Disease resistance-related protein osmed16, and biological materials and applications thereof
By regulating the OsMED16 protein and gene in rice, the complexity of the plant disease resistance regulatory network was solved, achieving the effects of improving disease resistance, reducing tiller number, delaying flowering time, and enhancing the expression of target genes.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANGHAI NORMAL UNIVERSITY
- Filing Date
- 2023-02-03
- Publication Date
- 2026-06-26
AI Technical Summary
Existing technologies have complex regulatory networks for plant disease resistance, lack effective molecular mechanism studies, and are insufficient to improve plant disease resistance, reduce tiller number, delay flowering time, and regulate the expression of OsPR1a, OsPR1b, OsPR10, OsNPR1, OsWRKY45, and OsAOS2 genes.
This study provides regulatory substances for the plant disease resistance-related protein OsMED16 and its encoding gene. By knocking out, inhibiting or downregulating its expression or activity, combined with recombinant vectors and gene editing technology, it regulates plant disease resistance, tiller number and flowering time, and upregulates the expression of target genes.
It can improve plant disease resistance, reduce tillering, delay flowering time, and enhance the expression of OsPR1a, OsPR1b, OsPR10, OsNPR1, OsWRKY45 and OsAOS2 genes, thereby enhancing plant disease resistance.
Smart Images

Figure CN116082480B_ABST
Abstract
Description
Technical Field
[0001] This application specifically relates to the disease-resistant protein OsMED16, its biomaterials, and its applications. Background Technology
[0002] Plants have evolved various defense mechanisms against pathogen infection. The hypersensitive response (HR) is one of the most common and effective defense responses in plants. It is characterized by the rapid localization of cell necrosis around the infection site when a plant is infected by a pathogen, thereby limiting the spread of the pathogen to adjacent cells. HR is a typical process of programmed cell death (PCD), usually accompanied by reactive oxygen species (ROS) bursts, callose deposition, free radical production, induction of pathogenesis-related gene expression, and cell wall thickening. Although the role of HR in plant disease resistance is widely recognized, its molecular mechanisms remain unclear.
[0003] Lesion mimic mutants (LMMs) are mutants that spontaneously develop necrotic lesion-like spots on the leaves or leaf sheaths of plants without significant abiotic stress, mechanical damage, or pathogen infection. They are important experimental materials for studying plant hazard response (HR)-mediated plant disease disease (PCD) and resistance mechanisms. Currently, a number of lesion mimic mutants have been identified in plants such as Arabidopsis thaliana, wheat, maize, rice, and soybean, and more than 60 lesion mimic genes have been isolated. These genes encode various types of proteins and participate in multiple physiological processes, such as calcium ion signal transduction, protein ubiquitination and phosphorylation, reactive oxygen species (ROS) emission, transcriptional regulation, and mRNA splicing. However, these known genes represent only the tip of the iceberg compared to the complex regulatory network of plant disease resistance responses, and many unknown aspects require further investigation.
[0004] Therefore, finding a disease-related protein, its biomaterials, and its applications is a problem to be solved in this field. Summary of the Invention
[0005] The technical problem solved by this application is to provide methods for improving plant disease resistance, reducing plant tiller number, delaying plant flowering time, and improving the expression of plant OsPR1a, OsPR1b, OsPR10, OsNPR1, OsWRKY45 and OsAOS2 genes and / or to prepare materials that improve the expression of plant OsPR1a, OsPR1b, OsPR10, OsNPR1, OsWRKY45 and OsAOS2 genes.
[0006] To address the aforementioned problems, this application provides the following applications.
[0007] The use of a protein, a substance that regulates the expression of the gene encoding the protein, or a substance that regulates the activity or content of the protein in any of the following:
[0008] A1) Applications in regulating plant disease resistance and / or applications in the preparation of products that regulate plant disease resistance;
[0009] A2) Applications in regulating plant tiller number and / or in the preparation of products that regulate plant tiller number;
[0010] A3) Regulating plant flowering time and / or its application in preparing plant flowering time regulators;
[0011] A4) Application in regulating the expression of plant OsPR1a, OsPR1b, OsPR10, OsNPR1, OsWRKY45 and OsAOS2 genes and / or in the preparation of products that regulate the expression of plant OsPR1a, OsPR1b, OsPR10, OsNPR1, OsWRKY45 and OsAOS2 genes.
[0012] The protein is any one of the following:
[0013] B1) The amino acid sequence is the protein shown in sequence 2;
[0014] B2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein described in B1), which has more than 80% identity with the protein shown in B1) and is associated with plant disease resistance.
[0015] B3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2).
[0016] Sequence 2 (SEQ ID No. 2) is as follows:
[0017]
[0018] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0019] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.
[0020] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 98%, 99%, or 100% identity.
[0021] Of the proteins described above, sequence 2 (SEQ ID No. 2) consists of 1301 amino acid residues. It is named protein OsMED16.
[0022] In this application, the term "related to plant disease resistance" may refer to disease resistance.
[0023] The disease resistance can be resistance to fungal diseases or resistance to bacterial diseases.
[0024] In this application, the fungal disease resistance can be rice blast resistance. The bacterial disease resistance can be bacterial blight resistance.
[0025] The rice blast disease can be caused by physiological races of rice blast fungus TH12, CH131, or CH199. The bacterial blight can be caused by bacterial blight strains PXO71, PXO99, or PXO112.
[0026] In this application, the regulation may be knockout, suppression, reduction, or downregulation.
[0027] In the above text, the knockout, inhibition, reduction, or downregulation of the expression of the gene encoding the above protein or the activity or content of the above protein can achieve the following C1)-C4);
[0028] C1) Applications in enhancing plant disease resistance and / or in the preparation of products that regulate plant disease resistance;
[0029] C2) Applications in reducing plant tiller number and / or in the preparation of products that regulate plant tiller number;
[0030] C3) Delaying plant flowering time and / or its application in preparing materials for regulating plant flowering time;
[0031] C4) Application in upregulating the expression of plant OsPR1a, OsPR1b, OsPR10, OsNPR1, OsWRKY45 and OsAOS2 genes and / or in the preparation of products that regulate the expression of plant OsPR1a, OsPR1b, OsPR10, OsNPR1, OsWRKY45 and OsAOS2 genes.
[0032] In the above-mentioned uses, the protein is derived from rice.
[0033] The rice mentioned above may be the japonica rice variety Taichung65 (TC65) or Nipponbare.
[0034] In the above text, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).
[0035] In the above-described uses, the substance regulating the expression of the protein-coding gene is any one of the following:
[0036] D1) Inhibit, reduce, or downregulate the expression of nucleic acid molecules encoding the genes of the above proteins;
[0037] D2) expresses the gene encoding the nucleic acid molecule described in D1);
[0038] D3) contains an expression cassette containing the gene described in D2);
[0039] D4) A recombinant vector containing the gene described in D2), or a recombinant vector containing the expression cassette described in D3);
[0040] D5) Recombinant microorganisms containing the gene described in D2), or recombinant microorganisms containing the expression cassette described in D3), or recombinant microorganisms containing the recombinant vector described in D4);
[0041] D6) A transgenic plant cell line containing the gene described in D2), or a transgenic plant cell line containing the expression cassette described in D3), or a transgenic plant cell line containing the recombinant vector described in D4;
[0042] D7) Transgenic plant tissue containing the gene described in D2), or transgenic plant tissue containing the expression cassette described in D3), or transgenic plant tissue containing the recombinant vector described in D4;
[0043] D8) A transgenic plant organ containing the gene described in D2), or a transgenic plant organ containing the expression cassette described in D3), or a transgenic plant organ containing the recombinant vector described in D4).
[0044] In the nucleic acid molecule described in D2), those skilled in the art can easily mutate the nucleotide sequence that inhibits, reduces, or downregulates the expression of the OsMED16 protein encoding gene in this invention using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides that have 80% or more of the same nucleotide sequence as the one isolated in this invention that inhibits, reduces, or downregulates the expression of the OsMED16 protein encoding gene, and that have the function of inhibiting, reducing, or downregulating the expression of the OsMED16 protein encoding gene, are all nucleotide sequences derived from and equivalent to the sequences of this invention.
[0045] The aforementioned 80% or higher identity can be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
[0046] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of amino acid sequences, then the identity value (%) can be obtained.
[0047] In D4) above, the recombinant vector can be a plant gene editing vector. The plant gene editing vector can be the BGK032 vector.
[0048] As a specific embodiment, the recombinant vector described above is the recombinant vector BGK032-OsMED16-sgRNA. The recombinant vector BGK032-OsMED16-sgRNA is a recombinant plasmid obtained by inserting the nucleotide sequence GTATGGGAATCCAAAATGGT between the BsaI restriction endonuclease recognition site of the BGK032 vector, while keeping the other nucleotide sequences of the BGK032 vector unchanged.
[0049] The microorganism mentioned in D5 above can be Agrobacterium. The Agrobacterium is EHA105.
[0050] In the above uses, the nucleic acid molecule described in D1) is a gRNA that targets the protein-coding gene described in claim 1 or 2, and the target sequence of the gRNA is sequence 7 in the sequence listing.
[0051] In the above-mentioned uses, the plant is any one of the following:
[0052] G1) Dicotyledons or monocotyledons;
[0053] G2) Gramineae plants;
[0054] G3) Plants of the genus Oryza;
[0055] G4) Rice.
[0056] To address the aforementioned problems, this application provides a method for cultivating highly disease-resistant plants.
[0057] The method includes knocking out, inhibiting, reducing, or downregulating the expression level of the gene encoding the protein as described above in the target plant, and / or, the activity and / or content of the protein to obtain a highly disease-resistant plant, wherein the disease resistance of the highly disease-resistant plant is higher than that of the target plant.
[0058] To address the aforementioned problems, this application provides a method for cultivating late-flowering plants.
[0059] The method includes knocking out, inhibiting, reducing, or downregulating the expression level of the gene encoding the protein as described above in the target plant, and / or, the activity and / or content of the protein to obtain a late-flowering plant, the late-flowering plant flowering later than the target plant.
[0060] In this application, the term "related to plant disease resistance" may refer to disease resistance.
[0061] The disease resistance can be resistance to fungal diseases or resistance to bacterial diseases.
[0062] In this application, the fungal disease resistance can be rice blast resistance. The bacterial disease resistance can be bacterial blight resistance.
[0063] The rice blast disease can be caused by physiological races of rice blast fungus TH12, CH131, or CH199. The bacterial blight can be caused by bacterial blight strains PXO71, PXO99, or PXO112.
[0064] In the above method, knocking out, inhibiting, reducing or downregulating the expression of the gene encoding the protein in the plant includes introducing a gene knockout vector with sequence 7 as the target sequence into the target plant.
[0065] In the above text, the recombinant vector mentioned above is the recombinant vector BGK032-OsMED16-sgRNA. The recombinant vector BGK032-OsMED16-sgRNA is a recombinant plasmid obtained by inserting the nucleotide sequence GTATGGGAATCCAAAATGGT between the BsaI restriction endonuclease recognition site of the BGK032 vector, while keeping the other nucleotide sequences of the BGK032 vector unchanged.
[0066] To address the aforementioned problems, this application provides a method for cultivating highly disease-resistant plants and / or late-flowering plants.
[0067] The method includes performing any of the following operations on the genome of the target plant:
[0068] K1) Insert one adenine deoxyribonucleotide residue between positions 1648 and 1649 of sequence 3 in the target plant genome sequence listing;
[0069] K2) Two deoxyribonucleotide residues were deleted between positions 1646 and 1649 of sequence 3 in the genome sequence listing of the target plant;
[0070] K3) Mutate the deoxyribonucleotide residues with the sequence CCCACCATT between positions 1641 and 1652 in sequence 3 of the target plant genome sequence listing to deoxyribonucleotide residues with the sequence TCTAA.
[0071] K4) 33 deoxyribonucleotide residues between positions 1624 and 1658 of sequence 3 in the genome sequence listing of the target plant were deleted;
[0072] K5) Delete one deoxyribonucleotide residue between positions 1646 and 1648 of sequence 3 in the genome sequence listing of the target plant;
[0073] K6) Insert one adenine deoxyribonucleotide between positions 1647 and 1648 of sequence 3 in the target plant genome sequence listing.
[0074] Sequence 3 (SEQ ID No. 3) is shown below:
[0075]
[0076] In the above uses and methods, the plant is any one of the following: J1) dicotyledonous or monocotyledonous plants; J2) grasses; J3) oregano; J4) rice.
[0077] The rice mentioned above may be Nipponbare.
[0078] Beneficial effects
[0079] This application discloses the disease resistance-related protein OsMED16, its biomaterials, and its applications. This application identifies a protein, the disease resistance-related protein OsMED16, and its encoding gene. A homozygous mutant, named mutant spl38, was obtained by converting the 8024th guanine deoxyribonucleotide residue in sequence 3 region (the OsMED16 encoding gene) of the wild-type TC65 genome to an adenine deoxyribonucleotide residue. Compared with wild-type TC65, mutant spl38 exhibits significantly increased disease resistance, reduced tiller number, delayed flowering time, and increased expression of the OsPR1a, OsPR1b, OsPR10, OsNPR1, OsWRKY45, and OsAOS2 genes, and / or by improving the expression levels of these genes in plants.
[0080] The OsMED16 coding gene (sequence 3) with the original promoter was cloned from wild-type TC65 and introduced into the mutant spl38 using the pCAMBIA1300 vector to obtain the reversion mutant spl38-C. Compared with the mutant spl38, the mutant spl38-C showed restored phenotype. Therefore, the conversion of the guanine deoxyribonucleotide residue at position 8024 of the OsMED16 coding gene (sequence 3 region) in the mutant spl38 genome to the adenine deoxyribonucleotide residue is the factor that causes the above effect.
[0081] Furthermore, this application constructed osmed16-3, osmed16-5, osmed16-6, and osmed16-8 OsMED16 gene knockout plants.
[0082] Compared with wild-type rice Nipponbare, the OsMED16-5 homozygote showed a mutation in the OsMED16 gene in the rice genome: the nucleotide sequence of the OsMED16 gene in sequence 3 of the sequence listing on both homologous chromosomes underwent the following changes: an adenine deoxyribonucleotide was inserted between positions 1648 and 1649 of sequence 3 in the sequence listing, causing the encoded protein to terminate prematurely at amino acid position 204, thereby knocking out the OsMED16 gene.
[0083] Compared to wild-type Nipponbare rice, the OsMED16-3 heterozygote exhibited mutations in the OsMED16 gene in its genome. On two homologous chromosomes, the nucleotide sequence of the OsMED16 gene (Sequence 3 in the sequence listing) underwent the following changes: On one chromosome, two deoxyribonucleotides were deleted between positions 1646 and 1649 of Sequence 3, causing premature termination of the encoded protein at amino acid position 203, thus knocking out the OsMED16 gene. On the other chromosome, ten deoxyribonucleotides (CCCACCATTT) between positions 1641 and 1652 of Sequence 3 were mutated to five deoxyribonucleotides (TCTAA), causing premature termination of the encoded protein at amino acid position 202, also knocking out the OsMED16 gene.
[0084] Compared to wild-type Nipponbare rice, the OsMED16-6 heterozygote exhibits a mutation in the OsMED16 gene in the rice genome. On two homologous chromosomes, the nucleotide sequence of the OsMED16 gene (Sequence 3 in the sequence listing) has undergone the following changes: On one chromosome, an adenine deoxyribonucleotide was inserted between positions 1648 and 1649 of Sequence 3 in the sequence listing, causing premature termination of the encoded protein at amino acid position 204, thus knocking out the OsMED16 gene. On the other chromosome, 33 deoxyribonucleotides were deleted between positions 1624 and 1658 of Sequence 3 in the sequence listing, causing premature termination of the encoded protein at amino acid position 169, thus knocking out the OsMED16 gene.
[0085] Compared to wild-type Nipponbare rice, the OsMED16-8 heterozygote exhibited mutations in the OsMED16 gene in the rice genome. On two homologous chromosomes, the nucleotide sequence of the OsMED16 gene (Sequence 3 in the sequence listing) showed the following changes: On one chromosome, a deoxyribonucleotide was deleted between positions 1646 and 1648 of Sequence 3, causing premature termination of the encoded protein at amino acid position 178, thus knocking out the OsMED16 gene; on the other chromosome, a thymine deoxyribonucleotide was inserted between positions 1647 and 1648 of Sequence 3, causing premature termination of the encoded protein at amino acid position 204, also knocking out the OsMED16 gene. OsMED16-3, OsMED16-5, OsMED16-6, and OsMED16-8 were continuously cultured with wild-type Nipponbare rice in a greenhouse environment with a photoperiod of 14h light / 10h dark and a temperature of 28℃. The results showed that, compared with wild-type Nipponbare (Nip), the OsMED16 knockout lines also produced a lesion-like phenotype. At the same time, all four lines showed extremely weak, dwarfed and lesion-prone phenotypes during the vegetative development stage. The phenotypes were very pronounced after 60 days of culture and eventually died after 70 days of growth.
[0086] Furthermore, this application lays the foundation for isolating and identifying new lesion-like mutants and their mutant genes, elucidating the mechanisms by which lesion-like formation occurs and participates in plant defense responses, and gaining a deeper understanding of plant disease resistance mechanisms.
[0087] In production practice, the following operations can be performed:
[0088] (1) Those skilled in the art can use gene editing to achieve site-directed mutations in rice, introducing a mutation in which the 8024th guanine deoxyribonucleotide residue in the middle sequence 3 region (OsMED16 encoding gene) is transformed into an adenine deoxyribonucleotide residue, thereby obtaining plants with the above phenotype and then breeding the target plants.
[0089] (2) Those skilled in the art can use rice lesion mutants spl38 and OsMED16 mutant genes to introduce the OsMED16 mutant gene into rice through conventional hybridization, molecular marker-assisted selection or genetic engineering, which can significantly enhance the resistance of transgenic rice to fungal diseases (such as rice blast) and bacterial diseases (such as rice bacterial blight), thereby improving rice varieties.
[0090] (3) For some crops that need to delay flowering, those skilled in the art can achieve the purpose of delaying flowering by heterologously expressing the OsMED16 mutant gene. Attached Figure Description
[0091] Figure 1Phenotypic comparison of wild-type (WT) and lesion-like mutant spl38. Among them, (a) shows the leaf phenotype of wild-type (WT) and lesion-like mutant spl38, with wild-type on the left and spl38 on the right; (b) shows the comparison of wild-type (WT) and lesion-like mutant spl38 plants at the tillering stage, with wild-type on the left and spl38 on the right; (c) shows the comparison of wild-type (WT) and lesion-like mutant spl38 plants at maturity, with wild-type on the left and spl38 on the right.
[0092] Figure 2 Phenotypic results of wild-type (WT) and lesion-like mutant spl38 after inoculation with *Bacillus oryzae* and *Bacillus oryzae*. Among them, (a) shows the phenotype after spray inoculation with *Bacillus oryzae* physiological race TH12; (b) shows the phenotype after spray inoculation with *Bacillus oryzae* physiological race CH131; (c) shows the phenotype after spray inoculation with *Bacillus oryzae* physiological race CH199; (d) shows the quantitative results of the relative fungal biomass after spray inoculation with *Bacillus oryzae*; (e) shows the phenotype after leaf-cutting inoculation with *Bacillus oryzae* physiological race PXO71; (f) shows the phenotype after leaf-cutting inoculation with *Bacillus oryzae* physiological race PXO99; (g) shows the phenotype after leaf-cutting inoculation with *Bacillus oryzae* physiological race PXO112; and (h) shows the statistical results of lesion length after leaf-cutting inoculation with *Bacillus oryzae*.
[0093] Figure 3 Expression levels of six defense-related genes were detected in wild-type (WT) and the lesion-like mutant spl38. An asterisk indicates a statistically significant difference between wild-type and mutant (**: P < 0.01, t-test).
[0094] Figure 4 The location and cloning of the rice OsMED16 (LOC_Os10g35560) gene were performed. (a) shows the initial location of OsMED16 between markers M8 and M9 on chromosome 10; (b) shows the final location of OsMED16 between markers IN28 and IN8; (c) shows the gene structure diagram of OsMED16. Sequencing comparison of the wild-type and mutant parental genomic DNA sequences in this region revealed a mutation at the 3320th base of the CDS sequence of the OsMED16 gene, where a G was changed to an A, resulting in a change in the encoded amino acid from glycine (Gly) to aspartic acid (Asp).
[0095] Figure 5 This is a validation of gene functional complementation of the OsMED16 mutant, where (a) shows the plant phenotypes of wild type (WT), mutant (spl38) and transgenic complementary plant (spl38-C); and (b) shows the leaf phenotypes of wild type (WT), mutant (spl38) and transgenic complementary plant (spl38-C).
[0096] Figure 6 To detect tissue expression of the OsMED16 gene using quantitative real-time PCR.
[0097] Figure 7 Subcellular localization results of OsMED16. Among them, (a) shows the localization results of OsMED16-YFP in tobacco epidermal cells; (b) shows the localization results of OsMED16-YFP in rice protoplasts.
[0098] Figure 8 Sequencing results for the OsMED16 CRISPR-Cas9 knockout lines. (a) shows the gene structure of OsMED16, with the sgRNA marked at the third exon; (b) shows the sequencing results of the DNA editing regions of all four lines, with osmed16-3, osmed16-6, and osmed16-8 being heterozygous plants, and osmed16-5 being a homozygous plant with a single base insertion.
[0099] Figure 9 Phenotype of OsMED16 CRISPR-cas9 knockout line. Detailed Implementation
[0100] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0101] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0102] The following examples used SPSS 18.0 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.
[0103] Physiological races of *Pyroblastus* TH12, CH131, and CH199 are described in the following literature: Deng, Y., Zhu, X., Shen, Y. et al. Genetic characterization and fine mapping of the blast resistance locus *Pigm(t)* tightly linked to *Pi2* and *Pi9* in abroad-spectrum resistant Chinese variety. Theor Appl Genet 113, 705–713 (2006). https: / / doi.org / 10.1007 / s00122-006-0338-7.
[0104] Rice bacterial blight strains PXO71, PXO99, and PXO112 are described in the following literature: An E3 Ubiquitin Liga se-BAG Protein Module Controls Plant Innate Immunity and Broad-Spectrum Disease Resistance.
[0105] The indica rice variety Dular is described in the following literature: Pyrophosphate-fructose 6-phosphate 1-phosphotransferase (PFP1) regulates starch biosynthesis and seed development via heterotetramer formation in rice (Oryza sativa L.).
[0106] The intermediate carrier pQBV3 is described in the following literature: Pyrophosphate-fructose 6-phosphate 1-phosphotransferase (PFP1) regulates starch biosynthesis and seed development via heterotetramer formation in rice (Oryza sativa L.).
[0107] The vector pEarleyGate101 is described in the following literature: Pyrophosphate-fructose 6-phosphate 1-phosphotransferase (PFP1) regulates starch biosynthesis and seed development via heterotetramer formation in rice (Oryza sativa L.).
[0108] BGK032 is described in the following reference: Lu, Y., Ye, X., Guo, R., Huang, J., Wang, W., Tang, J., Tan, L., Zhu, JK, Chu, C., & Qian, Y. (2017). Genome-wide Targeted Mutagenesis in Rice Using the CRIS PR / Cas9 System. Molecular Plant, 10(9), 1242–1245. https: / / doi.org / 10.1016 / j.molp.2017.06.007.
[0109] The public may obtain the biological material from the applicant. The biological material is only for the purpose of repeating the experiments of this invention and may not be used for any other purpose.
[0110] Example 1: Obtaining the mutant and its phenotype
[0111] A lesion-like mutant, named spl38, was obtained by screening a mutant library from the Japonica rice variety Taichung65 (TC65) using EMS chemical mutagenesis. During the conventional rice growing season in Shanghai and Sanya, under normal sowing conditions, the seed germination and growth vigor of the mutant spl38 were significantly weaker than its wild type. The mutant spl38 did not exhibit any spontaneous cell necrosis in the early tillering stage, but in the late tillering stage, reddish-brown lesion-like spots appeared on the upper leaves starting from the leaf tips and persisting until maturity, while the wild type did not develop any lesions throughout its growth period. During the tillering stage, the mutant spl38 produced significantly fewer tillers than the wild type; at maturity, the mutant did not cause premature senescence, but the flowering period was delayed by approximately 20 days. Figure 1 ).
[0112] Example 2: Disease resistance identification and detection of expression levels of defense-related genes
[0113] Preparation of bacterial suspensions of physiological races TH12, CH131, and CH199 of *Magnaporthe oryzae*:
[0114] (1) Preparation of oat culture medium: Weigh 6g of oat flakes according to a volume of 200mL, and blend them into a homogenate in a soymilk maker with 150mL of distilled water; pour it into a blue cap bottle, add 4g of agar powder, stir well and adjust the volume to 200mL; sterilize at 121℃ for 15 minutes, and after cooling to about 60℃, pour the culture medium evenly into a sterile plastic petri dish (9cm in diameter), and let it cool and solidify for later use.
[0115] (2) Cultivation of *Magnaporum oryzae*: Paper discs containing spores of physiological races TH12, CH131, and CH199 of *Magnaporum oryzae* were inoculated onto oat medium and cultured in the dark at 25°C for 2-3 days. After the mycelium germinated and grew, the culture was carried out under light. Within two weeks, when the *Magnaporum oryzae* had covered the entire culture dish, the mycelium (containing a large number of conidia) was scraped with distilled water containing 0.01% (V / V) Tween-20 and filtered through double-layer gauze. The spore density was calculated using a microscope and a hemocytometer, and the concentration of the spore suspension was adjusted to 1×10⁻⁶. 5 1 spore / mL (approximately 20-30 spores under a 10×10 magnification microscope) to obtain bacterial suspensions of blast fungus physiological races TH12, CH131, and CH199, which were used for blast fungus inoculation (spraying method).
[0116] Preparation of bacterial suspensions of *Rhizoctonia solani* strains PXO71, PXO99, and PXO112:
[0117] (1) Preparation of NA medium: Weigh 3g beef extract, 5g peptone and 2.5g glucose into a 1L blue cap bottle, adjust the pH of the medium to 7.0, then add 15g agar powder, stir well and bring the volume to 1L; sterilize at 121℃ for 15 minutes, wait until it cools to about 60℃, pour the medium evenly into a sterile plastic petri dish (9cm in diameter), and let it cool and solidify for later use.
[0118] (2) Cultivation of *Rhizoctonia solani* strains PXO71, PXO99, and PXO112, which were stored in a -80℃ freezer, were taken out and streaked onto NA medium. They were then incubated in the dark at 28℃ for 2-3 days. Larger single colonies were picked, streaked again, and transferred to NA medium. They were then incubated in the dark at 28℃ for another 2-3 days. Colonies were gently scraped from the medium and dissolved in sterile water to prepare the inoculation solution. The solution was shaken well and the concentration was adjusted to OD. 600 =1.0, obtained bacterial suspensions of rice bacterial blight strains PXO71, PXO99 and PXO112, which were used for inoculation of rice bacterial blight (leaf cutting method).
[0119] (3) Leaf-cutting inoculation: When rice plants in a greenhouse (photoperiod of 14h light / 10h darkness, temperature 28℃) reach 60 days of age, use scissors dipped in Bacillus subtilis solution to cut off 1-3cm of the leaf tips. Inoculate each plant with 3-5 fully expanded leaves, avoiding yellowing of leaves. Measure the length of lesions 14 days after inoculation, depending on the disease situation.
[0120] Rice blast fungus inoculation
[0121] (1) Inoculation with TH12 physiological race of rice blast fungus:
[0122] (3) Spray inoculation: After dehulling wild-type (japonica rice variety Taichung65 (TC65)) and mutant spl38 rice seeds, disinfect them with 75% alcohol for 30 seconds, then with 1% sodium hypochlorite for about 15 minutes. After rinsing with sterile water 3-4 times, inoculate them on 1 / 2 MS medium for germination and seedling growth. After 7 days, transplant them into small plastic pots (8cm×7cm, height×diameter) filled with soilless substrate. When the rice seedlings grow to the three-leaf stage, place them in a large plastic storage box. Twenty wild-type rice plants (Japonica rice variety Taichung65 (TC65)) and 20 mutant plants (spl38) were randomly selected. A suspension of the prepared *Strombus oryzae* physiological race TH12 was evenly sprayed onto each leaf of each plant. The amount of *Strombus oryzae* physiological race TH12 suspension used was 0.5 ml per plant. The plastic storage box was then sealed with plastic film and treated in darkness for 24 hours at 28℃ and ≥80% humidity. Normal light was then restored, and disease incidence was assessed 7 days later. Simultaneously, DNA was extracted from diseased leaves of the same length from both wild-type and *spl38* mutant plants. The ratio of *Strombus oryzae* 28S rDNA to rice OsActin1 gene DNA was detected using qRT-PCR to indicate the relative biomass of *Strombus oryzae*, thus quantifying the resistance levels of wild-type and *spl38* mutant plants to rice blast.
[0123] (2) Inoculation with blast fungus race CH131:
[0124] The operation is the same as above.
[0125] (3) Inoculation with blast fungus race CH199:
[0126] The operation is the same as above.
[0127] The results showed that the number and size of lesions on the leaves of the wild-type mutant were significantly greater than those of the mutant spl38, indicating that the mutant spl38 had significantly enhanced resistance to rice blast. Figure 2 (ad).
[0128] Rice bacterial blight strain inoculation
[0129] (1) Inoculation with PXO71 bacterial strain, a pathogen that causes bacterial leaf blight in rice:
[0130] Leaf-cutting inoculation: After dehulling wild-type (japonica rice variety Taichung65(TC65)) and mutant spl38 rice seeds, disinfect them with 75% alcohol for 30 seconds, then with 1% sodium hypochlorite for about 15 minutes. After rinsing with sterile water 3-4 times, inoculate them on 1 / 2 MS medium for germination and seedling growth. After 7 days, transplant them into small plastic pots (8cm×7cm, height×diameter) filled with soilless substrate. Culture them for 60 days in an environment with a photoperiod of 14h light / 10h dark and a temperature of 28℃. Randomly select 20 wild-type rice plants (japonica rice variety Taichung65(TC65)) and 20 mutant spl38 plants. Using scissors dipped in the prepared rice bacterial blight strain PXO71 bacterial suspension, cut off 1-3cm of the leaf tips of different plants. Inoculate each plant with 3-5 fully expanded leaves, avoiding inoculation with yellow leaves. Measure the length of lesions 14 days after inoculation, depending on the disease situation.
[0131] (2) Inoculation with PXO99 bacterial suspension of rice bacterial blight pathogen:
[0132] The operation is the same as above.
[0133] (3) Inoculation with rice bacterial blight strain PXO112:
[0134] The operation is the same as above.
[0135] The results showed that the lesion length of the mutant spl38 leaves was significantly shortened, and its resistance was significantly better than that of the wild type. Figure 2 These results indicate that the mutant spl38 significantly enhances resistance to both fungal and bacterial diseases.
[0136] Detection of related gene expression
[0137] The expression levels of six defense-related genes (OsPR1a, OsPR1b, OsPR10, OsNPR1, OsWRKY45, and OsAOS2) in wild-type and mutant spl38 were detected using qRT-PCR. The rice OsActin1 gene was used as an internal control. qRT-PCR primers are shown in Table 1. The qRT-PCR reaction system and PCR procedure followed the ChamQ Universal SYBR qPCR MasterMix kit (Vazyme, #Q711-02). The Roche LightCycler 480 quantitative PCR instrument was used for detection. The results showed that the expression levels of all six genes were significantly upregulated in the spl38 mutant compared to the wild-type. Figure 3 The mutation of the target gene activated the expression of defense-related genes in the body.
[0138] Table 1. qRT-PCR primers for defense-related genes
[0139]
[0140]
[0141] Example 3: Localization and Cloning of the OsMED16 Gene
[0142] Genetic analysis was performed on the mutant spl38 obtained in Example 1. The mutant spl38 was crossed with the indica rice variety Dular to obtain the F1 generation, followed by self-pollination to obtain the F2 segregating population. All individuals in the F1 generation showed normal phenotypes, indicating that spl38 is controlled by a recessive nuclear gene. In the F2 generation, segregation occurred between the lesion-like phenotype and the normal phenotype. Among the 138 F2 individuals, the ratio of normal phenotype to lesion-like phenotype was 102:36. A chi-square test confirmed a segregation ratio of 3:1 (Table 2), indicating that the lesion-like phenotype of the mutant spl38 is controlled by a single recessive nuclear gene, consistent with Mendel's laws of inheritance.
[0143] Table 2 Genetic analysis of mutant spl38
[0144]
[0145] Using 217 pairs of insertion / deletion (InDel) markers and simple sequence repeat (SSR) markers evenly distributed across the 12 chromosomes of rice preserved in our laboratory, polymorphism analysis was performed on the two parents, spl38 and Dular. 120 pairs of markers exhibiting polymorphism were screened, and these markers were used for preliminary localization of the mutant gene. Ninety lesion-like individual plants were selected from the F2 population, and DNA was extracted using the CTAB method to construct a DNA pool. Genotyping of the pool was analyzed using polymorphic markers between the two parents, and markers linked to the spl38 mutation site were screened. The results showed that two linked markers, M8 and M9, were screened on the long arm of chromosome 10, with a genetic distance of approximately 10.0 cM. Figure 4 a). A new InDel marker was developed between the initially mapped M8 and M9 markers (Table 3). Further fine mapping was performed using 1652 F2 population plants, locating the target gene within a 44.09 kb interval between IN28 and IN8. Figure 4 b).
[0146] Table 3 Molecular markers used for gene mapping
[0147]
[0148] Analysis of the Rice Genome Annotation Project database revealed six open reading frames (ORFs) in this region. Figure 4 b). Using PCR, the genomic sequences of these six genes in the mutant spl38 and wild-type TC65 were amplified and sequenced. Analysis revealed a point mutation at nucleotide 3320 of exon 7 of LOC_Os10g35560, changing from G to A, resulting in a change in the encoded amino acid from glycine (Gly) to aspartic acid (Asp). Figure 4 c), but the other 5 ORF sequences are completely identical to the wild type, so they are designated as candidate genes for the target gene.
[0149] Its protein sequence is shown in sequence 5 (SEQ ID No. 5).
[0150] The sequence 5 is as follows:
[0151]
[0152] The CDS sequence of the above protein is shown in sequence 4 (SEQ ID No. 4), as follows:
[0153]
[0154] The genomic sequence of the above protein is shown in sequence 6 (SEQ ID No. 6), as follows:
[0155]
[0156] Because the LOC_Os10g35560 gene encodes subunit 16 of the rice mediator complex, it is named OsMED16.
[0157] Example 4: Verification of OsMED16 gene functional complementation
[0158] Based on the Nipponbare reference sequence, specific primers for the target gene OsMED16 were designed (OsMED16-COM-F:TCCCTCTGACTCTCTCCCCG, OsMED16-COM-R:ATCTGCTCTGACTGCTGCAGG).
[0159] Using OsMED16-COM-F / OsMED16-COM-R as primers, the genomic DNA fragment of the OsMED16 gene, including the promoter, was amplified using wild-type TC65 genomic DNA as a template. This fragment, referred to as DNA fragment 1, was then ligated into the pCAMBIA1300 vector using the ClonExpress II One Step Cloning Kit (Vazyme) to obtain the recombinant vector pCAMBIA1300-OsMED16-COM.
[0160] The recombinant vector pCAMBIA1300-OsMED16-COM is obtained by replacing the DNA fragment 1 from position 3 to position 9371 of the normal OsMED16 gene genome sequence (Sequence 3) with the fragment between the restriction endonuclease KpnI and SalI recognition sites of the pCAMBIA1300 vector (Abcam), while keeping the other nucleotide sequences of the pCAMBIA1300 vector unchanged.
[0161] The recombinant vector pCAMBIA1300-OsMED16-COM was transformed into Agrobacterium EHA105. The transformation was then performed using Agrobacterium-mediated genetic transformation into callus induced by mature embryos of the mutant spl38. After pre-culture, infection, co-culture, and screening, transgenic plants were obtained and positive identification was performed. Positive plants, spl38-C, were obtained.
[0162] In Shanghai's conventional rice planting season (mid-June), wild-type rice (Japonica variety Taichung65 (TC65)), mutant spl38, and transgenic complementary plants (spl38-C) were sown in the field. Transplanting occurred approximately 10 days later, followed by routine water and fertilizer management. When the rice seedlings were about 60 days old, plant size, growth, and leaf spot phenotype were observed. Results showed that the complementary seedlings recovered to normal plant size, and no leaf spots appeared. Figure 5 This proves that the mutant spl38 is caused by a mutation in the OsMED16 gene. Figure 5 In the middle: (a) Phenotypes of the first plant from the left, which is wild type (WT), the second and third plants are mutant (spl38), and the fourth and fifth plants are transgenic complementary plants (spl38-C); (b) Leaf phenotypes of the first plant from the left, which is wild type (WT), the second and third plants are mutant (spl38), and the fourth and fifth plants are transgenic complementary plants (spl38-C).
[0163] Example 5: Expression pattern of the OsMED16 gene
[0164] RNA was extracted from the roots, stems, leaves, leaf sheaths, and panicles of wild-type TC65 and reverse transcribed into cDNA. The expression of the OsMED16 gene was detected by qRT-PCR. Primers are shown below. The qRT-PCR reaction system and PCR procedure were performed using the ChamQ Universal SYBR qPCR Master Mix kit (Vazyme, #Q711-02) and a Roche LightCycler 480 quantitative PCR instrument.
[0165] The results showed that OsMED16 was expressed in stems, roots, leaves, leaf sheaths, and panicles. Figure 6 ).
[0166] The primer sequences used for qRT-PCR are:
[0167] OsMED16-F:GATGCTGTTGGCTGCACA;
[0168] OsMED16-R:TCCAGCAAAGCTATCACACTG;
[0169] OsActin1-F:CTGCGATAATGGAACTGGT;
[0170] OsActin1-F:ACAATGCTGGGGAAGACA.
[0171] Example 6: Subcellular localization of OsMED16 and its mutants
[0172] RNA was extracted from wild-type TC65 and the mutant spl38, reverse transcribed into cDNA, and the full-length CDS sequences of the normal OsMED16 gene and its mutant were amplified. These sequences were then ligated into the intermediate vector pQBV3 using the ClonExpress II One Step Cloning Kit (Vazyme) to obtain the recombinant vectors pQBV3-OsMED16 and pQBV3-OsMED16M. The recombinant vector pQBV3-OsMED16 is obtained by replacing the fragment between the restriction endonuclease EcoR32I and the EcoR32I recognition site in the pQBV3 vector with DNA fragment 2, which is the CDS sequence (sequence 1) of the normal OsMED16 gene, while keeping the other nucleotide sequences of the pQBV3 vector unchanged.
[0173] The recombinant vector pQBV3-OsMED16M is obtained by replacing the DNA fragment 3 of the CDS sequence (sequence 4) of the mutant OsMED16 gene with the fragment between the restriction endonuclease EcoR32I and the EcoR32I recognition site of the pQBV3 vector, while keeping the other nucleotide sequences of the pQBV3 vector unchanged.
[0174] Sequence 1 (SEQ ID No. 1) is as follows:
[0175]
[0176] DNA fragment 1 and DNA fragment 2 from the intermediate vector were recombined into the plant expression vector pEarleyGate101 using Gateway LR Clonase II Enzyme Mix (Invitrogen).
[0177] The recombinant vector was transformed into Agrobacterium GV3101. Using Agrobacterium-mediated transformation, it was transferred into tobacco mesophyll cells. After 48 hours, subcellular localization was observed using laser confocal microscopy. The results showed that the OsMED16 protein was located in the nucleus of tobacco mesophyll cells, while the OsMED16 protein mutant was located in both the nucleus and the cytoplasmic membrane. Figure 7 (a). Furthermore, the results of subcellular localization using rice protoplasts were the same as those using tobacco mesophyll cells (a). Figure 7 (b)
[0178] Example 7: Phenotype of OsMED16 CRISPR-Cas9 knockout lines
[0179] The CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR / ) was used to screen for suitable sgRNAs. The sequence (GTATGGGAATCCAAAATGGT) on the third exon of the MED16 gene was ultimately selected as the sgRNA and constructed into the CRISPR vector BGK032 to obtain the recombinant vector BGK032-OsMED16-sgRNA. The recombinant vector BGK032-OsMED16-sgRNA is obtained by inserting the nucleotide sequence GTATGGGAATCCAAAATGGT (SEQ ID No. 7, i.e., sequence 7) between the BsaI restriction endonuclease recognition site of the BGK032 vector, while keeping the other nucleotide sequences of the BGK032 vector unchanged.
[0180] The recombinant vector BGK032-OsMED16-sgRNA was transformed into Agrobacterium EHA105, and then transferred into callus induced by mature embryos of the rice variety Nipponbare via Agrobacterium-mediated genetic transformation. After pre-culture, infection, co-culture, and screening, transgenic plants were obtained and positive identification was performed. T0 generation positive plants osmed16-3, osmed16-5, osmed16-6, and osmed16-8 were obtained, of which osmed16-5 was homozygous, and the other three lines were heterozygous. Figure 8 ).
[0181] Compared with wild-type rice Nipponbare, the OsMED16-5 homozygote showed a mutation in the OsMED16 gene in the rice genome: the nucleotide sequence of the OsMED16 gene in sequence 3 of the sequence listing on both homologous chromosomes underwent the following changes: an adenine deoxyribonucleotide was inserted between positions 1648 and 1649 of sequence 3 in the sequence listing, causing the encoded protein to terminate prematurely at amino acid position 204, thereby knocking out the OsMED16 gene.
[0182] Compared to wild-type Nipponbare rice, the OsMED16-3 heterozygote exhibited mutations in the OsMED16 gene in its genome. On two homologous chromosomes, the nucleotide sequence of the OsMED16 gene (Sequence 3 in the sequence listing) underwent the following changes: On one chromosome, two deoxyribonucleotides were deleted between positions 1646 and 1649 of Sequence 3, causing premature termination of the encoded protein at amino acid position 203, thus knocking out the OsMED16 gene. On the other chromosome, ten deoxyribonucleotides (CCCACCATTT) between positions 1641 and 1652 of Sequence 3 were mutated to five deoxyribonucleotides (TCTAA), causing premature termination of the encoded protein at amino acid position 202, also knocking out the OsMED16 gene.
[0183] Compared to wild-type Nipponbare rice, the OsMED16-6 heterozygote exhibits a mutation in the OsMED16 gene in the rice genome. On two homologous chromosomes, the nucleotide sequence of the OsMED16 gene (Sequence 3 in the sequence listing) has undergone the following changes: On one chromosome, an adenine deoxyribonucleotide was inserted between positions 1648 and 1649 of Sequence 3 in the sequence listing, causing premature termination of the encoded protein at amino acid position 204, thus knocking out the OsMED16 gene. On the other chromosome, 33 deoxyribonucleotides were deleted between positions 1624 and 1658 of Sequence 3 in the sequence listing, causing premature termination of the encoded protein at amino acid position 169, thus knocking out the OsMED16 gene.
[0184] Compared to wild-type rice Nipponbare, the OsMED16-8 heterozygote exhibits a mutation in the OsMED16 gene in the rice genome: On two homologous chromosomes, the nucleotide sequence of the OsMED16 gene (Sequence 3 in the sequence listing) has undergone the following changes: On one chromosome, a deoxyribonucleotide is deleted between positions 1646 and 1648 of Sequence 3 in the sequence listing, causing premature termination of the encoded protein at amino acid position 178, thus knocking out the OsMED16 gene; on the other chromosome, a thymine deoxyribonucleotide is inserted between positions 1647 and 1648 of Sequence 3 in the sequence listing, causing premature termination of the encoded protein at amino acid position 204, thus knocking out the OsMED16 gene.
[0185] osmed16-3, osmed16-5, osmed16-6 and osmed16-8 were continuously cultured with wild-type rice Nipponbare in a greenhouse environment with a photoperiod of 14h light / 10h dark and a temperature of 28℃.
[0186] The results showed that, compared with the wild-type Nipponbare (Nip), the OsMED16 knockout lines also exhibited a lesion-like phenotype. All four lines showed extremely weak, stunted, and lesion-prone phenotypes during the vegetative development stage, with the phenotype becoming very pronounced after 60 days of culture, ultimately leading to death after 70 days of growth. Furthermore, the homozygous line osmed16-5 exhibited a more severe phenotype and died earlier than the other three heterozygous lines. Figure 9 ).
[0187] Example 8: Application of the rice lesion gene OsMED16 in breeding
[0188] (1) In production practice, rice lesion mutants spl38 and OsMED16 mutant genes can be used to introduce the OsMED16 mutant gene into rice through conventional hybridization, molecular marker-assisted selection or genetic engineering. This can significantly enhance the resistance of transgenic rice to fungal diseases (such as rice blast) and bacterial diseases (such as rice bacterial blight), thereby improving rice varieties.
[0189] (2) In production practice, for some crops that need to delay flowering, the purpose of delaying flowering can be achieved by heterologous expression of the OsMED16 mutant gene.
[0190] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. For those skilled in the art, any direct derivation or modification of the disclosed content of this invention, or any equivalent substitution of some of the technical features, should be considered within the scope of protection of this invention.
[0191] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. The use of a protein or a substance expressing said protein in any of the following: A1) Application in reducing the number of rice tillers and / or in the preparation of products that reduce the number of rice tillers; A2) Applications in delaying rice flowering time and / or in the preparation of products that delay rice flowering time; The protein is the protein whose amino acid sequence is shown in SEQ ID No.
5.
2. The application according to claim 1, characterized in that, The substance expressing the protein is any one of the following: D1) A nucleic acid molecule encoding the protein described in claim 1; D2) An expression cassette containing the nucleic acid molecules described in D1); D3) A recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2); D4) Recombinant microorganisms containing the nucleic acid molecules described in D1), or recombinant microorganisms containing the expression cassette described in D2), or recombinant microorganisms containing the recombinant vector described in D3); D5) A transgenic plant cell line containing the nucleic acid molecule described in D1), or a transgenic plant cell line containing the expression cassette described in D2), or a transgenic plant cell line containing the recombinant vector described in D3); D6) Transgenic plant tissue containing the nucleic acid molecules described in D1), or transgenic plant tissue containing the expression cassette described in D2), or transgenic plant tissue containing the recombinant vector described in D3); D7) A transgenic plant organ containing the nucleic acid molecule described in D1), or a transgenic plant organ containing the expression cassette described in D2), or a transgenic plant organ containing the recombinant vector described in D3).
3. The application according to claim 2, characterized in that, D1) The nucleic acid molecule is any one of the following: d1) The nucleotide sequence is that of a DNA molecule as shown in SEQ ID No. 6; d2) The coding sequence is a DNA molecule as shown in SEQ ID No.
4.
4. A method for breeding late-flowering rice, comprising mutating nucleotide G to A at position 8024 of SEQ ID No. 3 in the genome of the target rice; wherein the rice genome is the Taichung65 genome; and wherein the flowering time of the late-flowering rice is later than that of the target rice.