0243]
[28] The use according to the above [1], wherein the drug is in a dosage form suitable for children or a dosage form suitable for adults.
[0244]
[29] The use according to the above
[28] , wherein the children include neonates within 28 days after birth, infants within 1 year of age, toddlers from 1 to 6 years of age, and children from 6 to 18 years of age.
[0245]
[30] The use according to the above
[28] , wherein the adults include female adults in a gestation period, female adults in a perinatal period, and female adults in a lactation period.
[0246]
[31] The use according to the above [1], wherein the drug is in a dosage form including a gastrointestinal administration dosage form and a non-gastrointestinal administration dosage form.
[0247]
[32] The use according to the above [1], wherein the drug is in a dosage form including a capsule, a tablet, a microcapsule preparation, an injection, a suppository, a spray, a powder, a soft capsule, a dripping pill, a honeyed pill, a pill, a granule, a honeyed plaster, a controlled release preparation, an oral liquid preparation, a chewable tablet, a buccal tablet, a transdermal patch, and an effervescent tablet.
[0248]
[33] The use according to the above [1], wherein the folic acid or a derivative thereof is in a unit dosage of 0.1 mg to 1 g in the drug.
[0249]
[34] The use according to the above [1], wherein the folic acid or a derivative thereof is in a unit dosage of 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg, or 1.0 mg in the drug.
[0250]
[35] The use according to the above [1], wherein the folic acid or a derivative thereof is in a unit dosage of 0.2 mg, 0.4 mg, 0.8 mg, or 1.0 mg in the drug.
[0251]
[36] A medicament comprising: folic acid or a derivative thereof; and another active ingredient comprising at least one of vitamin B, vitamin C, vitamin A, vitamin E, vitamin D, vitamin K, nicotinamide, zinc oxide, homocysteine, glutathione, and taurine.
[0252]
[37] The medicament according to the above
[36] , comprising: folic acid or a derivative thereof; and vitamin B comprising at least one of vitamin Bl, vitamin B2, vitamin B3, vitamin B5, vitamin B6, vitamin B7, and vitamin B 12.
[0253]
[38] The medicament according to the above
[36] , comprising folic acid or a derivative thereof, and at least one of vitamin B6 and B 12; or, comprising: folic acid or a derivative thereof; and at least one of vitamin B6, vitamin B 12, vitamin A, vitamin E, vitamin C, vitamin D, vitamin K, nicotinamide, zinc oxide, taurine; or, comprising folic acid or a derivative thereof, and nicotinamide; or, comprising folic acid or a derivative thereof, and vitamin E; or, comprising folic acid or a derivative thereof, and vitamin A and vitamin E.
[0254]
[39] The medicament according to the above
[36] to
[38] , wherein the folic acid derivative comprises pharmaceutically acceptable salts, esters, hydrates, solvates, polymorphs, tautomers, prodrugs, and functional equivalents of folic acid.
[0255]
[40] The medicament according to the above
[36] to
[38] , wherein the folic acid derivative comprises any one of (al) to (a2):
[0256] (al) folinic acid, dihydrofolic acid, tetrahydrofolic acid, 5-methyltetrahydrofolic acid, 5,10-methylenetetrahydrofolic acid, 5,10-formiminotetrahydrofolic acid, 5-formyltetrahydrofolic acid, 10-formyltetrahydrofolic acid, and 10-methyltetrahydrofolic acid;
[0257] (a2) a pharmaceutically acceptable salt of (al).
[0258]
[41] The medicament according to the above
[40] , wherein the pharmaceutically acceptable salt comprises calcium, sodium, zinc, arginine, choline, acetylcholine, N-methylaminoethanol, 2-amino-2-methyl-propanol, 1,1-dimethylbiguanide, phenylethylbiguanide, diamino guanidine, glucosamine, and dimethylaminoethanol.
[0259]
[42] The medicament according to the above
[36] , wherein the folic acid derivative comprises calcium folinate.
[0260]
[43] The medicament according to the above
[36] , wherein the dosage form is a dosage form for children or a dosage form for adults.
[0261]
[44] The medicament according to the above-mentioned
[43] , wherein the children include neonates within 28 days after birth, infants within 1 year of age, toddlers from 1 to 6 years of age, and children from 6 to 18 years of age.
[0262]
[45] The medicament according to the above-mentioned
[43] , wherein the adults include female adults in a gestation period, female adults in a perinatal period, and female adults in a lactation period.
[0263]
[46] The medicament according to the above-mentioned
[36] , wherein the dosage form of the medicament includes a dosage form for gastrointestinal administration and a dosage form for non-gastrointestinal administration.
[0264]
[47] The medicament according to the above-mentioned
[36] , wherein the dosage form of the medicament includes a capsule, a tablet, a microcapsule preparation, an injection, a suppository, a spray, a powder, a soft capsule, a dripping pill, a honeyed pill, a pill, a granule, a honeyed paste, a controlled release preparation, an oral liquid preparation, a chewable tablet, a buccal tablet, a transdermal patch, and an effervescent tablet.
[0265]
[48] The medicament according to the above-mentioned
[36] , wherein the unit dose of the folic acid or the derivative thereof in the medicament is 0.1 mg to 1 g.
[0266]
[49] The medicament according to the above-mentioned
[36] , wherein the unit dose of the folic acid or the derivative thereof in the medicament is 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg, or 1.0 mg.
[0267]
[50] The medicament according to the above-mentioned
[36] , wherein the unit dose of the folic acid or the derivative thereof in the medicament is 0.2 mg, 0.4 mg, 0.8 mg, or 1.0 mg.
[0268]
[51] A method of preventing and / or treating a genetic, infectious, or allergic disease, comprising administering to a subject a medicament comprising folic acid or a derivative thereof as an active ingredient, wherein the genetic disease includes biliary atresia, the infectious disease includes cholangitis, jaundice, neonatal infection, necrotizing enterocolitis, a bacterial infectious disease, a viral infectious disease, and the allergic disease includes food allergy.
[0269]
[52] The method according to the above-mentioned
[51] , wherein the biliary atresia includes viral-induced biliary atresia or biliary stasis-induced biliary atresia.
[0270]
[53] The method according to the above-mentioned
[52] , wherein the viral-induced biliary atresia further includes biliary atresia mainly induced by cytomegalovirus or biliary atresia mainly induced by rotavirus.
[0271]
[54] The method according to the above
[51] , wherein the biliary atresia further comprises food allergy caused by biliary atresia, jaundice caused by biliary atresia, cholangitis caused by biliary atresia, liver disease caused by biliary atresia, intestinal disease caused by biliary atresia.
[0272]
[55] The method according to the above
[54] , wherein the liver disease caused by biliary atresia comprises liver function impairment caused by biliary atresia, and / or liver inflammatory disease caused by biliary atresia.
[0273]
[56] The method according to the above
[54] , wherein the intestinal disease caused by biliary atresia comprises intestinal inflammatory disease caused by biliary atresia.
[0274]
[57] The method according to the above
[51] , wherein the jaundice comprises pathological jaundice or infantile jaundice.
[0275]
[58] The method according to the above
[57] , wherein the pathological jaundice comprises viral-induced pathological jaundice, or infantile pathological jaundice.
[0276]
[59] The method according to the above
[57] , wherein the pathological jaundice further comprises viral-induced infantile pathological jaundice; or preferably, the viral-induced pathological jaundice comprises cytomegalovirus jaundice.
[0277]
[60] The method according to the above
[51] , wherein the cholangitis comprises bacterial cholangitis, viral cholangitis, cholangitis caused by biliary atresia, cholangitis complicated after biliary atresia surgery.
[0278]
[61] The method according to the above
[60] , wherein the bacterial cholangitis further comprises bacterial cholangitis caused by biliary atresia, bacterial cholangitis complicated after biliary atresia surgery.
[0279]
[62] The method according to the above
[51] , wherein the neonatal infectious disease further comprises neonatal bacterial infectious disease and neonatal viral infectious disease, neonatal mycoplasma or chlamydia infection; or the neonatal infectious disease comprises neonatal hepatitis syndrome, neonatal sepsis, neonatal pneumonia, gastrointestinal disease caused by neonatal infection.
[0280]
[63] The method according to the above
[62] , wherein the neonatal viral infection further comprises RNA virus and DNA virus.
[0281]
[64] The method according to the above
[63] , wherein the RNA virus further comprises antisense RNA virus, DNA virus.
[0282]
[65] The method according to the above
[62] , wherein the neonatal viral infection further comprises neonatal cytomegalovirus (CMV) infection, neonatal rotavirus infection, neonatal herpes virus infection.
[0283]
[66] The method according to the above
[51] , wherein the bacterial infectious disease comprises Escherichia coli, Staphylococcus aureus, or hemolytic streptococcus.
[0284]
[67] The method according to the above
[51] , wherein the viral infectious disease comprises cytomegalovirus (CMV) infection, rotavirus infection, herpes virus infection.
[0285]
[68] The method according to the above
[67] , wherein the viral infectious disease further comprises viral diarrhea.
[0286]
[69] The method according to the above
[51] , wherein the food allergy further comprises skin disease caused by food allergy, gastrointestinal disease caused by food allergy, respiratory disease caused by food allergy.
[0287]
[70] The method according to the above
[69] , wherein the gastrointestinal disease caused by food allergy comprises inflammatory bowel disease caused by food allergy.
[0288]
[71] The method according to the above
[51] , wherein the folic acid derivative comprises pharmaceutically acceptable salt, ester, hydrate, solvate, polymorph, tautomer, prodrug, and functional equivalent of folic acid.
[0289]
[72] The method according to the above
[51] , wherein the folic acid derivative comprises any one of (a1) to (a2):
[0290] (a1) folinic acid, dihydrofolic acid, tetrahydrofolic acid, 5-methyltetrahydrofolic acid, 5,10-methylenetetrahydrofolic acid, 5,10-formimino tetrahydrofolic acid, 5-formyltetrahydrofolic acid, 10-formyltetrahydrofolic acid, and 10-methyltetrahydrofolic acid;
[0291] (a2) pharmaceutically acceptable salt of (a1).
[0292]
[73] The method according to the above
[71] to
[72] , wherein the pharmaceutically acceptable salt comprises calcium, sodium, zinc, arginine, choline, acetylcholine, N-methyl amino ethanol, 2-amino-2-methyl-propanol, 1,1-dimethylbiguanide, phenylethylbiguanide, diamino guanidine, glucosamine, and dimethylamino ethanol.
[0293]
[74] The method according to the above
[51] , wherein the folic acid derivative comprises calcium folinate.
[0294]
[75] The method according to the above-mentioned
[51] , wherein the method further comprises administering to the subject other active ingredients comprising at least one of vitamin B, vitamin C, niacinamide, zinc oxide, vitamin A, vitamin E, homocysteine, glutathione, and taurine.
[0295]
[76] The method according to the above-mentioned
[75] , wherein the vitamin B comprises at least one of vitamin Bl, vitamin B2, vitamin B3, vitamin B5, vitamin B6, vitamin B7, and vitamin B 12.
[0296]
[77] The method according to the above-mentioned
[51] , wherein the drug comprises folic acid, and at least one of vitamin B6 and B 12; or, the drug comprises folic acid or a derivative thereof, and at least one of vitamin B6, vitamin B 12, vitamin A, vitamin E, vitamin C, vitamin D, vitamin K, niacinamide, zinc oxide, taurine; or, the drug comprises folic acid or a derivative thereof, and niacinamide; or, the drug comprises folic acid or a derivative thereof, and vitamin E; or, the drug comprises folic acid or a derivative thereof, and vitamin A and vitamin E.
[0297]
[78] The method according to the above-mentioned
[51] , wherein the drug is in a dosage form suitable for children or a dosage form suitable for adults.
[0298]
[79] The method according to the above-mentioned
[78] , wherein the children include neonates within 28 days after birth, infants within 1 year of age, toddlers between 1 and 6 years of age, and children between 6 and 18 years of age.
[0299]
[80] The method according to the above-mentioned
[78] , wherein the adults include female adults in gestation, female adults in perinatal period, and female adults in lactation.
[0300]
[81] The method according to the above-mentioned
[51] , wherein the drug is in a dosage form for gastrointestinal administration or a dosage form for non-gastrointestinal administration.
[0301]
[82] The method according to the above-mentioned
[51] , wherein the drug is in a dosage form comprising a capsule, a tablet, a microcapsule preparation, an injection, a suppository, a spray, a powder, a soft capsule, a dripping pill, a honeyed pill, a pill, a granule, a honeyed paste, a controlled release preparation, an oral liquid preparation, a chewable tablet, a buccal tablet, a transdermal patch, and an effervescent tablet.
[0302]
[83] The method according to the above-mentioned
[51] , wherein the folic acid or a derivative thereof is in a unit dose of 0.1 mg to 1 g in the drug.
[0303]
[84] The method according to the above
[51] , wherein the unit dose of the folic acid or its derivative in the medicament is 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg, or 1.0 mg.
[0304]
[85] The method according to the above
[51] , wherein the unit dose of the folic acid or its derivative in the medicament is 0.2 mg, 0.4 mg, 0.8 mg, or 1.0 mg.
[0305]
[86] A diagnostic or auxiliary diagnostic marker for biliary atresia, comprising:
[0306] a) folic acid; and
[0307] b) at least one of S100a8, S100a9, Nox2, IFN-gamma.
[0308]
[87] The marker according to
[86] , wherein the S100a8, S100a9, Nox2, and IFN-gamma include proteins and / or mRNAs.
[0309]
[88] The marker according to
[86] , wherein the diagnostic or auxiliary diagnostic marker is from a body fluid, blood, tissue, cell, or excretion;
[0310]
[89] The marker according to
[88] , wherein the tissue includes liver, intestinal tract;
[0311]
[90] The marker according to
[88] , wherein the excretion includes feces, urine;
[0312]
[91] The marker according to
[88] , wherein the blood is whole blood, serum or plasma, dried blood spot.
[0313]
[92] Use of a reagent for detecting a marker in the manufacture of a product for diagnosing or aiding in the diagnosis of biliary atresia: the marker comprises at least one of folic acid, S100a8, S100a9, Nox2, IFN-gamma.
[0314]
[93] The use according to
[92] , wherein the S100a8, S100a9, Nox2, and IFN-gamma include proteins and / or mRNAs.
[0315]
[94] The use according to
[92] , wherein the product includes a reagent, a kit, a gene chip, and a protein chip;
[0316]
[95] The use according to
[92] , wherein the product is used to perform at least one of the following detection methods:
[0317] (d1) colorimetry; (d2) chemiluminescence; (d3) atomic absorption spectrophotometry; (d4) polymerase chain reaction; (d5) micro digital polymerase chain reaction; (d6) fluorescent polymerase chain reaction; (d7) loop-mediated isothermal amplification reaction; (d8) enzyme-linked immunosorbent assay; (d9) nucleotide sequence sequencing method; (d10) amino acid sequence sequencing method; (d11) denaturing gradient gel electrophoresis; (d12) nucleic acid typing chip detection; (d13) high performance liquid chromatography; (d14) in situ hybridization; (d15) biological mass spectrometry; (d16) high resolution melting curve analysis; (d17) single strand conformational isomerism polymorphism analysis; (d18) probe amplification block mutation system analysis.
[0318]
[96] The use according to
[92] , when the marker is mRNA of S100a8, S100a9, Nox2 and IFN-γ, the product contains primers for detecting the marker and / or internal standard mRNA, and / or detection probes;
[0319]
[97] The use according to
[92] , when the marker is S100a8 mRNA, the product comprises primers for detecting S100a8 mRNA, the nucleotide sequences of the primers are shown as SEQ ID NO. 1 and SEQ ID NO. 2;
[0320]
[98] The use according to
[92] , when the marker is S100a9 mRNA, the product comprises primers for detecting S100a9 mRNA, the nucleotide sequences of the primers are shown as SEQ ID NO. 3 and SEQ ID NO. 4;
[0321]
[99] The use according to
[92] , when the marker is IFN-γ mRNA, the product comprises primers for detecting IFN-γ mRNA, the nucleotide sequences of the primers are shown as SEQ ID NO. 5 and SEQ ID NO. 6;
[0322]
[100] The use according to
[92] , when the marker is Nox2 mRNA, the product comprises primers for detecting Nox2 mRNA, the nucleotide sequences of the primers are shown as SEQ ID NO. 7 and SEQ ID NO. 8.
[0323]
[101] The use according to
[92] , when the subject satisfies at least one of (c1) to (c5), it is diagnosed as a patient with biliary atresia disease;
[0324] (c1) folate is significantly reduced relative to the reference level;
[0325] (c2) S100a8 is significantly increased relative to the reference level;
[0326] (c3) S100a9 is significantly increased relative to a reference level;
[0327] (c4) IFN-γ is significantly increased relative to a reference level;
[0328] (c5) Nox2 is significantly decreased relative to a reference level;
[0329] The reference level is that of a subject of the same age who does not have a biliary atresia disease.
[0330]
[102] The use according to
[101] , wherein the subject of the same age is a healthy person or a patient with a choledochal cyst.
[0331]
[103] The use according to
[92] , wherein the marker is from a body fluid, blood, tissue, cell or excretion.
[0332]
[104] The use according to
[103] , wherein the tissue comprises liver, intestinal tract.
[0333]
[105] The use according to
[103] , wherein the excretion comprises feces, urine.
[0334]
[106] The use according to
[103] , wherein the blood is whole blood, serum or plasma, dried blood spot.
[0335]
[107] The use according to
[103] , wherein the subject to be tested is an adult or a child.
[0336]
[108] The use according to
[107] , wherein the child comprises a neonate within 28 days of birth, an infant under 1 year of age, a toddler between 1 and 6 years of age, and a child between 6 and 8 years of age.
[0337]
[109] The use according to
[107] , wherein the adult is selected from a female adult in gestation, a female adult in perinatal period or a female adult in lactation.
[0338]
[110] A kit comprising a reagent for detecting a marker; the marker comprises at least one of folate, S100a8, S100a9, Nox2, IFN-γ.
[0339]
[111] The kit according to
[110] , wherein the marker comprises:
[0340] a) folate; and
[0341] b) at least one of S100a8, S100a9, Nox2, IFN-γ.
[0342]
[112] The kit according to
[110] , when the markers detected are mRNA of S100a8, S100a9, Nox2 and IFN-γ, the products contain primers for detecting the markers and / or internal control mRNA, and / or detection probes.
[0343]
[113] The kit according to
[110] , when the markers detected are mRNA of S100a8, S100a9, Nox2 and IFN-γ, the products further comprise: sample processing reagents, including but not limited to sample lysis reagents, sample purification reagents and / or sample nucleic acid extraction reagents.
[0344]
[114] The kit according to
[110] , when the markers detected are mRNA of S100a8, S100a9, Nox2 and IFN-γ, the products further comprise: one or more of RNA extraction reagents, dNTPs, DNA polymerase, double-stranded specific fluorescent dyes and water.
[0345]
[115] The kit according to
[110] , when the marker detected is S100a8 mRNA, the products comprise primers for detecting S100a8 mRNA, the nucleotide sequences of the primers are shown in SEQ ID NO. 1 and SEQ ID NO. 2.
[0346]
[116] The kit according to
[110] , when the marker detected is S100a9 mRNA, the products comprise primers for detecting S100a9 mRNA, the nucleotide sequences of the primers are shown in SEQ ID NO. 3 and SEQ ID NO. 4.
[0347]
[117] The kit according to
[110] , when the marker detected is IFN-γ mRNA, the products comprise primers for detecting IFN-γ mRNA, the nucleotide sequences of the primers are shown in SEQ ID NO. 5 and SEQ ID NO. 6.
[0348]
[118] The kit according to
[110] , when the marker detected is Nox2 mRNA, the products comprise primers for detecting Nox2 mRNA, the nucleotide sequences of the primers are shown in SEQ ID NO. 7 and SEQ ID NO. 8.
[0349]
[119] The kit according to
[110] , the detection sample or test sample of the products is from a body fluid, blood, tissue, cell or excrement of the subject to be tested; further preferably, the marker is from blood, tissue or excrement.
[0350]
[120] The kit according to
[119] , the tissue comprises liver, intestinal tract.
[0351]
[121] The kit according to
[119] , wherein the excretion includes feces, urine.
[0352]
[122] The kit according to
[119] , wherein the blood is whole blood, serum or plasma, dried blood spot; further serum, dried blood spot.
[0353]
[123] The kit according to
[110] , wherein the subject is an adult or a child.
[0354]
[124] The kit according to
[123] , wherein the child includes a neonate within 28 days of birth, an infant within 1 year of age, a toddler between 1 and 6 years of age, and a child between 6 and 8 years of age.
[0355]
[125] The kit according to
[123] , wherein the adult is selected from a female adult in gestation, a female adult in perinatal period, or a female adult in lactation.
[0356]
[126] The kit according to
[110] , wherein the subject is diagnosed as a patient with biliary atresia disease when the subject satisfies at least one of (c1) to (c5);
[0357] (c1) folate is significantly decreased relative to a reference level;
[0358] (c2) S100a8 is significantly increased relative to a reference level;
[0359] (c3) S100a9 is significantly increased relative to a reference level;
[0360] (c4) IFN-g is significantly increased relative to a reference level;
[0361] (c5) Nox2 is significantly decreased relative to a reference level;
[0362] the reference level is a level of a subject of the same age without biliary atresia disease
[0363]
[127] The kit according to
[126] , wherein the subject of the same age is a healthy person or a patient with choledochal cyst.
[0364]
[128] A method of diagnosing or aiding in the diagnosis of biliary atresia disease, the method comprising detecting the level and / or activity of at least one of the markers: folate, S100a8, S100a9, Nox2, IFN-g.
[0365]
[129] The method according to
[128] , the method comprising detecting
[0366] a) folate; and
[0367] b) a level and / or activity of at least one of S100a8, S100a9, Nox2, IFN-γ
[0368]
[130] The method according to
[128] , wherein the sample from the subject is from a body fluid, blood, tissue, cell or excretion from the subject to be tested; further preferably, the marker is from blood, tissue or excretion.
[0369]
[131] The method according to
[130] , wherein the tissue comprises liver, intestinal tract.
[0370]
[132] The method according to
[130] , wherein the excretion comprises feces, urine.
[0371]
[133] The method according to
[130] , wherein the blood is whole blood, serum or plasma, dried blood spot; further serum, dried blood spot.
[0372]
[134] The method according to
[128] , wherein the subject to be tested is an adult or a child.
[0373]
[135] The method according to
[134] , wherein the child comprises a neonate within 28 days of birth, an infant within 1 year of age, a toddler from 1 to 6 years of age, and a child from 6 to 8 years of age.
[0374]
[136] The method according to
[134] , wherein the adult is selected from a female adult in gestation, a female adult in perinatal period or a female adult in lactation.
[0375]
[137] The method according to
[128] , wherein the subject to be tested is diagnosed as a patient with biliary atresia disease when at least one of (c1) to (c5) is satisfied:
[0376] (c1) folate is significantly decreased relative to a reference level;
[0377] (c2) S100a8 is significantly increased relative to a reference level;
[0378] (c3) S100a9 is significantly increased relative to a reference level;
[0379] (c4) IFN-γ is significantly increased relative to a reference level;
[0380] (c5) Nox2 is significantly decreased relative to a reference level;
[0381] the reference level is a level of a subject of the same age without biliary atresia disease;
[0382]
[138] The method according to
[137] , wherein the subject of the same age is a healthy person or a patient with choledochal cyst.
[0383]
[139] The method according to
[128] , when the detected marker is mRNA of S100a8, S100a9, Nox2 and IFN-γ, the detection method further comprises using primers and / or detection probes of the marker and / or internal reference mRNA.
[0384]
[140] The method according to
[128] , when the detected marker is mRNA of S100a8, S100a9, Nox2 and IFN-γ, the detection method further comprises using: processing reagents of the sample, including but not limited to sample lysis reagent, sample purification reagent and / or sample nucleic acid extraction reagent.
[0385]
[141] The method according to
[128] , when the detected marker is mRNA of S100a8, S100a9, Nox2 and IFN-γ, the detection method further comprises using: one or more of RNA extraction reagent, dNTP, DNA polymerase, double-stranded specific fluorescent dye and water.
[0386]
[142] The method according to
[128] , when the detected marker is S100a8 mRNA, the detection method further comprises using primers of S100a8 mRNA, the nucleotide sequence of the primers is shown as SEQ ID NO. 1 and SEQ ID NO. 2.
[0387]
[143] The method according to
[128] , when the detected marker is S100a9 mRNA, the detection method further comprises using primers for detecting S100a9 mRNA, the nucleotide sequence of the primers is shown as SEQ ID NO. 3 and SEQ ID NO. 4.
[0388]
[144] The method according to
[128] , when the detected marker is IFN-γ mRNA, the detection method further comprises using primers for detecting IFN-γ mRNA, the nucleotide sequence of the primers is shown as SEQ ID NO. 5 and SEQ ID NO. 6.
[0389]
[145] The method according to
[128] , when the detected marker is Nox2 mRNA, the detection method further comprises using primers for detecting Nox2 mRNA, the nucleotide sequence of the primers is shown as SEQ ID NO. 7 and SEQ ID NO. 8.
[0390] The beneficial effects of the present application are:
[0391] 1. The embodiments of this invention demonstrate that folic acid intervention in RRV-induced biliary atresia model mice effectively controls the occurrence and development of biliary atresia. Therefore, this invention utilizes folic acid or its derivatives, a highly safe nutrient that humans require daily, to prevent and treat biliary atresia and its closely related disease, cholangitis. Folic acid or its derivatives (e.g., its pharmaceutical salts), as a safe water-soluble vitamin, can be directly applied or added to nutritional foods or preparations for use by women preparing for pregnancy, pregnant women, breastfeeding women, and / or newborns, thereby fundamentally preventing and treating the occurrence, development, and prognosis of biliary atresia with few toxic side effects.
[0392] 2. The embodiments of the present invention demonstrate that folic acid supplementation can also inhibit the expression of intestinal inflammatory factors, reduce intestinal iron content, and correct intestinal flora imbalance. Therefore, the present invention provides an economical, safe, and effective composition for regulating intestinal flora balance and preventing inflammatory bowel disease and other enteritis diseases. Its active ingredient is folic acid or its derivatives, providing a feasible solution for the prevention and treatment of acute / chronic, inflammatory / non-inflammatory gastrointestinal diseases for a wide range of patients with gastrointestinal diseases.
[0393] 3. The embodiments of this invention demonstrate that folic acid, when used in a mouse model of viral-induced biliary atresia, can significantly reduce the jaundice rate, improve liver function, and inhibit the expression of the hepatic or intestinal cytotoxic cytokine IFN-γ. Simultaneously, it can also inhibit the expression of intestinal inflammatory factors, reduce intestinal iron content, and correct intestinal flora imbalance. Therefore, this invention provides a safe and active ingredient—folic acid—that can simultaneously act on the bile, liver, and intestinal digestive tract. Thus, in addition to preventing and treating biliary atresia and flora imbalance, this invention, through the diversity of its target sites, can also achieve preventive and therapeutic effects on diseases such as liver fibrosis, enterohepatic circulation disorders, viral infections, and cholangitis—a milder form of biliary atresia.
[0394] 4. The embodiments of the present invention demonstrate that, in BA mice, folic acid can inhibit the expression of inflammatory cytokines S100a8, S100a9 and IFN-γ in the intestine and / or liver, as well as iron overload in the disease, and promote the expression of Nox2, a characteristic transcription factor of myeloid-derived suppressor cells. It also demonstrates that at least one of folic acid, S100a8, S100a9, IFN-γ and Nox2 can serve as a marker for the diagnosis or auxiliary diagnosis of biliary atresia.
[0395] 5. The present application also proves that folic acid can also reduce the total bilirubin concentration and direct bilirubin concentration of patients with biliary atresia, and achieve the effect of preventing and / or treating cholangitis. At the same time, supplementing folic acid can also achieve the effect of correcting systemic iron overload and luminal iron deficiency, inhibiting small intestinal eosinophil infiltration, inhibiting the production of IgG-Ro / SSA autoantibodies, increasing the IgM / IgG4 ratio, and at the same time, prolonging the autoimmune period and improving liver function; the present application also proves that supplementing calcium folinate (CF) can reduce the content of INFβ and ROS in the liver, reduce the incidence of jaundice and improve the growth of newborns; increase the expression of Dhfr, Mthfr, Nrf2 and Slc40a1 in the small intestine, so that folic acid metabolism, oxidative stress and iron homeostasis are restored; reduce the content of CD4 + T cells, CD8 + IFN-γ content in T cells, IgG1 content in plasma cells; reduce lymphocyte infiltration around the portal tract of the liver; increase the integrity of the liver lobule structure; restore the ballooning degeneration of intestinal epithelial cells, achieve the effect of treating biliary atresia; by supplementing folic acid or its derivatives (calcium folinate), bacterial and / or viral infections can be prevented and / or treated, thereby achieving the effect of preventing and / or treating infectious diseases in newborns.
[0396] Therefore, the nutritional food and / or preparation and / or medicine added with folic acid or its derivatives is a safe, effective, economical and feasible method for preventing and treating biliary atresia, cholangitis, liver fibrosis, hepatointestinal circulation disorder, inflammatory bowel disease, viral infection, regulating intestinal flora balance and infectious diseases in newborns. BRIEF DESCRIPTION OF DRAWINGS
[0397] Figure 1 is a result graph of folic acid content in patients with biliary atresia (BA) and choledochal cyst (CC); A is a result graph of folic acid level in serum of patients with biliary atresia (BA) and choledochal cyst (CC); B is a receiver operating characteristic (ROC) curve graph of the predictive performance of folic acid in distinguishing BA from non-BA subjects (choledochal cyst (CC) patients).
[0398] Figure 2 is a result graph of the preventive and therapeutic effect of folic acid on a biliary atresia mouse model; A is a schematic diagram of the treatment scheme of the BA model mouse; B is a result graph of the effect of folic acid on the body weight of the biliary atresia mouse model; C is a result graph of the effect of folic acid on the incidence of jaundice in the biliary atresia mouse model; D is a result graph of the effect of folic acid on the necrotic foci and lymphocyte infiltration of the liver of the biliary atresia mouse model; E is a result graph of the effect of folic acid on the content of CD4 + IFN-γ content in T cells.
[0399] Figure 3Figure is a graph showing the effect of folic acid on the intestinal epithelium of a biliary atresia mouse model.
[0400] Figure 4 Figure is a graph showing the effect of folic acid on the intestinal villi of a biliary atresia mouse model.
[0401] Figure 5 Figure is a graph showing the effect of folic acid on inflammatory factors in a biliary atresia mouse model.
[0402] Figure 6 Figure is a graph showing the effect of folic acid on the over-activation of the type I interferon pathway caused by viral or bacterial infection.
[0403] Figure 7 Figure is a graph showing the results of the preventive and therapeutic effects of calcium folinate on a biliary atresia mouse model: A is a graph showing the effect of calcium folinate on the body weight of a biliary atresia mouse model; B is a graph showing the effect of calcium folinate on the lymphocyte infiltration around the portal tract, the integrity of the liver lobule structure, and the ballooning degeneration of intestinal epithelial cells in a biliary atresia mouse model; C is a graph showing the effect of calcium folinate on the incidence of jaundice in a biliary atresia mouse model; D is a graph showing the effect of calcium folinate on the content of INFβ and ROS in the liver of a biliary atresia mouse model; E is a graph showing the expression of Dhfr, Mthfr, Nrf2, and Slc40a1 in the small intestine of a biliary atresia mouse model; F is a graph showing the expression of CD4 + T cells, CD8 + T cells, and the content of IgG1 in plasma cells.
[0404] Figure 8 Figure is a graph showing the effect of folic acid on the incidence of cholangitis in biliary atresia infants: A is a schematic diagram of the treatment plan for BA infants; B is a graph showing the demographic and clinical characteristics of BA infants; C is a summary graph showing the effect of folic acid on the incidence of cholangitis in biliary atresia infants.
[0405] Figure 9 Figure is a graph showing the effect of folic acid on the incidence of cholangitis in biliary atresia infants: A is a graph showing the incidence of cholangitis at different times after biliary atresia infants received folic acid treatment; B is a graph showing the effect of folic acid on the total bilirubin concentration in biliary atresia infants; C is a graph showing the effect of folic acid on the direct bilirubin concentration in biliary atresia infants.
[0406] Figure 10 Figure is a graph showing the results of the study on the mechanism of folic acid treatment for biliary atresia: A is a schematic diagram of the single-cell sequencing experiment design based on the BD Rhapsody "M" platform; B is a graph showing the effect of folic acid on the distribution and proportion of intestinal cells; C is a graphical summary of the mechanism of folic acid treatment for biliary atresia.
[0407] Figure 11Fig. 1 is a graph of the effect of folic acid on the expression of genes in intestinal cells and the concentration of BH4 in plasma and HCY in liver biopsy: wherein A is a graph of the effect of folic acid on the expression of genes in intestinal cells; B is a graph of the effect of folic acid on the expression of SLC11A2, SLC40A1 and SLC46A1 genes in intestinal cells; C is a graph of the effect of folic acid on the concentration of BH4 in plasma and HCY in liver biopsy.
[0408] Figure 12 Fig. 2 is a graph of the effect of folic acid on the concentration of iron, Ro / SSA IgG, Ro / SSA IgM and IgM / IgG ratio in liver: wherein A is a graph of the effect of folic acid on the concentration of iron; B is a graph of the effect of folic acid on Ro / SSA IgG, Ro / SSA IgM and IgM / IgG ratio in liver.
[0409] Figure 13 Fig. 3 is a graph of the results of folic acid in inhibiting the occurrence of food allergy in patients with biliary atresia and gallbladder cyst: wherein A is a graph of the results of the investigation of the proportion of the occurrence of food allergy in patients after biliary atresia surgery and after gallbladder cyst surgery; B is a graph of the results of the significant reduction in the number of eosinophils in the intestinal tract of patients with biliary atresia surgery after taking folic acid for 7 days participating in food allergy. DETAILED DESCRIPTION
[0410] The present application will be further described with reference to the following specific examples and drawings.
[0411] It is to be understood that the examples are only for illustrating the present application and not for limiting the scope of the present application.
[0412] Reference will now be made in detail to implementations of the present application, one or more examples of which are described hereinbelow. Each example is provided by way of explanation of the present application, not limitation of the present application. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the implementations disclosed herein without departing from the scope or spirit of the present application. For example, features illustrated or described as part of one implementation can be used with another implementation to yield a still further implementation.
[0413] Thus, it is intended that the present application cover modifications and variations of this application provided they come within the scope of the appended claims and their equivalents. Other objects, features, and aspects of the present application are disclosed in or are apparent from the following detailed description of the application. It is to be understood by the skilled artisan that the discussion below is merely an illustration of the presently disclosed implementations and is not intended to limit the broader aspects of the present application.
[0414] For the present invention, the term "dosage" is understood by the skilled person to mean that the medicament or composition should contain at least 0.1 mg of folic acid. The normal requirement of folic acid for a healthy person is 0.2-0.4 mg / day, and for pregnant women and breast-feeding women it is 0.4 mg / day. For the purpose of disease treatment, however, higher amounts of folic acid are required, for example 0.8 mg to 1 g / day. For the purpose of ease of administration, the medicament is preferably in unit form, i.e. a preparation which contains the active ingredient required for one administration. Common unit forms are, for example, one unit (tablet) tablet, one unit (needle) injection or powder injection, etc., in which the active ingredient is in the amount required for one administration. The amount required for one administration can be easily calculated as the product of the body weight of the subject and the unit body weight dose (hereinafter referred to as "dosage") required for one administration by the subject. For example, in the process of preparing the medicament, the body weight of an adult is usually taken as 60 kg, and this value can be used for calculation. The unit body weight dose for different subjects can be calculated by the equivalent dosage conversion relationship. For example, the effective dosage for humans can be derived from the dosage for experimental animals according to the equivalent dosage conversion relationship between experimental animals and humans known to those skilled in the art (usually see the guidelines of drug regulatory agencies such as FDA, SFDA, etc., and also see Huang Jihan et al. Equivalent dosage conversion between animals and humans in pharmacological tests. Chinese Clinical Pharmacology and Therapeutics, 2004 Sep; 9(9): 1069-1072). The active ingredient folic acid or its derivative (for example, its pharmaceutically acceptable salt) of the present invention can be administered to patients at a daily dosage of 0.8 mg to 1 g / day, and the amount of administration can be adjusted according to the actual situation of factors such as the gender, body weight, age, and degree of symptoms of the patient.
[0415] For the present invention, the term "folic acid" is understood by the skilled person to mean folic acid (PTEROYL MONOGLUTAMATE), or to include all functional equivalents thereof, and derivatives thereof, a compound in which the pyrazine ring of the pterin moiety of folic acid or polyglutamate is reduced to dihydrofolic acid or tetrahydrofolic acid, or a derivative of all the above compounds, in which the N-5 or N-10 position carries one carbon unit at various oxidation levels, or a pharmaceutically compatible salt thereof or a combination of two or more thereof. In particular, folic acid is meant in the form of free folic acid (pteroylglutamic acid) or folinic acid (formyltetrahydrofolic acid). In addition, the equivalents or derivatives of folic acid can be selected from: folinic acid, dihydrofolic acid, tetrahydrofolic acid, 5-methyltetrahydrofolic acid, 5,10-methylenetetrahydrofolic acid, 5,10-formylimidazolyltetrahydrofolic acid, 5-formyltetrahydrofolic acid (leucovorin), 10-formyltetrahydrofolic acid, 10-methyltetrahydrofolic acid, a pharmaceutically acceptable salt thereof, or a combination of two or more thereof.
[0416] For the present invention mentioned "vitamin B group", those skilled in the art should understand that the vitamin B group includes vitamin B1 (thiamine), vitamin B2 (riboflavin), vitamin B3 (niacin), vitamin B5 (pantothenic acid), vitamin B6 (pyridoxine), vitamin B12 (cyanocobalamin), vitamin B7 (biotin) and the like, which is an effective component for promoting folate absorption.
[0417] For the present invention mentioned "vitamin C", which has the effect of enhancing the efficacy of folic acid therapy.
[0418] For the present invention mentioned "vitamin A", which is a fat-soluble vitamin, an organic compound, the chemical formula is C 20 H 30 O, stable to heat, acid, base, easy to be oxidized, and ultraviolet light can promote its oxidative destruction. Vitamin A includes A1 and A2, A1 is retinol. Vitamin A2 is 3-dehydroretinol. Vitamin A has the physiological functions of promoting growth, reproduction, maintaining bone, epithelial tissue, vision and normal secretion of mucosal epithelium, and vitamin A and its analogues have the effect of preventing precancerous lesions.
[0419] Homocysteine (also known as homocysteine, plasma homocysteine, homocysteine, Hcy) is an intermediate product in the process of methionine metabolism, and its structural formula is HSCH2(NH2)CO2H. There are two forms of oxidized and reduced HCY in plasma. The oxidized form contains disulfide, including homocysteine and cysteine; the reduced form contains sulfide, including homocysteine and cysteine.
[0420] For the present invention mentioned "taurine", which has the effects of protecting and protecting liver, can promote gastrointestinal function, increase human immunity, improve body resistance and disease resistance. Those skilled in the art should understand that its application in the treatment of biliary atresia can shorten the treatment course of biliary atresia with liver damage.
[0421] For the "biliary atresia" mentioned in the present application, those skilled in the art should understand that biliary atresia (BA) is one of the common severe hepatobiliary system diseases in infancy, characterized by progressive inflammation and fibrosis of intrahepatic and extrahepatic bile ducts; if not treated in time, late stage will appear cholestatic cirrhosis, portal hypertension, liver failure, which is a disease of unknown etiology affecting intrahepatic and extrahepatic bile ducts, leading to cholestasis and progressive liver fibrosis and endangering the life of the child. The clinical manifestations are: (1) delayed jaundice after birth (more than 2 weeks for full-term infants, more than 3 weeks for premature infants), or jaundice appears again after subsiding and persists; (2) feces color gradually lightens to white clay color, urine color darkens to strong tea color; (3) abdominal distension, hepatosplenomegaly, abdominal wall varices, etc.; (4) malnutrition or growth retardation due to fat-soluble vitamin absorption disorder.
[0422] For the "hepatointestinal circulation disorder" mentioned in the present application, those skilled in the art should understand that the diseases caused by the hepatointestinal circulation disorder include hypercholesterolemia, cholesterol stones, jaundice.
[0423] For the "inflammatory bowel disease" mentioned in the present application, those skilled in the art should understand that inflammatory bowel disease (IBD) is a kind of idiopathic intestinal inflammatory disease involving ileum, rectum and colon. The clinical manifestations are diarrhea, abdominal pain, and even bloody stool. This disease includes ulcerative colitis (UC) and Crohn's disease (CD). Ulcerative colitis is a continuous inflammation of the mucosa and submucosa of the colon, and the disease usually involves the rectum first and gradually spreads to the entire colon. Crohn's disease can involve the entire digestive tract and is a non-continuous full-thickness inflammation, most commonly involving the terminal ileum, colon and perianal region.
[0424] For the "viral infection" mentioned in the present application, those skilled in the art should understand that viral infection refers to the process in which viruses invade the body through various routes and proliferate in susceptible host cells. Human viruses refer to viruses that can infect the human body or have pathogenic effects on humans. The essence of viral infection is the interaction between viruses and the body, and between viruses and susceptible cells. Viral infection often causes varying degrees of damage or viral diseases due to differences in virus types and body conditions. Viral pathogenesis begins with invasion of the host and infection of cells, and the pathogenic effect is manifested in the whole body and cells.
[0425] For the "intestinal flora disorder" mentioned in the present application, those skilled in the art should understand that there is a stable and balanced flora in the intestines of healthy people, which maintains the normal intestinal environment. Once this intestinal environment is destroyed, intestinal flora disorder will occur, which will inevitably cause digestive system disorders. Diseases easily caused by intestinal flora disorder include but are not limited to:
[0426] 1. Candida albicans enteritis
[0427] It is the most common type of intestinal flora disorder. It is more common in weak infants, indigestion, malnutrition, diabetes, malignant tumors, long-term use of antibiotics or hormones in patients.
[0428] 2. Staphylococcus enteritis
[0429] It is more common in elderly patients or patients with chronic diseases who have long-term use of antibiotics (tetracyclines, ampicillin, etc.), adrenal cortex hormones and intestinal surgery.
[0430] 3. Clostridium perfringens acute necrotizing enteritis
[0431] Clostridium perfringens produces beta toxin, which can cause acute necrotic tumors, wasting diseases, and infections in cases of antibiotic, corticosteroid use, etc.
[0432] 4. Necrotizing enterocolitis and sepsis
[0433] It is an acquired disease, mainly occurring in premature infants or sick newborns (neonatal necrotizing enterocolitis, NEC), characterized by mucosal and even intestinal deep necrosis, most commonly occurring in the distal ileum, and the colon and proximal intestine are rarely involved. Epidemiological studies have confirmed that some clustered cases are related to the colonization of specific pathogenic bacteria in the intestine (such as Klebsiella, Escherichia coli, coagulase-negative Staphylococcus). Intestinal necrosis begins in the mucosal layer and gradually involves the entire intestinal wall, leading to perforation, and 1 / 3 of the newborns develop secondary sepsis.
[0434] 5. Pseudomonas aeruginosa intestinal infection
[0435] Pseudomonas aeruginosa is a conditional pathogen, often a secondary infection, most likely to occur in infants, the elderly, certain malignant tumors, wasting diseases, and cases of antibiotic, corticosteroid use, etc.
[0436] 6. Proteus enteric infection
[0437] Proteus can be a conditional pathogen under certain conditions, such as Proteus vulgaris, Proteus mirabilis, Morganella proteus, which can cause food poisoning, and Proteus hauseri, which can cause summer diarrhea in infants.
[0438] 7. Klebsiella enteric infection
[0439] When the body's resistance is reduced or for other reasons, Klebsiella normally parasitic in the intestinal tract can cause infection, especially severe diarrhea in children.
[0440] Intestinal flora disorder causes inflammation of the intestinal tract, and diarrhea is the most common clinical symptom of intestinal flora disorder. Severe diarrhea can cause dehydration and low blood pressure, and can also cause diseases of the respiratory system or urinary system if not treated in time.
[0441] For the "pregnancy" mentioned in the present application, those skilled in the art should understand that the pregnancy refers to the physiological period from conception to childbirth, also known as the gestation period. From the fertilization of a mature ovum to the delivery of a fetus, it is generally about 266 days. For ease of calculation, pregnancy is usually counted from the first day of the last menstrual period, and full-term pregnancy is about 280 days (40 weeks). During pregnancy, the metabolism, digestive system, respiratory system, vascular system, nervous system, endocrine system, reproductive system, bones, joints, ligaments, and breasts of the mother all undergo corresponding changes. The entire pregnancy period is divided into three periods: the first 13 weeks are called early pregnancy; the 14th to 27th weeks are called mid-pregnancy; and the 28th week and beyond are called late pregnancy.
[0442] For the "perinatal period" mentioned in the present application, those skilled in the art should understand that the perinatal period refers to the period from 28 weeks of pregnancy to one week after childbirth, which is the period before and after delivery.
[0443] For the "lactation period" mentioned in the present application, those skilled in the art should understand that the lactation period refers to the period when a postpartum woman uses her own milk to feed her baby, i.e. the period from the start of breastfeeding to the stop of breastfeeding, which is generally about 10 months to 2 years.
[0444] For the "diagnostic or auxiliary diagnostic marker" mentioned in the present application, a biomarker refers to a biochemical indicator that can mark changes or possible changes in the system, organ, tissue, cell, and subcellular structure or function, and has very wide applications. Biomarkers can be used for disease diagnosis, disease staging, or to evaluate the safety and effectiveness of new drugs or new therapies in target populations. Those skilled in the art should understand that for disease research, a biomarker generally refers to a certain characteristic biochemical indicator in a general physiological or pathological or therapeutic process that can be objectively measured and evaluated, and through its measurement, the current progress of the organism in the biological process can be known. Checking a disease-specific biomarker can help with disease identification, early diagnosis, and prevention, and monitoring during the treatment process.
[0445] For the "interferon gamma" mentioned in the present application, those skilled in the art should understand that interferon gamma, also known as γ-IFN or immunointerferon, is produced by T lymphocytes stimulated by mitogens. Interferon is a highly effective antiviral biological active substance and also a lymphokine with broad immunomodulatory effects.
[0446] For the "dosage form" mentioned in the present application, those skilled in the art should understand that the classification of pharmaceutical dosage forms is:
[0447] (I) Classification by route of administration
[0448] 1. Gastrointestinal administration dosage form
[0449] 2. Non-gastrointestinal administration dosage form
[0450] (1) Injection administration dosage form: such as various powder injections, water injections.
[0451] (2) Respiratory administration dosage form: such as isopropyl adrenaline hydrochloride aerosol.
[0452] (3) Skin administration dosage form: such as boric acid lotion.
[0453] (4) Mucosal administration dosage form: such as erythromycin eye ointment.
[0454] (5) Cavity administration dosage form: such as various suppositories for rectum, vagina, urethra.
[0455] (II) Classification by dispersion system
[0456] 1. Solution type
[0457] 2. Colloidal solution type
[0458] 3. Emulsion type
[0459] 4. Suspension type
[0460] 5. Gas dispersion type
[0461] 6. Microparticle dispersion type
[0462] 7. Solid dispersion type
[0463] (III) Classification by form
[0464] Liquid dosage form, gas dosage form, solid dosage form and semi-solid dosage form.
[0465] For the "adjuvant" mentioned in the present application, those skilled in the art should understand that the pharmaceutical adjuvant refers to the excipients and additives used in the dispensing of biological drugs and prescriptions, that is, the general term of all materials except the main active ingredients. In the preparation process of injection, in order to ensure safety, effectiveness and stability, in addition to the main drug and solvent, adjuvant is often added to increase solubility, improve stability, etc. In addition to excipients, acting as carriers and improving stability, pharmaceutical adjuvants also have important functions such as solubilization, solubilization, controlled release, etc. They are important components that may affect the quality, safety and effectiveness of drugs. It refers to the general term of all pharmaceutical materials in the prescription design process, except for the main drug, to solve the molding, effectiveness, stability and safety of the preparation. The process of prescription design of pharmaceutical preparation is essentially the process of screening and applying pharmaceutical adjuvants according to the characteristics of drugs and the requirements of dosage forms.
[0466] Pharmaceutical adjuvants are the basic materials and important components of pharmaceutical preparations, and are the material basis for ensuring the production and development of pharmaceutical preparations, playing a key role in the preparation of dosage forms and production. It not only gives the drug a certain dosage form, but also has a great relationship with improving the efficacy of the drug and reducing adverse reactions. Its reliability and diversity in quality are the basis for ensuring the advancement of dosage forms and preparations. According to the use, it can be divided into solvent, propellant, solubilizer, cosolvent, emulsifier, coloring agent, binding agent, disintegrating agent, filling agent, lubricant, wetting agent, osmotic pressure regulator, stabilizer, flow aid, flavoring agent, preservative, suspending agent, coating material, aromatic agent, anti-adhesion agent, integration agent, penetration enhancer, pH regulator, buffer, plasticizer, surfactant, foaming agent, defoaming agent, thickening agent, inclusion agent, humectant, absorbent, diluent, flocculating agent and anti-flocculating agent, filter aid, release retardant, etc.
[0467] For the "S100a8", "S100a9" mentioned in the present application, those skilled in the art should understand that S100a8, S100a9 encodes S100A8 (S100 Calcium Binding Protein A8) and S100A9 (S100 Calcium Binding Protein A9) calcium binding protein, often forming S100A8 / A9 heterodimer. Studies have shown that S100A8 and S100A9 are closely related to many pathological processes of chronic inflammatory diseases and various tumors. S100A8 and S100A9 proteins mainly mediate intracellular inflammatory signaling pathways by binding and activating Toll-like receptors and glycosylated end product receptors, and play an important regulatory role in inflammation.
[0468] For the myeloid derived suppressive cells (MDSC) mentioned in the present application, it is a group of natural immune cells with significant inhibitory function produced under pathological conditions (such as tumor, autoimmune disease, infection, etc.), and the differentiation is abnormal, leading to accumulation of MDSC, regulation of multiple signaling pathways and influence of multiple cytokines, and Nox2 is one of them. "Nox2" refers to Nox2 encoding NADPH oxidase 2, which is an important member of the NADPH oxidase family and plays an important regulatory role in inflammation.
[0469] For the genes / proteins mentioned in the present application, those skilled in the art know that the expression of genes and proteins is corresponding, so when it is proved that a gene has a function, it also means that the corresponding protein also has the corresponding function; vice versa.
[0470] For the "children" mentioned in the present application, those skilled in the art should understand that children refer to anyone under the age of 18, preferably, they are newborns within 28 days of birth, infants within 1 year of age, toddlers aged 1-6 years, and children aged 6-18 years.
[0471] For the "adults" mentioned in the present application, those skilled in the art should understand that adults refer to anyone over the age of 18, preferably, the adults are pregnant female adults, perinatal female adults or lactating female adults.
[0472] Unless otherwise specified, the reagents, methods and equipment used in the present application are conventional reagents, methods and equipment in the technical field. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.
[0473] Unless otherwise specified, the immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA used in the present application are the conventional skills in the art.
[0474] The experimental methods in the following examples without specific conditions are usually carried out according to the conventional conditions or according to the conditions recommended by the manufacturer. The materials, reagents and the like used in the present embodiment are commercially available reagents and materials unless otherwise specified.
[0475] Example 1. Obtaining of biliary atresia patient samples
[0476] In order to clarify the reasons for the occurrence and development of BA disease in patients, the present application collects clinical intestinal, liver and blood samples and detects metabolic related indicators.
[0477] 1. Collection of clinical samples and data:
[0478] Medical history, especially laboratory test indicators related to liver injury, of biliary atresia and control group choledochal cyst children were obtained from the hospital's electronic medical record system. Ethical statement: This project has been approved by the Medical Ethics Committee of Guangzhou Women and Children's Medical Center. The experiment was conducted in accordance with the "International Ethical Guidelines for Research Involving Human Subjects" described in the "Helsinki Declaration". The informed consent of the project research will be obtained from the patient or the legal guardian of the patient. The inclusion criteria of the subjects: The subjects of this study include two types of patients: one is recruited from patients diagnosed as highly suspected BA by experienced doctors in the pediatric hepatobiliary surgery of the participating institution, and the patients are planned to receive hepatobiliary Kasai surgery, the inclusion criteria are: ① 0-90 days of age of obstructive jaundice children; ② diagnosed as BA by intraoperative cholangiography; ③ guardian's informed consent; ④ not accompanied by nervous system diseases such as epilepsy; ⑤ not accompanied by unexplained anemia; ⑥ can be regularly followed up; two is recruited from patients diagnosed as biliary atresia who have completed Kasai surgery and are regularly followed up after surgery, the inclusion criteria are: ① 1-12 months of age of children, who have been diagnosed as BA; ② have received Kasai surgery treatment; ③ guardian's informed consent; ④ not accompanied by unexplained anemia; ⑤ not accompanied by nervous system diseases such as epilepsy. A total of 152 BA patients in the disease group and 63 choledochal cyst patients in the control group were recruited in this trial.
[0479] Exclusion criteria: (1) children with systemic inflammatory response syndrome or multiple system malformations; (2) children with unclear primary disease diagnosis; (3) children whose parents refuse to participate in the study or cannot obtain parental authorization; (4) patients who have not undergone Kasai surgery; (5) patients who cannot be followed up in time; (6) patients with pernicious anemia and suspected vitamin B12 deficiency.
[0480] Withdrawal criteria: Withdrawal criteria implemented by the researcher: (1) the subject has an abnormal function of an important organ during the trial; (2) the subject has a serious adverse drug allergy reaction during the trial; (3) the subject has poor compliance during the trial; (4) the subject's condition worsens or a serious adverse reaction occurs during the trial, requiring the subject to stop taking the trial drug or take other treatment methods. Withdrawal criteria implemented by the subject: (1) the subject's guardian voluntarily withdraws from the trial due to poor efficacy; (2) the subject's guardian voluntarily withdraws from the trial due to the desire to take other treatment methods; (3) the subject's guardian voluntarily withdraws from the trial without any reason.
[0481] Serum specimen collection:
[0482] With the patient's guardian's informed consent, 0.5-1 mL peripheral blood was collected at admission, during operation and after operation, and was placed in an ice box for transportation to the laboratory for processing. After receiving the sample, the laboratory first stored 0.3 mL of whole blood directly in a -80°C freezer, and the remaining blood was centrifuged (at 1800 rpm for 5 min) to collect serum, which was then stored. The remaining blood cells were added to peripheral blood lymphocyte separation medium (2 mL) or directly added to red blood cell lysis solution (4 mL) to separate or lyse the red blood cells to obtain red blood cell-free mononuclear cells (PBMC), which were counted, stored or subjected to the next step of flow cytometry staining.
[0483] Obtaining of liver samples:
[0484] With the patient's guardian's informed consent, the liver samples obtained during the operation were sent to pathology for fixation and sectioning, and the remaining part was placed in tissue preservation solution and transported to the laboratory in an ice box. After receiving the sample, the laboratory divided the sample into two parts for processing. One part was directly stored in a -80°C freezer after removing the blood on the surface of the tissue; the remaining part was ground, centrifuged (at 1800 rpm for 5 min), and the supernatant was collected and stored. After removing the liver cells, the remaining precipitate was subjected to flow cytometry staining.
[0485] Obtaining of intestinal samples from BA children: With the patient's guardian's informed consent, the intestinal tube for Kasai operation was taken, placed in tissue preservation solution, and transported to the laboratory in an ice box. After receiving the sample, the laboratory divided the sample into three parts. One part was fixed and sent for paraffin-embedded pathology sectioning; one part was quickly frozen in liquid nitrogen and stored in a -80°C freezer; the third part was cut into small pieces and placed in a shaking flask containing 10 mL of collagenase digestion solution (collagenase II, DNAase inhibitor, fetal bovine serum, RPMI1640 medium) for digestion at 37°C on a shaking table. After filtration and red blood cell lysis, the sample was finally resuspended in PBS and subjected to flow cytometry staining. The intestinal samples from children with choledochal cyst were obtained in the same way with the patient's guardian's informed consent, and the samples were obtained during the operation and subjected to the same sample processing steps.
[0486] Obtaining of embryonic intestinal samples: After signing the informed consent for active termination of pregnancy and biomedical research, the gynecological department assisted in obtaining the embryonic samples. The placenta was stripped in vitro, the umbilical cord was cut, the abdominal cavity was opened, and the intestines were removed. The intestines were fixed in 4% paraformaldehyde on ice for 2 hours, then transferred to 30% sucrose for overnight fixation, and the next day, the samples were embedded in OCT for frozen sectioning.
[0487] Example 2. Detection of serum folic acid
[0488] 1. Detection of serum folic acid (Serum Folic Acid):
[0489] The serum samples in Example 1 were taken for folate content detection, 55 cases of BA patients, and 18 cases of age-matched control disease (choledochal cyst) less than 9 months old, according to the method of folate detection kit (Novus, item number: NBP2-59966-1Kit): 10 standard wells were set on the enzyme-labeled coated plate, blank wells (blank control wells without sample and enzyme-labeled reagent, the rest of the operation was the same), and sample wells. In the enzyme-labeled coated plate, first add 40 μL of sample diluent to the sample well, then add 10 μL of sample to be tested (the final dilution of the sample is 5 times). After sealing the plate with sealing film and incubating at 37°C for 30 minutes, discard the liquid, shake dry, fill each well with washing solution, stand for 30 seconds, then discard, repeat 5 times, and tap dry. Add 50 μL of enzyme-labeled reagent to each well, except for the blank well. Incubate for 30 minutes, and wash with washing solution. Add 50 μL of color developing agent A to each well, then add 50 μL of color developing agent B, mix gently, and develop color at 37°C for 15 minutes. Add 50 μL of stop solution to each well to stop the reaction (at this time the blue color turns yellow). Zero the blank well, and measure the absorbance (OD value) of each well at 450 nm. The measurement should be performed within 15 minutes after adding the stop solution. In addition, the ROC curve (receiver operating characteristic) is used to verify the prediction performance of the BA-specific clinical indicator according to the AUC (area under the curve).
[0490] The results are as follows: Figure 1 As shown in Table A: by comparing biliary atresia (BA) and age-matched control patients with choledochal cyst (CC), it was found that the serum level of folate in BA patients was significantly reduced, P<0.05, indicating that BA patients have folate deficiency; Figure 1 Table B: The ROC curve verification of the above prediction results showed that folate can effectively distinguish BA subjects from CC cases (AUC=0.745), and folate can be used to distinguish BA subjects from healthy patients, with an AUC>0.75, indicating that folate can be used as one of the diagnostic or auxiliary diagnostic markers for BA.
[0491] Example 3. Prevention and treatment effect of folate on biliary atresia mouse model
[0492] 1. Establishment of biliary atresia animal model:
[0493] (1) Animals: Adult BALB / c pregnant mice, specific pathogen free (SPF) level, purchased from Guangdong Medical Experimental Animal Center. Raising in the SPF level environment of Guangzhou Medical University Experimental Animal Center. When the pregnant mice gave birth to newborn mice (average 8 newborn mice per pregnant mouse), the average weight was 1.5 g, and the newborn mice were randomly selected according to the experimental grouping for the experiment. The experimental animal disposal method conforms to the animal ethics standard.
[0494] (2) Modeling method: The newborn BALB / c mice were intraperitoneally injected with 20 μL (titer 1.0 x 10 6 PFU) of monkey MMU18006 rotavirus (hereinafter referred to as "RRV") within 24 hours of birth to establish a BA mouse animal model.
[0495] (3) Observation of the survival status of the mice: including the survival rate, growth weight, skin jaundice and liver function changes of the mice.
[0496] 2. Effect experiment of folic acid
[0497] Infection with Rhesus rotavirus (RRV) within 24 hours of birth to establish a BA model, on the basis of the established acute biliary atresia mouse model, according to the experimental requirements, a paired experiment was carried out, and the BA model was divided into different experimental groups: 1) Control mouse group (intraperitoneal injection of the same volume of PBS, n = 9); 2) RRV induced BA mouse model group (specific method synchronous step 1, n = 7); 3) Folic acid supplement group (RRV + FA, n = 11), on the basis of RRV induced BA mouse model, folic acid treatment was given, wherein the folic acid dose was 6.25 mg / kg, intraperitoneal injection, 16 hours after virus infection, once a day, the experiment was terminated on the 13th day (specific steps are as follows Figure 2 In the whole process of the experiment, the body weight, liver and gall appearance, jaundice characteristics and survival rate of the mice in each group were observed and recorded, and the liver immune cell subtypes were detected by flow cytometry, and the folic acid level was detected by ELISA.
[0498] The results are as follows:
[0499] Figure 2 Figure B in the middle, the body weight of the mice changed with time, from Figure 2 It can be seen from Figure B in the middle that from the 11th day of modeling, the body weight of the RRV induced BA mouse model group began to show significant difference (p < 0.01) compared with the control mouse group and the folic acid supplement group, especially on the 13th day, the body weight of the RRV induced BA mouse model group showed significant difference (P value reached 0.001) compared with the control mouse group and the folic acid supplement group, while the body weight of the control mouse group and the folic acid supplement group showed no significant difference (p > 0.05). It can be seen that the supplementation of folic acid significantly improved the weight loss of the BA model mice caused by RRV infection.
[0500] Figure 2 Figure 7 is a graph showing the change in jaundice rate over time in mice, from Figure 2 As shown in Figure 7, on the 13th day of termination of the experiment, the jaundice rate of the control mice group was 0%, the jaundice rate of the RRV-induced BA mouse model group was 80%, and the jaundice rate of the folic acid supplemented mice group was 30%. The jaundice rate of the RRV-induced BA mouse model group was significantly different from the jaundice rate of the folic acid supplemented mice group (p=0.0003). It can be seen that the BA model mice were successfully modeled, and the folic acid supplemented group significantly improved the reduced jaundice rate of the BA model mice, reducing the jaundice rate from 80% in the RRV group to 30%, showing a significant therapeutic effect.
[0501] Figure 2 Figure 8 is a graph showing the condition of necrotic foci or lymphocytes in the liver of mice, from Figure 2 As shown in Figure 8, on the 13th day of termination of the experiment, the necrotic foci and lymphocyte infiltration of the RRV-induced BA mouse model group were severe, while the necrotic foci and lymphocyte infiltration of the folic acid supplemented mice group were reduced, and were close to the necrotic foci and lymphocyte infiltration of the control mice, which were less obvious. It can be seen that folic acid showed a significant anti-inflammatory therapeutic effect in BA disease.
[0502] Figure 2 Figure 9 is a graph showing the IFN-γ content in CD4 + T cells in the liver, from Figure 2 As shown in Figure 9, on the 13th day of termination of the experiment, the IFN-γ content in CD4 + T cells in the liver of the RRV-induced BA mouse model group was significantly different from the IFN-γ content in CD4 + T cells in the liver of the control mice group and the folic acid supplemented group (p<0.01), while the IFN-γ content in CD4 T cells in the liver of the control mice group and the folic acid supplemented group was not significantly different (p>0.05). It can be seen that the expression of the cytotoxic cytokine IFN-γ in the liver of the folic acid supplemented group was significantly reduced relative to the RRV-induced BA mouse model group, and folic acid showed a significant anti-inflammatory and anti-viral therapeutic effect in BA disease, suggesting that the folic acid inhibited the secretion of the cytotoxic cytokine IFN-γ by T cells and played a protective role in BA liver.
[0503] 3. HE Staining Experiment
[0504] H&E staining (or simply HE staining). The specific method of HE staining is as follows: the animal tissue is fixed in 4% paraformaldehyde (PFA) for 24 h, sequentially immersed in 50%, 60%, 70%, 80%, 90% and 100% ethanol for dehydration, transparentized with xylene twice, embedded with paraffin, and 4 μm sections are prepared. After baking at 60°C, the paraffin sections are deparaffinized with xylene twice, each for 15 min, rehydrated with 100% and 70% ethanol, and immersed in distilled water twice. Hematoxylin is used for staining at room temperature for 6 min, and the floating color is washed away with running water. The color is separated with 1% hydrochloric acid alcohol for 3 s, and then placed in tap water, and the color is returned to blue with running water for 5 min. Eosin staining is performed for 3 min, and then the sections are dehydrated with 70% and 100% ethanol twice, transparentized with xylene twice, and embedded with neutral resin for microscopic examination.
[0505] The HE staining results of the mouse intestines are shown in Figure 3 、 4 From Figure 3 , it can be seen that on the 12th day of the experiment, the RRV-induced BA mouse model group showed significant vacuolar degeneration of the intestinal epithelium, while the folic acid supplemented group only showed slight vacuolar degeneration of the intestinal epithelium, close to the characteristics of the blank control group. From Figure 4 , it can be seen that compared with the RRV-induced BA mouse model group, the folic acid supplemented group showed significant growth of the intestinal villus length of the BA mouse, and the tissue structure was obviously more compact, close to the blank control. It can be seen that the folic acid supplemented group significantly repaired the RRV infection-induced vacuolar degeneration of the intestinal epithelium and damage to the tissue structure.
[0506] In summary, the above results show that folic acid plays a significant therapeutic role in BA mice by inhibiting the expression of toxic cytokines and repairing the intestinal barrier. Furthermore, from B and C in Figure 2 , it can be seen that the RRV-induced biliary atresia model showed obvious symptoms around 7 days, while the folic acid administration was performed at the same time as the modeling in this experiment, so the above results not only prove the therapeutic effect of folic acid on BA disease, but also prove the preventive effect of folic acid on BA. At the same time, in subsequent studies, the inventors further proved the preventive effect of folic acid on BA by pre-administering folic acid and setting a blank control before RRV virus infection to model BA.
[0507] Example 4 S100a8, S100a9, Nox2, IFN-γ for diagnosis of biliary atresia
[0508] 1. qPCR detection of expression of inflammatory factors
[0509] RNA was extracted from the intestinal tract of the three groups of mice in Example 3: the control mouse group; the RRV-induced BA mouse model group; and the folic acid supplement group. The RNA was extracted using the Trizol one-step method. The first strand of cDNA was synthesized using a Promega reverse transcription kit. The primers were designed according to the principle of crossing introns to avoid genomic contamination interference. The primer sequences are as follows:
[0510] S100a8: F: AAATCACCATGCCCTCTACAAG (SEQ ID NO. 1); R: CCCACTTTTATCACCATCGCAA
[0511] (SEQ ID NO. 2);
[0512] S100a9: F: ATACTCTAGGAAGGAAGGACACC (SEQ ID NO. 3); R: TCCATGATGTCATTTATGAGGGC (SEQ ID NO. 4);
[0513] IFN-γ: F: CCGAACTGTACGGACATCACA (SEQ ID NO. 5); R: TCATAGTGTTGAAATGGCTCCAG (SEQ ID NO. 6);
[0514] Nox2: F: TTCCCCCAATTCAATGTCTGG (SEQ ID NO. 7); R: TCCACCTGACACGACTTGAGA (SEQ ID NO. 8);
[0515] Real-time quantitative PCR amplification was detected using the Eva Green fluorescent dye method. The relative expression of the target gene was calculated using 2-ΔCT.
[0516] The results are as follows:
[0517] In the qPCR detection of intestinal tissue, it was found that, as shown in Table 1, the expression of S100a8 and S100a9 in the intestinal tissue of the RRV-induced BA mouse model group was significantly higher than that in the control mouse group and the folic acid supplement group (P < 0.05), and the expression of S100a8 and S100a9 in the intestinal tissue of the folic acid supplement group was significantly lower than that in the control mouse group (P < 0.05). Figure 5The expression of gene S100a8 is shown in the figure. In the RRV-induced BA mouse model group, gene S100a8 was abnormally highly expressed, while in the folic acid supplementation group it was only slightly higher than that in the blank control group. The expression of gene S100a8 in the RRV-induced BA mouse model group was significantly different from that in the folic acid supplementation group and the blank control group (p < 0.05), while there was no significant difference in the expression of gene S100a8 between the folic acid supplementation group and the blank control group. Therefore, the S100a8 gene (and its corresponding protein) can serve as one of the effective biomarkers for the diagnosis or auxiliary diagnosis of biliary atresia. When the expression level of S100a8 gene or its protein is detected to be high relative to the corresponding indicators in age-matched subjects without biliary atresia, it can be considered that the individual from whom the sample came has a high probability of having biliary atresia.
[0518] like Figure 5 The expression of gene S100a9 is shown in the figure. In the RRV-induced BA mouse model group, gene S100a9 was abnormally highly expressed, significantly different from the blank control group (p < 0.05). Although its expression was higher in the folic acid supplementation group than in the blank control group, it still effectively reduced gene S100a9 expression compared to the RRV-induced BA mouse model group. Therefore, the S100a9 gene (and its corresponding protein) can serve as an effective biomarker for the diagnosis or auxiliary diagnosis of biliary atresia. When high expression of the S100a9 gene or its protein is detected relative to the corresponding indicators in age-matched subjects without biliary atresia, the individual from whom the sample was taken is considered to have biliary atresia or a higher probability of having biliary atresia.
[0519] like Figure 5 As shown in the figure, IFN-γ gene expression was abnormally high in the RRV-induced BA mouse model group, and only slightly higher than the blank control group in the folic acid supplementation group. The expression of IFN-γ in the RRV-induced BA mouse model group was significantly different from that in the folic acid supplementation group and the blank control group (p < 0.05), while there was no significant difference in IFN-γ expression between the folic acid supplementation group and the blank control group. Therefore, the IFN-γ gene (and its corresponding protein) can serve as an effective biomarker for the diagnosis or auxiliary diagnosis of biliary atresia. When high expression of the IFN-γ gene or its protein is detected relative to the corresponding indicators in age-matched subjects without biliary atresia, the individual from whom the sample was taken is considered to have biliary atresia or a higher probability of having biliary atresia.
[0520] like Figure 5The expression of gene Nox2 in the graph is shown in the RRV-induced BA mouse model group, and the expression of gene Nox2 is abnormally low, which is significantly different from the blank control group (p<0.05); in the folic acid supplement group, although the expression is lower than that of the blank control group, compared with the RRV-induced BA mouse model group, the expression of gene Nox2 has been effectively improved. As can be seen, Nox2 gene (and should be understood as the corresponding protein thereof) can be used as one of the effective markers for the diagnosis or auxiliary diagnosis of biliary atresia disease, and when the expression of Nox2 gene or its protein is lower than the level of the corresponding index of the same age group of subjects without biliary atresia disease, it can be considered that the individual from which the sample comes has biliary atresia or has a higher possibility of having biliary atresia.
[0521] In summary, the expression amounts of S100a8, S100a9, IFN-γ, and Nox2 in the BA mouse model are significantly different from those of the blank control group. Therefore, S100a8, S100a9, IFN-γ, and / or Nox2 can be used as one of the effective markers for the diagnosis or auxiliary diagnosis of biliary atresia disease. Furthermore, by supplementing folic acid, the intestinal inflammation of the BA model mouse can be reduced, thereby achieving the purpose of preventing and treating intestinal diseases caused by biliary atresia.
[0522] On the basis of Example 2, the inventors found through experiments that the use of folic acid in serum combined with one or more of S100a8, S100a9, IFN-γ, and Nox2 in intestinal tissue can be more accurately used for the diagnosis or auxiliary diagnosis of biliary atresia, with higher accuracy, specificity, and higher AUC values.
[0523] Example 5. Preventive and therapeutic effects of calcium folinate on biliary atresia mouse models
[0524] 1. Establishment of a biliary atresia animal model:
[0525] (1) Animals: Adult BALB / c pregnant mice, specific pathogen-free level (SPF level), purchased from Guangdong Medical Laboratory Animal Center. Raising in the SPF level environment of Guangzhou Medical University Experimental Animal Center. After the pregnant mice gave birth to newborn mice (8 newborn mice per pregnant mouse on average), the average body weight was 1.5 g, and the newborn mice were randomly selected according to the experimental grouping for experiments. The experimental animal disposal method conforms to the animal ethics standards.
[0526] (2) Modeling method: The newborn BALB / c mice were intraperitoneally injected with 20 μL (titer 1.0 x 10 6 PFU) of monkey MMU18006 rotavirus (hereinafter referred to as “RRV”) within 24 hours of birth to establish a BA mouse animal model.
[0527] (3) Observation of the survival condition of mice: including the incidence of jaundice, growth weight, liver and intestinal manifestations of mice.
[0528] 2. Effect experiment of calcium folinate
[0529] Infection of Rhesus rotavirus (RRV) within 24 hours of birth to establish the BA model, on the basis of the established acute biliary atresia mouse model, according to the experimental requirements, the BA model was divided into different experimental groups: 1) Control mouse group (intraperitoneal administration of the same volume of PBS); 2) RRV induced BA mouse model group (RRV, specific method step 1); 3) Calcium folinate supplement group (RRV+CF), on the basis of the RRV induced BA mouse model, calcium folinate was administered, wherein the dose of calcium folinate was 5mg / kg, intraperitoneal injection, 16 hours after virus infection, administration once a day, and the experiment was terminated on the 12th day. During the whole experiment, the body weight, liver and intestinal manifestations, and the incidence of jaundice of mice in each group were observed and recorded, and the levels of INFβ and ROS in the liver, Dhfr, Mthfr, Nrf2, Slc40a1 in the small intestine were detected, and the immune cell subtypes in the liver were detected by flow cytometry, and the results are shown in Figure 7:
[0530] From the 10th day of modeling, the body weight of the RRV induced BA mouse model group began to show significant difference compared with the control mouse group and the calcium folinate supplement group (p<0.01), while there was no significant difference in body weight between the control mouse group and the calcium folinate supplement group (p>0.05) Figure 7 Fig. A);
[0531] On the 12th day of the termination of the experiment, the calcium folinate supplement group significantly reduced the lymphocyte infiltration around the portal area of the liver of the BA model mice; the calcium folinate supplement group significantly increased the integrity of the liver lobule structure of the BA model mice; the calcium folinate supplement group restored the ballooning degeneration of the intestinal epithelial cells of the BA model mice Figure 7 Fig. B);
[0532] On the 12th day of the termination of the experiment, the jaundice rate of the control mouse group was 0%, the jaundice rate of the RRV induced BA mouse model group was 100%, and the jaundice rate of the calcium folinate supplement group was less than 70%, and there was a significant difference in the jaundice rate between the RRV induced BA mouse model group and the calcium folinate supplement group (p<0.05), which indicated that the BA model mice were successfully modeled, and the calcium folinate supplement group significantly reduced the jaundice rate of the BA model mice, the jaundice rate decreased from 100% in the RRV group to less than 70%, showing a significant therapeutic effect Figure 7 Fig. C);
[0533] At the 12th day of the end of the experiment, there was a significant difference in the content of INFβ in the liver of the RRV-induced BA mouse model group and the control mouse group, the sub-folic acid calcium supplement group (p<0.01), and there was a significant difference in the content of ROS in the liver of the RRV-induced BA mouse model group and the control mouse group, the sub-folic acid calcium supplement group (p<0.05); the sub-folic acid calcium supplement group significantly reduced the content of INFβ and ROS in the liver of the BA model mouse Figure 7 D) in the liver;
[0534] At the 12th day of the end of the experiment, there was a significant difference in the expression of Dhfr, Mthfr, Nrf2, and Slc40a1 in the small intestine of the RRV-induced BA mouse model group and the control mouse group, the sub-folic acid calcium supplement group (p<0.05), and the sub-folic acid calcium supplement group significantly increased the expression of Dhfr, Mthfr, Nrf2, and Slc40a1 in the small intestine of the BA model mouse Figure 7 E) in the small intestine;
[0535] At the 12th day of the end of the experiment, there was a significant difference in the content of IFN-γ in CD4 + T cells and CD8 + T cells in the liver of the RRV-induced BA mouse model group and the control mouse group, the folic acid supplement group (p<0.001), and the sub-folic acid calcium supplement group significantly reduced the content of IFN-γ in CD4 + T cells and CD8 + T cells in the liver of the BA model mouse; there was a significant difference in the content of IgG1 in plasma cells in the liver of the RRV-induced BA mouse model group and the control mouse group, the folic acid supplement group (p<0.001), and the sub-folic acid calcium supplement group significantly reduced the content of IgG1 in plasma cells in the liver of the BA model mouse Figure 7 F) in the liver;
[0536] Therefore, the sub-folic acid calcium (CF) can reduce the content of INFβ and ROS in the liver, reduce the incidence of jaundice and improve the growth of newborns; increase the expression of Dhfr, Mthfr, Nrf2, and Slc40a1 in the small intestine, thereby restoring folate metabolism, oxidative stress, and iron homeostasis; reduce the content of IFN-γ in CD4 + T cells and CD8 + T cells and the content of IgG1 in plasma cells in the liver; reduce the lymphocyte infiltration around the portal tract in the liver; increase the integrity of the liver lobule structure; restore the ballooning degeneration of intestinal epithelial cells, and achieve the effect of treating biliary atresia.
[0537] Example 6. Effect of folic acid on the incidence of cholangitis in infants with biliary atresia and research on the treatment mechanism
[0538] In a clinical study, 19 BA subjects were orally administered folic acid at a dose of 0.4 mg / day for 6 months; at the same time, a group of BA subjects (n=38) matched in clinical characteristics such as age (at the time of Kasai surgery), sex, liver enzyme, bile acid and bilirubin status were recruited as controls to compare the effect of folic acid treatment (e.g. Figure 8 Fig. 6B shows the total bilirubin concentration in the folic acid treatment group and the control group.
[0539] It was found that the total incidence of bacterial cholangitis decreased from 74% (28 / 38) in the untreated group to 21% (4 / 19) in the folic acid treated group ( Figure 8 Fig. 6C, Figure 9 Fig. 6A). In addition, it was observed that the total bilirubin concentration and the direct bilirubin concentration in the folic acid treated patients were significantly reduced in the 3-month follow-up ( Figure 9 Fig. 6B, C).
[0540] The inventors also found that in patients with cholangitis, taking folic acid and not taking folic acid also showed significant differences in total bilirubin concentration and direct bilirubin concentration, and the total bilirubin concentration and direct bilirubin concentration in the folic acid treated patients were significantly reduced, indicating the effect of folic acid on the treatment of cholangitis.
[0541] Further, the inventors found through subsequent research and development that in patients with cholangitis, taking folic acid and vitamin B12 also showed a significant effect of reducing total bilirubin concentration and direct bilirubin concentration compared with not taking, indicating the combined treatment effect of folic acid and vitamin B on cholangitis.
[0542] In summary, on the one hand, cholangitis is an important pathological feature in the development of biliary atresia, and on the other hand, cholangitis is the most common complication after biliary atresia surgery, and the folic acid and its salts discovered by the present application can not only be used to prevent the occurrence of cholangitis, a complication of biliary atresia, but also can be applied to the treatment of cholangitis.
[0543] In order to further study the treatment mechanism of folic acid, an additional scRNA transcriptome dataset was generated using the BD Rhapsody platform ( Figure 10 Fig. 6A), and the analysis focused on intestinal epithelial cells ( Figure 10 Fig. 6B). After treatment, genes regulating folic acid absorption (FOLH1), iron export (FTH1, NCOA4, SLC40A1) and inhibiting lipid peroxidation (NFE2L2 / NRF2, SELENOP, GPX4) were significantly up-regulated, while the response to IFN-I (STAT1, IFITM2, IFITM3) was significantly reduced in patients receiving folic acid treatment ( Figure 10 Fig. 6C, Figure 11Folic acid treatment also significantly increased the concentration of tetrahydrobiopterin (BH4) in circulation but decreased the concentration of homocysteine in the liver Figure 11 C). The increase of SLC40A1 expression in intestinal epithelial cells demonstrated the correction of systemic iron overload and luminal iron deficiency. In patients who received folic acid treatment before surgery, the iron level in plasma decreased, but the fecal iron level increased in 10 cases Figure 12 A). Other therapeutic benefits of folic acid treatment include suppression of small intestinal eosinophil infiltration, suppression of IgG-Ro / SSA autoantibody production, and increase of IgM / IgG4 ratio Figure 12 B), which can predict liver health of BA and suppression of IFN-I signaling pathway in small intestine and liver myeloid cells.
[0544] Therefore, folic acid supplementation can reduce the total bilirubin concentration and direct bilirubin concentration of patients with biliary atresia, achieving the effect of preventing and / or treating cholangitis. At the same time, folic acid supplementation can also achieve the effects of correcting systemic iron overload and luminal iron deficiency, suppressing small intestinal eosinophil infiltration, suppressing IgG-Ro / SSA autoantibody production, increasing IgM / IgG4 ratio, prolonging autoimmune period, and improving liver function.
[0545] Example 7 Preventive and therapeutic effects of calcium folinate on viral and bacterial infections
[0546] 1. Differentiation of bone marrow-derived macrophages
[0547] 1) Mouse leg bone
[0548] After the mouse is anesthetized and executed by dislocation, the mouse is placed in a beaker containing sufficient 75% ethanol for 5 minutes of disinfection, and the soaked animal is wiped with paper to remove excess alcohol; a small opening is cut on the back of the mouse with scissors, and the skin is directly torn to the mouse calf joint, and the mouse foot joint and skin are removed; the hind limb is detached along the greater trochanter of the mouse thigh with scissors, and after removing the muscle tissue, it is placed in a culture dish containing 75% ethanol for 5 minutes, and a new culture dish containing 75% ethanol is moved to the clean bench.
[0549] 2) Extraction and induction of bone marrow macrophages (BMDM)
[0550] Ethanol soaked leg bones were moved to cold PBS soak, washed off the ethanol from the surface of tibia and femur, this process can be repeated 3 times; cleaned femur and tibia were separated and the ends of femur and tibia were cut off with scissors, 1 mL syringe was used to suck the cold induction medium to blow out the bone marrow from femur and tibia, repeated 3 times until no obvious red color was observed in the leg bone; 5 mL pipette was used to repeatedly blow the medium containing bone marrow cells to disperse the cell clumps, then 70 μm cell filter was used to sieve the cells, which were transferred to 15 mL centrifuge tube, centrifuged at 1500 rpm / min for 5 min, the supernatant was discarded, red blood cell lysis solution was added to resuspend and stand for 5 min, then centrifuged at 1500 rpm / min for 5 min, the supernatant was discarded, and the cells were resuspended with cold prepared bone marrow macrophage induction medium, and plated; the medium was not changed during cell culture, half of the bone marrow macrophage induction medium was changed after 3 days of culture, and all the medium was changed after 5 days, which could be used for subsequent experiments on the 7th day.
[0551] 2. Perform virus mimic antigen, virus or bacterial derived lipopolysaccharide stimulation
[0552] The medium in the culture dish was sucked off, and PBS or serum-free medium was used for washing once; the serum-free medium was changed; the transfection preparation solution was prepared, and the sterilized EP tube was prepared; taking a six-well plate as an example, A liquid: poly(I:C) (poly(I:C) (polyinosinic acid cytidylic acid) is a synthetic double-stranded RNA (dsRNA) analog, which simulates double-stranded RNA virus infection (stimulation concentration 5 ug / ml)) or poly dAdT (Poly(dA:dT) (polydeoxyadenylic acid) is a double-stranded alternating copolymer DNA model, which simulates DNA virus infection (5 ug / ml)) was diluted with 200 μl Opti-MEM; B liquid: 10 μl lipo2000 was diluted with 200 μl Opti-MEM, A liquid and B liquid were mixed gently, respectively, and stood for 5 min, B liquid was sucked into A liquid, mixed gently, and stood at room temperature for 20 min; transfection reagent or Sendai virus (Sev) (Sev is an antisense RNA virus, which simulates antisense RNA virus infection) or LPS (Sigma, stimulation concentration: 10 ng / ml) (derived from bacterial lipopolysaccharide, which simulates cell infection) was added to the medium of each well (Blank group without any substance), at the same time, the experimental group was given calcium folinate (Sigma, stimulation concentration 10 ug / ml) stimulation (the control group was added with the same amount of solvent), and the cells or culture supernatant was collected for I-IFN pathway activation detection after 16-18 hours of culture.
[0553] 3. ELISA method for detecting IFN-β
[0554] White flat bottom 96-well plates (Thermo Fisher) were coated with 50 μl mIFN-β capture antibody overnight at room temperature. After blocking, 50 ul of culture fluid, standard and 30 ng / ml lucia-conjugated detection antibody were added, and incubated at 37°C for 2h. After washing, 50ul of reconstituted QUANTI-Luc TM Plus was added immediately and detected by chemiluminescence. The microplate reader was pre-set, and the reading time was set to 0.5s.
[0555] The results are shown in Figure 6 Fig. 1. Bacteria, antisense RNA viruses, DNA viruses, etc. can cause excessive activation of I-IFN pathway in vivo, and the excessive activation of I-IFN caused by the above-mentioned bacterial and / or viral infection can be inhibited by supplementing folic acid or its derivatives (calcium folinate), that is, the bacterial and / or viral infection can be prevented and / or treated by supplementing folic acid or its derivatives (calcium folinate), thereby achieving the effect of preventing and / or treating neonatal infectious diseases.
[0556] On this basis, the inventors further found through experimental research that folic acid or its derivatives combined with at least one of the active ingredients vitamin B, vitamin C and taurine, especially combined with vitamin B6, vitamin B12, etc., showed more excellent inhibitory effect on the above-mentioned bacterial and viral infection.
[0557] Example 8 Preventive and therapeutic effects of folic acid combined with vitamin B on a mouse model of biliary atresia
[0558] 1. Establishment of a biliary atresia animal model:
[0559] (1) Animals: Adult BALB / c pregnant mice, specific pathogen free (SPF) level, purchased from Guangdong Medical Laboratory Animal Center. Raising in the SPF level environment of Guangzhou Medical University Laboratory Animal Center. When the pregnant mice gave birth to newborn mice (8 newborn mice per pregnant mouse on average), the average body weight was 1.5g, and the newborn mice were randomly selected according to the experimental grouping for the experiment. The experimental animal disposal method conforms to the animal ethics standards.
[0560] (2) Modeling method: The newborn BALB / c mice were intraperitoneally injected with 20 μL (titer 1.0 x 10 6 PFU) of monkey MMU18006 rotavirus (hereinafter referred to as "RRV") within 24 hours of birth to establish a BA mouse animal model.
[0561] (3) Observation of the survival status of the mice: incidence of jaundice, growth weight of the mice.
[0562] 2. Effect experiment
[0563] The BA model is established by infecting rhesus monkeys with rotavirus (RRV) within 24 hours of birth. In the established acute biliary atresia mouse model, a paired experiment is performed according to the experimental requirements, and the BA model is divided into different experimental groups: 1) control mouse group (intraperitoneal administration of the same volume of PBS); 2) RRV-induced BA mouse model group (RRV, specific method step 1); 3) folic acid and vitamin B6 supplementation group (RRV+CF+B6), which is based on the RRV-induced BA mouse model and supplemented with folic acid and vitamin B6 combination therapy, wherein the folic acid dosage is 3.5 mg / kg, the vitamin B6 dosage is 2.5 mg / kg, and the mixture is injected intraperitoneally. The drug is administered 16 hours after viral infection, once a day, and the experiment is terminated on the 12th day. The body weight and incidence of jaundice of the mice in each group are observed and recorded during the entire experiment.
[0564] From the 8th day of modeling, the body weight of the RRV-induced BA mouse model group began to show a significant difference (p<0.05) compared with the control mouse group and the folic acid and vitamin B6 supplementation group, while there was no significant difference (p>0.05) in body weight between the control mouse group and the folic acid and vitamin B6 supplementation group;
[0565] On the 12th day of the experiment, the incidence of jaundice in the control mouse group was 0%, the incidence of jaundice in the RRV-induced BA mouse model group was 100%, and the incidence of jaundice in the folic acid and vitamin B6 supplementation group was 45%. There was a significant difference (p<0.05) in the incidence of jaundice between the RRV-induced BA mouse model group and the folic acid and vitamin B6 supplementation group. It can be seen that the BA model mouse modeling was successful, and the folic acid and vitamin B6 supplementation group significantly reduced the incidence of jaundice in the BA model mice, with the incidence of jaundice decreasing from 100% in the RRV group to 45%, showing a significant therapeutic effect.
[0566] On this basis, the inventors further proved through experimental research that the combination of folic acid and vitamin B6 before RRV virus infection for BA modeling further proved the preventive effect of folic acid and vitamin B6 on BA.
[0567] Example 9 Folic acid reduces the incidence of food allergy in patients with biliary atresia and choledochal cyst
[0568] 1. Incidence of food allergy in patients with biliary atresia after surgery
[0569] The survey was conducted by the Pediatric Surgery and Pediatric Institute of Guangzhou Women and Children's Medical Center (GWCMC), using electronic forms to obtain information. The sample included 249 valid cases, of which 154 were from BA patients and 95 were from CC patients. Participants were recruited through an online applet (compatible with computers and mobile phones). Participants were invited to complete an online survey. The main content of the structured questionnaire included maternal nutritional intake during pregnancy and postpartum, postpartum nutrition and infection, postoperative complications, and infant allergens. The survey has obtained approval for data collection and analysis from the GWCMC Medical Ethics Committee.
[0570] The survey results are shown in Figure 13 , where about 15.12% of patients with biliary atresia developed food allergies after biliary atresia surgery.
[0571] 2. Folic acid inhibits the occurrence of postoperative food allergies in patients with biliary atresia
[0572] Patients with biliary atresia or suspected biliary atresia were treated with folic acid for 7 days before surgery. Intestinal specimens were taken during the operation for immunofluorescence staining, as shown in Figure 13 , it was found that the number of eosinophils involved in food allergies in the intestine was significantly reduced, indicating that folic acid has a preventive and inhibitory effect on the occurrence of food allergies in patients with biliary atresia.
[0573] 3. Folic acid inhibits the occurrence of postoperative food allergies in patients with gallbladder cysts
[0574] As shown in Figure 13 A, the incidence of food allergies after choledochal cyst surgery is significantly lower than that after biliary atresia surgery, but still has 4.29% of patients found food allergy phenomenon after choledochal cyst surgery. Food allergies can cause symptoms in the gastrointestinal tract, skin, respiratory tract, etc. The side effects of current anti-allergy drugs are large, and the treatment cycle is long, which can further exacerbate their side effects.
[0575] For patients with choledochal cysts, folic acid was used for 7 days before surgery. Intestinal specimens were taken during the operation for immunofluorescence staining, and it was also found that the number of eosinophils involved in food allergies in the intestine was significantly reduced, indicating that folic acid also has a preventive and inhibitory effect on the occurrence of food allergies in patients with choledochal cysts.
[0576] Example 10 Folic acid for inhibiting necrotizing enterocolitis
[0577] 1. Inducing a NEC mouse model
[0578] Induce experimental NEC in 7-10 day old mice, and then give the SPF seven-day-old C57BL / 6 mice rat milk by gavage, and then place them in a 90% N2+5% CO2+5% O2, 4°C environment for 10 min, and then take them out. Gavage + modeling three times a day, with an interval of 8 h each time, for three days.
[0579] 2. Folic acid for NEC mice
[0580] Group the NEC model mice: (1) normal mouse group, normal breastfed mice; (2) NEC model mouse group; (3) folic acid + NCE model mouse group, give folic acid to the NEC model mice, wherein the folic acid dose is 6 mg / kg, intraperitoneal injection, 16 h administration, once a day, and the experiment is terminated on the 6th day. After termination, the mice are sacrificed, the intestinal tissue is observed, and the RNA of the intestinal segment tissue is extracted for qPCR to detect the expression of IFN-γ and IL-1β in the intestinal segment tissue.
[0581] It is found through observation and experiment that, compared with the normal mouse group, the intestinal segment of the NEC model mouse group shows severe mucosal damage and patchy ulcers, while the mucosal necrosis and ulceration of the intestinal segment of the folic acid administration group are observed to be reduced to varying degrees, and the gene detection of the intestinal segment finds that the inflammatory factors of the folic acid administration group are significantly inhibited compared with the NEC model mouse group. This shows that folic acid has a significant therapeutic effect on NEC. In further research, similar situations are also observed in NEC mice pre-administered with folic acid, showing reduced mucosal damage and inhibited inflammatory factors.
[0582] Therefore, folic acid shows obvious preventive and therapeutic effects on NEC.
[0583] Example 11. Folic acid for prevention and treatment of neonatal cytomegalovirus infection (HCMV)
[0584] Collect about 20 cases of urine clinically diagnosed or highly suspected as HCMV infection, and detect the index of urine HCMV copy number, set a control group (other consistent, only not taking folic acid) and a folic acid taking group, the dose is 0.4 mg / day, once a day, and insist on taking for 10 days, and detect the urine HCMV copy number every day. Compared with the non-folic acid taking group, the urine HCMV copy number of the folic acid taking group is controlled in a shorter time, with an average of 1-2 days, and the inflammatory factor detection of the blood of the children collected on the 3rd, 6th and 10th day finds that the TNF-α and IL-1β inflammatory factor levels of the folic acid taking group are lower, especially on the 6th day, and the difference is significant.
[0585] Cytomegalovirus infection in newborns can affect infant development and may cause damage to various parts of the body, including the liver and central nervous system. In particular, this invention demonstrates that folic acid can inhibit cytomegalovirus infection, showcasing the potential of folic acid for the prevention and treatment of neonatal cytomegalovirus infection.
[0586] In summary, this invention demonstrates that serum folate levels are significantly reduced in BA ( Figure 1 (A) and folic acid levels can effectively distinguish between BA and non-BA subjects. Figure 1 Therefore, folic acid supplementation during pregnancy can help prevent biliary atresia; folic acid supplementation can increase BA weight (B). Figure 2 (B) can reduce the jaundice rate. Figure 2 (C) can also reduce inflammation, alleviate liver tissue damage, and decrease the degree of fibrosis. Figure 2 D), reduce IFN-γ levels ( Figure 2 (E), Repairing intestinal damage ( Figure 3 , 4 The expression of intestinal inflammatory factors (S100a8, S100a9, IFN-γ) is decreased, while the expression of the anti-inflammatory gene (Nox2) is increased. Figure 5 The levels of S100a8, S100a9, IFN-γ, or Nox2 can effectively distinguish between biliary atresia (BA) and non-BA subjects. Furthermore, this invention verifies that a biomarker composition consisting of at least two of S100a8, S100a9, IFN-γ, Nox2, and folic acid can effectively distinguish between BA and non-BA subjects. Therefore, folic acid or its salts can effectively prevent and treat biliary atresia, cholangitis, and pathological jaundice. This invention demonstrates that folic acid supplementation can reduce the jaundice rate in a mouse model of viral-induced biliary atresia, improve liver / intestinal function in mice, inhibit the expression of the hepatocyte-cytotoxic cytokine IFN-γ, and also reduce the total bilirubin concentration and direct bilirubin concentration in patients with biliary atresia. Figure 9 (B, C) can achieve the effect of preventing and / or treating cholangitis. Figure 8 C, Figure 9 (A). Simultaneously, folic acid supplementation can also correct systemic iron overload and luminal iron deficiency, inhibit eosinophil infiltration in the small intestine, suppress the production of IgG-Ro / SSA autoantibodies, and increase the IgM / IgG4 ratio. Figure 12 This invention also demonstrates that calcium leucovorin (CF) supplementation can reduce the levels of INFβ and ROS in the liver. (Note: The original text contains some formatting errors and inconsistencies. A more accurate translation would require the full context.) Figure 7 (D), reduces the incidence of jaundice and improves neonatal growth ( Figure 7 (A, C); Increase the expression levels of Dhfr, Mthfr, Nrf2, and Slc40a1 in the small intestine ( Figure 7restoration of folate metabolism, oxidative stress and iron homeostasis; reduction of CD4 + T cells, CD8 + IFN-gamma content in T cells, IgG1 content in plasma cells Figure 7 F); reduction of liver portal tract perivascular lymphocyte infiltration; increase of liver lobular structure integrity; restoration of intestinal epithelial cell ballooning degeneration Figure 7 B), which achieves the effect of treating biliary atresia; the effect of preventing and / or treating neonatal infectious diseases is achieved by supplementing folate or its derivative (calcium folinate) to prevent and / or treat bacterial and / or viral infections, and a significant inhibitory effect on necrotizing enterocolitis is also shown; therefore, the present application also successfully provides a safe active ingredient, folate, which can act on the liver, intestine and other digestive tracts, so that the present application can not only prevent and treat biliary atresia, but also achieve the effects of preventing and treating liver fibrosis, cholangitis, jaundice, liver-intestinal circulation disorder, viral infection, inflammatory bowel disease, intestinal flora imbalance and other diseases through the diversity of the target of the action. Finally, the present application also provides the use of one or more of folate, S100a8, S100a9, Nox2 and IFN-gamma as diagnostic or auxiliary diagnostic markers for biliary atresia. Therefore, the present application not only finds that folate can be used for diagnosing, preventing and treating diseases such as biliary atresia, but also expands its application prospect through the exploration of the mechanism.
[0587] The above embodiments are preferred embodiments of the present application, but the embodiments of the present application are not limited to the above embodiments, and any changes, modifications, substitutions, combinations and simplifications made without departing from the spirit and principles of the present application should be equivalent replacement methods and should be included in the protection scope of the present application.
[0588] The present application relates to the technical field of biological medicine, and discloses the application of folate in preventing, diagnosing and treating biliary atresia. The present application finds that folate can prevent and treat genetic, infectious or allergic diseases by improving inflammation, regulating iron ion metabolism, correcting intestinal flora imbalance, reducing liver / intestinal tissue damage and inhibiting the expression of inflammatory factors, and promoting the expression of Nox2. Meanwhile, the present application provides the application of one or more of folate, S100a8, S100a9, Nox2 and IFN-gamma as diagnostic or auxiliary diagnostic markers for biliary atresia. Meanwhile, folate or its derivative is prepared into food, nutritional preparation or medicine, and is applied to children or adults to achieve the purposes of preventing and treating biliary atresia, cholangitis, jaundice, infectious diseases, intestinal diseases and other related diseases as well as diseases caused by folate metabolism abnormalities.
Claims
1. The use of folic acid or folic acid derivatives as the sole active ingredient in the preparation of drugs for the prevention and / or treatment of biliary atresia; wherein The folic acid derivative is any one of (a1) to (a2): (a1) Follic acid, tetrahydrofollic acid, 5-methyltetrahydrofollic acid, 5,10-methylenetetrahydrofollic acid, 5,10-formiminotetrahydrofollic acid, 5-formyltetrahydrofollic acid, 10-formyltetrahydrofollic acid and 10-methyltetrahydrofollic acid; (a2) is a pharmaceutically acceptable salt of (a1), wherein the pharmaceutically acceptable salt is a calcium salt or a glucosamine salt.
2. Use according to claim 1, characterized in that, The biliary atresia includes biliary atresia caused by viruses or biliary atresia caused by bile stasis.
3. The application according to claim 2, characterized in that: The viral biliary atresia also includes biliary atresia mainly caused by cytomegalovirus or biliary atresia mainly caused by rotavirus.
4. The application according to any one of claims 1-3, characterized in that: The folic acid derivatives include calcium folinate.
5. The application according to claim 4, characterized in that: The drug is in a dosage form suitable for children or adults.
6. The application according to claim 5, characterized in that: The children include newborns within 28 days of birth, infants under 1 year old, toddlers aged 1 to 6 years, and children aged 6 to 18 years.
7. The application according to claim 5, characterized in that: The term "adults" includes pregnant adult women, perinatal adult women, and lactating adult women.
8. The application according to claim 5, characterized in that: The dosage forms of the drug include capsules, tablets, microcapsules, injections, suppositories, sprays, powders, pills, granules, honey-based ointments, oral liquid preparations, and transdermal patches; or, The dosage form of the drug includes gastrointestinal dosage forms or non-gastrointestinal dosage forms.
9. The application according to any one of claims 5-8, characterized in that: The unit dose of folic acid or its derivative in the drug is 0.1 mg to 1 g.
10. The application according to claim 9, characterized in that: The unit dose of folic acid or its derivative in the drug is 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg or 1.0 mg.
Citation Information
Patent Citations
Methods of treatment for cholestatic and fibrotic diseases
CN109069648A
Use of folates for producing a preparation suitable for preventing and treating inflammation and diseases associated with inflammation, especially for influencing the inflammation markers CRP and SAA
CN1638751A
Methods of treatment of cholestasis and fibrosis
US20170290814A1