Nucleic acid products, kits and uses for diagnosing esophageal cancer
By detecting the methylation level of specific regions of the HOXD1 gene, a nucleic acid product and detection kit were developed, which solved the problem of insufficient sensitivity and specificity of esophageal cancer detection and achieved high sensitivity and high specificity of esophageal cancer diagnosis.
Patent Information
- Application Number
- CN202310133651.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2022-02-22
- Filing Date
- 2023-02-20
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2043-02-20
AI Technical Summary
The sensitivity and specificity of the detection methods for esophageal cancer in the prior art are insufficient, endoscopic detection depends on hardware equipment and doctor experience, and there are problems of invasiveness and low patient compliance.
Provide a nucleic acid product. By detecting the methylation level of the HOXD1 gene Chr2:176189800-176189943 region, using methylation-specific PCR, bisulfite sequencing and other methods, combined with fluorescence quantification, a detection kit for diagnosing esophageal cancer is developed.
It achieved 100% sensitivity and 80% specificity for esophageal cancer tissue samples, the detection sensitivity for plasma samples of esophageal cancer patients reached 82.9%, and the specificity for plasma samples of healthy people reached 95.3%, improving the accuracy and sensitivity of the detection.
Smart Images

Figure CN116083586B_ABST
Abstract
Description
[0001] This application claims the priority of a Chinese patent application with the application number 202210161853.8 and the title "Biomarkers, Nucleic Acid Products and Kits for Esophageal Cancer", which was filed with the Chinese Patent Office on February 22, 2022. The entire content thereof is incorporated herein by reference. Technical Field
[0002] The present invention relates to the field of biotechnology, and particularly to a nucleic acid product, a kit and uses for diagnosing esophageal cancer. Background Art
[0003] According to the latest statistical data of GLOBOCAN 2020, esophageal cancer is the tenth most common malignant tumor globally in terms of incidence, and the sixth in terms of mortality. Although an increase in the survival rate of esophageal cancer patients has been observed in some studies, compared with other cancers, the prognosis of esophageal cancer is relatively poor. Most studies show that the 5-year survival rate of esophageal cancer patients is between 15% and 25%. In a population study including 1033 ESCC patients who underwent surgery, the 5-year survival rates of patients in stages IA, IB, IIA, IIB, IIIA, IIIB, IIIC and IV were 84.9%, 70.9%, 56.2%, 43.3%, 37.9%, 23.3%, 12.9% and 3.4% respectively (Evaluation of the 7th edition of the TNM classification in patients with resected esophageal squamous cell carcinoma. World J Gastroenterol, 2014). Additionally, the survival rate of esophageal cancer patients with distant organ metastasis at the time of initial diagnosis is particularly poor. A retrospective study showed that the median survival of these patients was only 6 months, and the 1-year or 2-year survival rates were 21.1% or 11.8% respectively (Analysis of prognostic factors for esophageal squamous cell carcinoma with distant organ metastasis at initial diagnosis. J Chin Med Assoc, 2014). All these evidences indicate that early diagnosis and treatment of esophageal cancer can improve the survival rate of esophageal cancer patients.
[0004] At present, endoscopy and pathological biopsy are the gold standards for diagnosing early esophageal cancer. Under endoscopy, the changes of the esophageal mucosa can be directly observed, the cancer status can be evaluated, the images of the lesions can be taken or recorded, and the nature, location, boundary and scope of the lesions can be evaluated by methods such as staining and magnification, thus completing screening and early diagnosis in one step. However, endoscopic detection depends on hospital hardware equipment and doctor experience, and has disadvantages such as invasiveness and low patient compliance. In addition, although there are kits for diagnosing esophageal cancer using tumor markers, the sensitivity of these kits still needs to be improved. Summary of the Invention
[0005] Based on this, it is necessary to provide a nucleic acid product, a detection kit and its use for diagnosing esophageal cancer to improve the problems of low detection sensitivity, low specificity and shortage of medical resources in traditional detection methods for esophageal cancer.
[0006] In a first aspect, the present invention provides a nucleic acid product for diagnosing esophageal cancer, using GRCh38.p13 as the reference genome, and the nucleic acid product is used to detect the methylation level of the region of the HOXD1 gene Chr2: 176189800-176189943.
[0007] In some embodiments of the present invention, the nucleic acid product detects the methylation level of the region of the HOXD1 gene Chr2: 176189800-176189943 by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole-genome methylation sequencing, pyrosequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, methylation-sensitive restriction enzyme method and fluorescence quantification method.
[0008] In some embodiments of the present invention, the nucleic acid product includes a methylation detection primer pair and a non-methylation detection primer pair for detecting the methylation level of the region of the HOXD1 gene Chr2: 176189800-176189943.
[0009] In some embodiments of the present invention, the nucleotide sequences of the methylation detection primer pair are shown as SEQ ID NO: 1 to SEQ ID NO: 2, and the nucleotide sequences of the non-methylation detection primer pair are shown as SEQ ID NO: 3 to SEQ ID NO: 4.
[0010] In some embodiments of the present invention, the nucleic acid product includes a detection primer pair for detecting the methylation level of the region of the HOXD1 gene Chr2: 176189800-176189943 and a corresponding detection probe.
[0011] In some embodiments of the present invention, the 5′ end of the detection probe contains a fluorescent group and the 3′ end contains a fluorescence quenching group.
[0012] In some embodiments of the present invention, the fluorescent reporter group is selected from one of FAM, TET, VIC, JOE, HEX, Cy3, Cy3.5, Cy5, Cy5.5, NED and Texas Red, and the fluorescence quenching group can be selected from one of TAMRA, BHQ and MGB.
[0013] In some embodiments of the present invention, the nucleotide sequences of the detection primer pair and the corresponding detection probe include at least one of the following nucleotide combinations:
[0014] Nucleotide combination 1, including the detection primer pair shown in SEQ ID NO: 1 to SEQ ID NO: 2 and the detection probe shown in SEQ ID NO: 17;
[0015] Nucleotide combination 2, including the detection primer pair shown in SEQ ID NO: 11 to SEQ ID NO: 12 and the detection probe shown in SEQ ID NO: 18; Nucleotide combination 3, including the detection primer pair shown in SEQ ID NO: 13 to SEQ ID NO: 14 and the detection probe shown in SEQ ID NO: 19; and Nucleotide combination 4, including the detection primer pair shown in SEQ ID NO: 15 to SEQ ID NO: 16 and the detection probe shown in SEQ ID NO: 20.
[0016] In a second aspect, the present invention provides a detection kit for diagnosing esophageal cancer, and the kit includes the above nucleic acid product.
[0017] In some embodiments of the present invention, the kit further includes one or more of a DNA extraction reagent, a methylation conversion reagent, a DNA purification reagent, a PCR reaction reagent and a quality control product.
[0018] In some embodiments of the present invention, the methylation conversion reagent includes bisulfite.
[0019] In some embodiments of the present invention, the quality control product includes a positive reference product, a negative reference product, a primer pair and a probe for detecting an internal reference gene.
[0020] In some embodiments of the present invention, the internal reference gene is the ACTB gene, and the nucleotide sequences of the primer pair and the probe for detecting the internal reference gene are as shown in SEQ ID NO: 9 to SEQ ID NO: 10 and SEQ ID NO: 21.
[0021] In a third aspect, the present invention provides the use of the nucleic acid product and the detection kit in the preparation of an esophageal cancer diagnostic product.
[0022] In some embodiments of the present invention, the sample to be tested includes at least one of a cell line, a biopsy tissue, whole blood, isolated blood cells, and plasma.
[0023] The nucleic acid product and the detection kit for diagnosing esophageal cancer disclosed in the present invention can effectively diagnose esophageal cancer by detecting the methylation level of the HOXD1 gene in the region of Chr2: 176189800-176189943. The sensitivity of detecting esophageal cancer tissue samples is as high as 100%, the specificity of detecting normal tissue samples adjacent to esophageal cancer is 80%, the sensitivity of detecting plasma samples of esophageal cancer patients is as high as 82.9%, and the specificity of detecting plasma samples of healthy people is 95.3%. The nucleic acid product and the detection kit have high diagnostic sensitivity and specificity, and are minimally invasive operations, providing a new solution for the screening and diagnosis of esophageal cancer. Description of the Drawings
[0024] Figure 1 ROC curve for nucleotide combinations 1-4 in diagnosing plasma samples of esophageal cancer patients and healthy people. Embodiments
[0025] For ease of understanding of the present invention, the present invention will be described more comprehensively below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the disclosure of the present invention more thorough and comprehensive.
[0026] The term "and / or" includes any and all combinations of one or more of the related listed items. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.
[0027] The term "gene" refers to a DNA segment encoding an amino acid polypeptide chain, which includes sequences located in the coding region and non-coding region involved in gene transcription / translation and transcription / translation regulation, as well as exon and intron sequences.
[0028] The term "methylation" is a form of chemical modification of DNA that can change genetic expression without altering the DNA sequence. Generally, DNA methylation refers to the covalent binding of a methyl group to the 5th carbon position of cytosine in genomic CpG dinucleotides under the action of DNA methyltransferase. DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression.
[0029] The term "methylation level" refers to whether cytosine in one or more CpG dinucleotides in a DNA sequence is methylated, or the frequency / ratio / percentage of methylation, representing both qualitative and quantitative concepts. In practical applications, different detection indicators can be used to compare DNA methylation levels according to the actual situation. For example, in some cases, comparison can be made based on the Ct value detected in the sample; in some cases, the proportion of gene methylation in the sample can be calculated, that is, the number of methylated molecules / (the number of methylated molecules + the number of unmethylated molecules) × 100%, and then comparison can be made; in some cases, statistical analysis and integration of each indicator are also required to obtain the final determination indicator.
[0030] The term "CpG island" refers to a region on DNA that is rich in a large number of cytosine and guanine connected by phosphate ester bonds. CpG dinucleotides are usually concentrated in the promoter regions and exons of human genes. In the normal human genome, CpG sites outside CpG islands are usually methylated, while CpG sites in CpG islands are usually in an unmethylated state, and this form of methylation is stably inherited during cell division. When tumors occur, the degree of demethylation of CpG sites outside the CpG islands of tumor suppressor genes increases, while the CpG sites in CpG islands are highly methylated, resulting in an increase in chromosome helicity, transcriptional inhibition, and gene expression loss.
[0031] The HOXD1 (homeobox D1) gene is a member of the Antp homeobox family and encodes a protein with a homeobox DNA-binding domain. Referring to GRCh38.p13, the HOXD1 gene is located on human chromosome 2. It should also be noted that the positions of the sites or regions mentioned in this article are all referenced to GRCh38.p13.
[0032] The GSX1 (GS homeobox 1) gene has the activity of enabling sequence-specific double-stranded DNA binding and acts upstream or within the positive regulation of transcription by RNA polymerase II. Referring to the GRCh38.p13 reference genome, the HOXD1 gene is located on human chromosome 13.
[0033] It has been found in the research of the present invention that the sensitivity of using the HOXD1 gene as a biomarker for diagnosing esophageal cancer tissue samples can reach 100%, and the specificity is 80%; the sensitivity of using the GSX1 gene as a biomarker for diagnosing esophageal cancer tissue samples is 100%, and the specificity is 15%. In contrast, detecting the methylation level of a specific region of the HOXD1 gene is more suitable for the diagnosis of esophageal cancer. Further verifying the detection performance of the HOXD1 gene for esophageal cancer using plasma samples, it is found that the sensitivity of detecting the methylation level of a specific region of the HOXD1 gene for diagnosing plasma samples of esophageal cancer patients is as high as 82.9%, and the specificity of detecting plasma samples of healthy people is as high as 95.3%. The technical solution provided by the present invention can effectively improve the detection rate of esophageal cancer and the detection accuracy.
[0034] In some embodiments, the target region for detecting the methylation level of the HOXD1 gene (abbreviated as "HOXD1 target region") is the CpG island of the HOXD1 gene. Further, the HOXD1 target region is Chr2: 176189800 - 176189943. In the region of Chr2: 176189800 - 176189943, there are 11 CG dinucleotide sites. Further still, esophageal cancer is diagnosed by detecting the methylation level of the target sites in the HOXD1 target region. In an optional specific example, the target sites in the HOXD1 target region are at least one of the following sites: Chr2: 176189800, Chr2: 176189815, Chr2: 176189818, Chr2: 176189830, Chr2: 176189845, Chr2: 176189852, Chr2: 176189856, Chr2: 176189921, Chr2: 176189927, Chr2: 176189930, and Chr2: 176189935.
[0035] In some embodiments, the target region for detecting the methylation level of the GSX1 gene (hereinafter referred to as the "GSX1 target region") is the CpG island of the GSX1 gene. Further, the GSX1 target region is Chr13: 27793590-27793730. There are 13 CG dinucleotide sites in the region of Chr13: 27793590-27793730. Further still, esophageal cancer is diagnosed by detecting the methylation level of the target sites in the GSX1 target region. In an optional specific example, the target sites in the GSX1 target region are at least one of the following sites: Chr13: 27793604, Chr13: 27793608, Chr13: 27793623, Chr13: 27793643, Chr13: 27793645, Chr13: 27793651, Chr13: 27793673, Chr13: 27793679, Chr13: 27793682, Chr13: 27793687, Chr13: 27793693, Chr13: 27793695, and Chr13: 27793714.
[0036] Based on the above solution, an embodiment of the present application provides a nucleic acid product for diagnosing esophageal cancer. Using GRCh38.p13 as the reference genome, this nucleic acid product is used to detect the methylation level of the region of the HOXD1 gene Chr2: 176189800-176189943.
[0037] It can be understood that when detecting the methylation level of the target region, the entire region of the above target region can be detected, or a partial region of the above target region can be detected.
[0038] In some embodiments, the nucleic acid product detects the methylation level of the region of the HOXD1 gene Chr2: 176189800-176189943 by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole-genome methylation sequencing, pyrosequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, methylation-sensitive restriction enzyme method, and fluorescence quantification method.
[0039] In some embodiments, the methylation level of the target region of the HOXD1 gene is detected by bisulfite sequencing. At this time, the nucleic acid product includes a methylation detection primer pair and an unmethylation detection primer pair for detecting the methylation level of the region of the HOXD1 gene Chr2: 176189800-176189943.
[0040] In some embodiments, the nucleotide sequences of the methylation detection primer pairs are as shown in SEQ ID NO: 1 to SEQ ID NO: 2, and the nucleotide sequences of the non-methylation detection primer pairs are as shown in SEQ ID NO: 3 to SEQ ID NO: 4.
[0041] In some embodiments, the methylation level of the HOXD1 target region is detected by methylation-specific fluorescence quantitative PCR. At this time, the nucleic acid product includes a detection primer pair for detecting the methylation level of the region Chr2: 176189800-176189943 of the HOXD1 gene and a corresponding detection probe.
[0042] In some embodiments, the 5′ end of the detection probe contains a fluorescent group, and the 3′ end contains a fluorescence quenching group.
[0043] In some embodiments, the fluorescent reporter group is selected from one of FAM, TET, VIC, JOE, HEX, Cy3, Cy3.5, Cy5, Cy5.5, NED, and Texas Red, and the fluorescence quenching group can be selected from one of TAMRA, BHQ, and MGB. It can be understood that the detection of the methylation of the target region and the detection of the internal reference gene can be carried out in the same reaction well or in different reaction wells, and the fluorescent group of the detection probe is reasonably selected according to the actual situation. In an optional specific example, the detection of the methylation of the target region and the detection of the internal reference gene are carried out in the same reaction well. Among them, the fluorescent reporter group of the detection probe for the methylation of the target region is FAM, and its fluorescence quenching group is MGB; the fluorescent reporter group of the detection probe for the internal reference gene is VIC, and its fluorescence quenching group is BHQ-1.
[0044] In some embodiments, the nucleotide sequences of the detection primer pair and the corresponding detection probe include at least one of the following nucleotide combinations: Nucleotide combination 1, including the detection primer pair as shown in SEQ ID NO: 1 to SEQ ID NO: 2 and the detection probe as shown in SEQ ID NO: 17;
[0045] Nucleotide combination 2, including the detection primer pair as shown in SEQ ID NO: 11 to SEQ ID NO: 12 and the detection probe as shown in SEQ ID NO: 18;
[0046] Nucleotide combination 3, including the detection primer pair as shown in SEQ ID NO: 13 to SEQ ID NO: 14 and the detection probe as shown in SEQ ID NO: 19; and
[0047] Nucleotide combination 4, including the detection primer pair shown in SEQ ID NO: 15 to SEQ ID NO: 16 and the detection probe shown in SEQ ID NO: 20.
[0048] One embodiment of the present application also provides a detection kit for diagnosing esophageal cancer. The kit diagnoses esophageal cancer by detecting the methylation level of the HOXD1 gene in the region of Chr2: 176189800 to 176189943. The detection kit includes the nucleic acid products described in any of the above embodiments.
[0049] In one embodiment, the above kit includes one or more of DNA extraction reagent, methylation conversion reagent, DNA purification reagent, PCR reaction reagent, and quality control product.
[0050] Specifically, the methylation conversion reagent is used to deaminate cytosine that is not methylated in DNA to form uracil, while methylated cytosine remains unchanged. In an optional specific example, the methylation conversion reagent includes bisulfite.
[0051] In one embodiment, the PCR reaction reagent includes PCR buffer, dNTP, MgCl2, and DNA polymerase.
[0052] In one embodiment, the quality control product includes positive reference product, negative reference product, primer pair and probe for detecting internal reference gene.
[0053] In one embodiment, the internal reference gene is the ACTB gene, and the nucleotide sequences of the primer pair and probe for detecting the internal reference gene are as shown in SEQ ID NO: 9 to SEQ ID NO: 10 and SEQ ID NO: 21.
[0054] One embodiment of the present application also provides the use of the above nucleic acid products and detection kits in the preparation of esophageal cancer diagnostic products.
[0055] In one embodiment, the sample to be tested includes at least one sample of cell line, biopsy tissue, whole blood, isolated blood cells, and plasma.
[0056] The above kit for diagnosing esophageal cancer uses the HOXD1 gene as a biomarker and diagnoses esophageal cancer by detecting the methylation level of the biomarker. The kit has high sensitivity and relatively high accuracy; and the above kit helps to achieve population stratification, improve the compliance of endoscopic examination, and is conducive to improving the early diagnosis rate of esophageal cancer, especially early esophageal cancer, by further endoscopic and pathological diagnosis of methylation-positive samples.
[0057] In addition, an embodiment of the present application also provides a chip for diagnosing esophageal cancer, on which a reaction unit for detecting the methylation level of the HOXD1 gene is provided.
[0058] Optionally, the nucleic acid product of any of the above embodiments is provided on the reaction unit.
[0059] In some embodiments, at least one of an extraction unit and a conversion unit is further provided on the above chip. Specifically, the extraction unit is used to extract nucleic acids from a sample to be tested; the conversion unit is used to convert nucleic acids (unmethylated cytosine is converted to uracil).
[0060] By using the HOXD1 gene as a biomarker for diagnosing esophageal cancer, the above chip for diagnosing esophageal cancer has the advantages of high sensitivity and high detection rate. Specific Examples
[0061] The following will be described in detail with specific examples. Unless otherwise specified in the following examples, other components are not included except for inevitable impurities. The reagents and instruments used in the examples are all conventional selections in the art unless otherwise specified. The experimental methods without specific conditions in the examples are carried out under conventional conditions, such as the conditions described in the literature, books, or the methods recommended by the manufacturers.
[0062] Example
[0063] Collect 20 whole blood samples from healthy people and 20 plasma samples from esophageal cancer patients in a certain hospital in Zhengzhou, record the sample information, and all samples are anonymized. The sample information is shown in Table 1.
[0064] Table 1
[0065]
[0066] 1. DNA extraction;
[0067] Use the Blood / Cell / Tissue Genomic DNA Extraction Kit (Catalog No.: DP304) from Tiangen Biochemical Technology (Beijing) Co., Ltd. to extract the genomic DNA of cells from each sample. The specific operation refers to the kit instruction manual.
[0068] 2. Bisulfite conversion and recovery
[0069] The genomic DNA of each extracted sample was separately subjected to bisulfite conversion. The nucleic acid conversion kit used was the nucleic acid purification reagent of Wuhan AmySen Life Science Co., Ltd. (Hubei Medical Device Preparation 20200843). For the specific experimental operations, refer to the kit instruction manual. During the conversion process, unmethylated cytosine (C) is converted into uracil (U), while methylated cytosine remains unchanged. Uracil (U) pairs with adenine (A) in the subsequent PCR step, and cytosine (C) pairs with guanine (G), thereby achieving the distinction between methylated and unmethylated sequences.
[0070] 3. PCR Reaction
[0071] Using Taq DNA polymerase, the bisulfite-converted DNA was used as a template, and PCR amplification was performed simultaneously using methylated primer pairs and unmethylated primer pairs. The methylated primer pairs can amplify the converted methylated templates, and the unmethylated primer pairs can amplify the converted unmethylated templates.
[0072] Specifically, the upstream primer sequence of the HOXD1 methylated primer pair (5′-3′) is: CCCCGTTGTAGGTAAATTCGTC (SEQ ID NO: 1), and the downstream primer sequence of the HOXD1 methylated primer pair (5′-3′) is: GGGACTATCTCGATACGCCGA (SEQ ID NO: 2); the upstream primer sequence of the HOXD1 unmethylated primer pair (5′-3′) is: CCCCGTTGTAGGTAAATTTGTT (SEQ ID NO: 3), and the downstream primer sequence of the HOXD1 unmethylated primer pair (5′-3′) is: CCCCCACTATCTCAATACACCAA (SEQ ID NO: 4).
[0073] The upstream primer sequence of the GSX1 methylated primer pair (5′-3′) is: CCCGTAGTAAGAGGATGCGTAC (SEQ ID NO: 5), and the downstream primer sequence of the GSX1 methylated primer pair (5′-3′) is: CCCCTCTTCACCTACTTCTCGA (SEQ ID NO: 6); the upstream primer sequence of the GSX1 unmethylated primer pair (5′-3′) is: CCCCGTAGTAAGAGGATGTGTAT (SEQ ID NO: 7), and the downstream primer sequence of the GSX1 unmethylated primer pair (5′-3′) is: GGGGGGTCTTCACCTACTTCTCAA (SEQ ID NO: 8).
[0074] Specifically, PCR for detecting the methylation levels of the HOXD1 gene and the GSX1 gene was performed on the same sample. That is, only the methylation primer pair and the unmethylated primer pair of one gene (HOXD1 gene or GSX1 gene) were added to one PCR tube, and at the same time, the primer pair of the internal reference gene ACTB was added. The upstream primer sequence of ACTB is: AAGGTGGTTGGGTGGTTGTTTTG (SEQ ID NO: 9), and the downstream primer sequence of ACTB is: AATAACACCCCCACCCTGC (SEQ ID NO: 10). The PCR amplification system for each sample is shown in Table 2.
[0075] Table 2
[0076] Component Dosage (μL) <![CDATA[10×Taq buffer (Mg 2+ Free)]]> 5 <![CDATA[25mMMg 2+ > 4 dNTPMix (10 mM each) 1 Methylated primer pair upstream primer (10 μM) 1 Methylated primer pair downstream primer (10 μM) 1 Unmethylated primer pair upstream primer (10 μM) 0.5 Unmethylated primer pair downstream primer (10 μM) 0.5 ACTB upstream primer (10 μM) 1 ACTB downstream primer (10 μM) 1 Hot start Taq DNA polymerase 0.5 Template DNA 10 Ultra-pure water Make up to 50
[0077] The PCR amplification program is shown in Table 3.
[0078] Table 3
[0079]
[0080] 4. Sequencing and Analysis
[0081] The PCR products were sent to a sequencing company for Sanger sequencing. For the amplification products of the HOXD1 gene, the primers corresponding to SEQ ID NO: 1-4 were used as sequencing primers for sequencing. For the amplification products of the GSX1 gene, the primers corresponding to SEQ ID NO: 5-8 were used as sequencing primers for sequencing. The methylation status of each CpG site in each amplicon was analyzed according to the sequencing peak map. Specifically, the methylation status of cytosine in a CpG nucleotide is divided into two types: methylation and non-methylation. Among them, methylation is further divided into complete methylation and partial methylation. If the sequencing result of cytosine at a certain CpG dinucleotide site shows both C and T at the position of cytosine, then this site is considered to be partially methylated.
[0082] If more than 95% of the CpG dinucleotide sites in a certain amplicon are methylated (that is, at least 10 are methylated for the HOXD1 gene and at least 12 are methylated for the GSX1 gene), then this sample is considered to be methylated in this region.
[0083] Calculate the number of methylated positives / negatives in each sample, and calculate the methylated positive / negative ratio. Sensitivity = the ratio of methylated positives in samples with a positive pathological result; Specificity = the ratio of methylated negatives in samples with a negative pathological result. The results are shown in Table 4. It should be noted that during the PCR reaction experiment, the experimenter does not know the pathological information of the sample in advance. After the PCR reaction is completed, the PCR results are compared with the pathological information, and the sensitivity and specificity data are calculated.
[0084] Table 4
[0085]
[0086] As can be seen from the results in Table 4, both the HOXD1 gene and the GSX1 gene are methylated in 20 esophageal cancer samples, and the methylated positive ratio is 100%. This indicates that using the HOXD1 gene or the GSX1 gene as a biomarker, the detection sensitivity for 20 esophageal cancer samples is 100%; the methylated positive rate of the GSX1 gene in 20 healthy human samples is as high as 85%, indicating that its specificity is 15%; the methylated positive rate of the HOXD1 gene in 20 healthy human samples is 20%, indicating that its specificity is 80%. It can be seen that the methylation of the CpG island of the HOXD1 gene is an esophageal cancer biomarker with high sensitivity and high specificity. Moreover, combining the sample information in Table 1, it can be seen that among the 20 samples diagnosed with esophageal cancer, there are 3 samples in the T1 stage and 2 samples in the T2 stage, indicating that the methylation of the HOXD1 gene and the GSX1 gene can also effectively detect early esophageal cancer and can be used as a product for early screening.
[0087] Example
[0088] Furthermore, in order to be able to conveniently and quickly diagnose esophageal cancer by detecting the gene methylation level, this example provides a method for diagnosing esophageal cancer by detecting the methylation level of the target gene through methylation-specific fluorescence quantitative PCR. The sensitivity of using the methylation level of the GSX1 gene to diagnose esophageal cancer patient tissue samples is as high as 100%, but considering its low specificity, it is not verified again in this example.
[0089] 1. Sample collection
[0090] A total of 158 blood samples were collected from patients diagnosed with esophageal cancer by pathological tissue biopsy in a certain hospital. Among them, 72 were patients with early-stage esophageal cancer, including those with pathological stages of high-grade intraepithelial neoplasia, stage Ia, stage Ib, stage IIa, and stage IIb. 86 were patients with mid- and late-stage esophageal cancer, including those with pathological stages of stage III and stage IV. In addition, 128 blood samples were collected from healthy patients undergoing routine physical examinations in this hospital. The collection of all blood samples was approved by the volunteers themselves, and all volunteers signed informed consent forms. All samples were anonymized. The collection process of all samples in this example was approved by the ethics committee.
[0091] 2. Extraction of free DNA in plasma samples
[0092] After centrifuging fresh blood samples, the plasma layer was collected. Subsequently, the magnetic bead method serum / plasma free DNA (cfDNA) extraction kit (DP709) from Tiangen Biochemical Technology (Beijing) Co., Ltd. was used for plasma cfDNA extraction, and the specific operation was carried out according to the kit instructions.
[0093] The bisulfite conversion and purification processes were the same as in Example 1.
[0094] Methylation-specific fluorescence quantitative PCR was used to detect the methylation level of the HOXD1 gene.
[0095] In addition to the methylation primer pairs SEQ ID NO: 1 - SEQ ID NO: 2 for detecting the methylation level of the HOXD1 gene, another 3 pairs of methylation detection primer pairs for amplifying the region of Chr2: 176189800 - 176189943 were designed for methylation-specific fluorescence quantitative PCR experiments. The 4 pairs of primer pairs could detect DNA with a methylation level of greater than or equal to 1% in the samples and could amplify efficiently and specifically. The sequences of the 4 pairs of methylation primer pairs for detecting the methylation level of the HOXD1 gene and the detection probes are shown in Table 5.
[0096] Table 5
[0097]
[0098] Using the DNA of each sample after bisulfite conversion as a template, the methylation primer pairs and detection probes provided in Table 5 were used to detect the methylation level of the HOXD1 gene in the region of Chr2: 176189800-176189943 by methylation-specific fluorescence quantitative PCR. Specifically, in a PCR tube, the DNA template of the sample to be tested, any one of the nucleotide combinations 1-4, the primer pair and detection probe for detecting the internal reference gene ACTB (nucleotide combination 5), and the necessary PCR buffer and Taq enzyme, etc. were added. The detection probes for the target regions were all Taqman probes, with a fluorescent group at the 5′ end and a fluorescent quenching group at the 3′ end. Specifically, the fluorescent group at the 5′ end of the detection probe for the target region of the HOXD1 gene in Table 5 was ROX, and its fluorescent quenching group at the 3′ end was MGB. The fluorescent group at the 5′ end of the ACTB gene detection probe was VIC, and its fluorescent quenching group at the 3′ end was BHQ1. When detecting the sample to be tested, positive controls and negative controls should be set on each PCR plate. Preparation method of the positive control DNA template: 10 3 copies / μL of the plasmid of the target region of the HOXD1 gene after bisulfite conversion and 10 3 copies / μL of the plasmid of the ACTB gene after conversion were mixed in equal volume. The template of the negative control was ultrapure water. The PCR reaction system was configured according to the formula provided in Table 6 and amplified on a fluorescence quantitative PCR instrument according to the amplification program shown in Table 7.
[0099] Table 6
[0100]
[0101] Table 7
[0102]
[0103] After the PCR reaction was completed, the baseline was adjusted, and the threshold line was set at the inflection point of the S-shaped amplification curve to obtain the Ct values of each sample amplified by different primer pairs and probe combinations. If in each PCR reaction plate, the Ct values of the HOXD1 gene and the ACTB gene in the positive control wells were both between 26 and 30, and there was no amplification curve in the negative control wells, then this experiment was normal. If in a certain sample to be tested, the Ct value of the ACTB gene was greater than 35, then this sample was an abnormal sample and needed to be retested or excluded.
[0104] The PCR detection results were analyzed by the 2 -ΔΔCt method for ROC analysis. When statistically analyzing the methylation level of the HOXD1 gene target region by different nucleotide combinations to diagnose esophageal cancer, the sensitivity, specificity, and AUC value when the Youden's index was the largest were calculated, where ΔΔCt = (Ct 目标区域 -CtACTB ) 样本 -(Ct 目标区域 -Ct ACTB ) 阳性对照 , the results are shown in Table 8 and Figure 1 as follows.
[0105] Table 8
[0106]
[0107]
[0108] As can be seen from Table 8 and Figure 1 it can be seen that using different nucleotide combinations to detect the methylation level of the HOXD1 gene in the region of Chr2: 176189800-176189943 by qMSP method can effectively diagnose esophageal cancer plasma samples, and the AUC values of the diagnosis are all greater than or equal to 0.831. Specifically, the sensitivity ranges of the four detection primer pairs and detection probe combinations for diagnosing esophageal cancer plasma samples are 74.1% - 82.9%, and their specificities for diagnosing healthy human plasma samples are all higher than 93.7%. In addition, the diagnostic effect of nucleotide combination 1 is the best, its sensitivity for detecting cancer samples is 82.9%, its specificity for detecting healthy human samples is 95.3%, and its AUC value can reach 0.883.
[0109] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope recorded in this specification.
Claims
1. A nucleic acid product for diagnosing esophageal cancer, characterized in that, The nucleic acid products include primer pairs with nucleotide sequences as shown in SEQ ID NO: 1-2 and a probe with a nucleotide sequence as shown in SEQ ID NO: 17, primer pairs with nucleotide sequences as shown in SEQ ID NO: 11-12 and a probe with a nucleotide sequence as shown in SEQ ID NO: 18, primer pairs with nucleotide sequences as shown in SEQ ID NO: 13-14 and a probe with a nucleotide sequence as shown in SEQ ID NO: 19, and primer pairs with nucleotide sequences as shown in SEQ ID NO: 15-16 and a probe with a nucleotide sequence as shown in SEQ ID NO:
20.
2. The nucleic acid product according to claim 1, wherein The 5′ end of the probe contains a fluorescent group, and the 3′ end of the probe contains a fluorescence quenching group.
3. A detection kit for diagnosing esophageal cancer, characterized in that, The detection kit includes the nucleic acid product as described in claim 1 or 2.
4. The detection kit according to claim 3, characterized in that, The detection kit further includes one or more of DNA extraction reagents, bisulfite, DNA purification reagents, PCR reaction reagents, or quality control products.
5. Use of the nucleic acid product as described in claim 1 or 2 in the preparation of an esophageal cancer diagnostic product.
Citation Information
Patent Citations
Gene for prognosis of lung cancer and application thereof
CN104046624A