Gp21 protein encoded by Pseudomonas aeruginosa phage and its application in inhibiting Escherichia coli phage infection

Abstract

The present invention belongs to the field of biotechnology, and relates to a Gp21 protein encoded by a Pseudomonas aeruginosa phage and its application in inhibiting Escherichia coli phage infection. A Gp21 protein encoded by a Pseudomonas aeruginosa phage, the amino acid sequence of which is shown in SEQ ID NO.1. The expression of the Gp21 protein in a non-original host bacterium, Escherichia coli BL21 (DE3), can enhance the resistance of Escherichia coli to phage infection, showing the potential to be used as a target for transforming different bacteria to resist phage infection, and having excellent characteristics of broad-spectrum resistance to phage infection.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a Gp21 protein encoded by a Pseudomonas aeruginosa phage and application thereof in inhibiting Escherichia coli phage infection. Background Art

[0002] Phage contamination has always been a major hidden danger in the safe production of fermented food. Phage (especially "lytic phage") is a bacterial virus that can specifically infect and efficiently kill fermentation strains and is not easy to develop resistance. Phages can affect the microbial fermentation process that uses bacteria or bacteria as products. Once the fermentation strain is infected by phage, it will lose its fermentation performance, resulting in fermentation failure. However, phage contamination has always been a global technical problem that has plagued the food fermentation industry. Phage infection during the fermentation process can lead to a decrease in the yield of fermented products, or even cause the factory to stop production or even go bankrupt, ultimately causing serious economic losses. Therefore, controlling and eliminating phage contamination during the fermentation process has become an urgent need in the production practice of the food fermentation industry.

[0003] In order to avoid phage infection, many defense measures such as reasonable factory design, phage disinfection of production environment, and transformation and optimization of fermentation strains have been proposed and applied. However, food fermentation factories are not sterile environments, and phages are widely present. No matter how the sanitary conditions and management level of the laboratory or factory are improved, phage infection of fermentation strains still occurs from time to time, making the probability of completely eliminating phages almost zero; although rotating strains can reduce the risk of phage infection, this method is cumbersome to operate and has high investment costs, so the problem of frequent infection of fermentation strains by phages is difficult to be completely solved. With the continuous deepening of research, the selection or transformation of phage-resistant fermentation strains has become a hot topic for scientists. Although it has been reported that bacteria can acquire resistance to phages through various mechanisms such as adsorption inhibition, injection blockade, restriction modification system, abortive infection, and adaptive immunity, and strategies such as using genetic engineering technology to construct abortive infection systems and CRISPR-Cas immune systems to give bacteria phage resistance have been derived. However, phages can quickly adapt to these phage resistance systems through mutations; in addition, many discovered resistance functional elements have not been verified to have broad-spectrum anti-phage properties, which limits the application of resistance functional elements in the transformation of fermentation engineering bacteria.

[0004] Recent studies have shown that phage proteins play an important role in promoting host resistance to phage infection, such as the Aqs1, BD24-4 and Tip proteins encoded by phages. However, the reported Aqs1, JBD24-4 and Tip proteins are all derived from lysogenic phages, and it is not clear whether lytic phage proteins can also mediate bacterial resistance to phage infection. Lytic phages are generally able to complete adsorption, invasion, proliferation, assembly and lysis in a short period of time, which is the main factor causing industrial fermentation failure. Therefore, the discovery of lytic phage-source encoded products as resistance elements provides an important theoretical basis and methodological basis for the future development and design of new anti-phage solutions, stable, safe and long-term application in the food fermentation industry, and breaking through the technical bottleneck of phage infection prevention and control. Summary of the invention

[0005] The present invention provides a Gp21 protein encoded by a lytic Pseudomonas aeruginosa phage. The expression of the protein in a non-original host bacterium, Escherichia coli BL21 (DE3), can enhance the resistance of Escherichia coli to infection by different phages, and shows the potential to be used as a target for transforming different bacteria to resist phage infection. The protein is the first product encoded by a lytic phage source discovered so far, and has excellent properties of broad-spectrum resistance to phage infection.

[0006] The technical solution adopted by the present invention to solve the technical problem is:

[0007] A Gp21 protein encoded by a Pseudomonas aeruginosa phage, the amino acid sequence of which is shown in SEQ ID NO. 1. The Gp21 protein is encoded by a lytic phage and can give different host strains resistance to phage infection.

[0008] The Gp21 protein encoded by the Pseudomonas aeruginosa phage of the present invention can give Escherichia coli the ability to resist phage infection, and has excellent characteristics of broad-spectrum resistance to phage infection. The present invention expands the existing understanding of anti-phage systems or anti-phage functional elements, and provides new ideas for the development of biotechnology and anti-phage contamination in fermentation processes.

[0009] A gene encoding the protein, the nucleotide sequence of the gene is shown as SEQ ID NO.2.

[0010] An application of the Gp21 protein encoded by the Pseudomonas aeruginosa phage of the present invention in inhibiting Escherichia coli phage infection.

[0011] Preferably, the Escherichia coli phage is a phage of the family Longicaudae or a phage of the family Myociudadae. Further, the phage of the family Myociudadae may be a phage of the family Myociudadae such as T4, vB_Eco M_IME281, vB_Eco M_IME338, vB_Eco M_IME339, vB_Eco M_IME340, vB_Eco M_IME341, and the phage of the family Longicaudae may be a phage of the family Longicaudae such as T1, vB_Eco S_IME18, vB_Eco S_IME253, vB_Eco S_IME347, JMPW1, etc.

[0012] An application of the Gp21 protein encoded by the Pseudomonas aeruginosa phage of the present invention in inhibiting Escherichia coli phage infection.

[0013] A method for improving the anti-phage ability of Escherichia coli, the method comprising: over-expressing a gene with a nucleotide sequence as shown in SEQ ID NO.2 in Escherichia coli,

[0014] Either an expression vector containing a gene with a nucleotide sequence such as that shown in SEQ ID NO.2 is transferred into E. coli, or a single copy or multiple copies of a gene with a nucleotide sequence such as that shown in SEQ ID NO.2 are integrated into the E. coli genome.

[0015] Preferably, the Escherichia coli is Escherichia coli BL21 (DE3).

[0016] Preferably, the Escherichia coli uses pET series as expression vectors, and the pET series vectors include pET28a(+), pET21a, and pET30a.

[0017] The invention discloses an application of Escherichia coli BL21 (DE3) obtained by the method of the invention in inhibiting Escherichia coli phage infection in industrial fermentation.

[0018] The invention discloses an application of the gene of the invention as a target in screening drugs related to inhibiting Escherichia coli phage infection.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention discovers for the first time that the Gp21 protein encoded by the lytic phage can protect different hosts from phage infection. The expression of the Gp21 protein in the original host bacteria Pseudomonas aeruginosa PAO1 can help PAO1 resist infection by Pseudomonas aeruginosa phage. In the non-original host bacteria Escherichia coli BL21 (DE3), the expression of Gp21 can also help Escherichia coli resist phage infection, that is, Gp21 has a broad-spectrum anti-phage performance, and is expected to be used as a target for the future fermentation engineering strain chassis cell transformation, solving the technical bottleneck of frequent phage infection in industrial fermentation production. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their description are used to explain the present invention and do not constitute improper limitations on the present invention.

[0022] Figure 1 is a schematic diagram of plasmid pET28a(+), which contains the gp21 gene encoded by the genome of a lytic Pseudomonas aeruginosa phage;

[0023] Figure 2 SDS-PAGE of protein expression of E. coli BL21 (DE3) (gp21). M: Marker; 1: pET28a-gp21 plasmid of E. coli BL21 (DE3), without IPTG induction; 2: pET28a-gp21 plasmid of E. coli BL21 (DE3), induced by IPTG. The arrow points to the target band;

[0024] Figure 3 The graphs show the results of the bacteriophage resistance experiment of Escherichia coli BL21 (DE3) (gp21) at 37°C without IPTG induction and at 37°C with 0.5 mM IPTG induction for 30 min. DETAILED DESCRIPTION

[0025] The technical solution of the present invention is further described in detail below through specific embodiments. It should be understood that the implementation of the present invention is not limited to the following embodiments, and any form of modification and / or change made to the present invention will fall within the protection scope of the present invention.

[0026] In the present invention, unless otherwise specified, all parts and percentages are by weight, and the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following embodiments are all conventional methods in the art unless otherwise specified.

[0027] The strains involved in the test of the present invention are:

[0028] Escherichia coli phage vB_EcoM_IME338 was deposited on August 30, 2018 at the General Microbiology Center of China Microorganism Culture Collection Committee (referred to as CGMCC, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101, China), with the deposit number CGMCC No.16292; the deposit number of Escherichia coli phage vB_EcoM_IME281 is CGMCC No.16291; the deposit number of Escherichia coli phage vB_EcoM_IME339 is CGMCC No.16293;

[0029] Escherichia coli BL21 (DE3) was purchased from Beina Biotechnology with the product number BNCC353806.

[0030] LB liquid medium, Qingdao Haibo Biotechnology Co., Ltd.;

[0031] Isopropyl-β-Dl-thiogalactoside (IPTG), Beijing Solaibao Technology Co., Ltd.

[0032] In one embodiment of the present invention, a gene related to the production of the target product is connected to an expression vector, which is then transferred into a host cell to obtain a recombinant bacterium, and the recombinant bacterium is tested for its anti-phage infection performance after inducing the expression of the recombinant protein.

[0033] The present invention provides a recombinant host cell, which contains the above expression vector or a chromosome in which a single copy or multiple copies of the exogenous gp21 gene are integrated.

[0034] The present invention provides a recombinant bacterium, or the expression vector, or the method for improving the anti-phage ability of Escherichia coli and its application in producing a target product.

[0035] Example 1 Construction of pET28a plasmid containing gp21 gene

[0036] The gp21 gene sequence with homology arm ends was artificially synthesized. The gp21 gene upstream had a homology arm sequence ACAGCAAATGGGTCGCGGATCC (containing a BamHI restriction enzyme site) (SEQ ID NO.3), and the downstream had a homology arm sequence GTGGTGGTG GTGGTGCTCGAGT (containing a XhoⅠ restriction enzyme site) (SEQ ID NO.4). The chemical synthesis of the gp21 gene sequence was completed by Shanghai Bioengineering Co., Ltd. By In-Fusion splicing, the gp21 fragment was connected to the linear vector pET28a obtained by digestion with BamHI and XhoⅠ to obtain the recombinant plasmid pET28a-gp21 ( Figure 1 ).

[0037] Example 2 Heterologous expression of the anti-phage defense element Gp21 in Escherichia coli

[0038] The recombinant plasmid pET28a-gp21 was transferred into Escherichia coli DH5α for screening of positive clones, and the resistance to kanamycin was screened; the obtained positive single clone was activated and inoculated into 10 mL LB broth medium (containing 50 μg / mL kanamycin) and cultured with shaking at 200 r / min at 37°C overnight. After the bacterial liquid was collected, the recombinant plasmid was extracted using the Sangon EZ-10 column plasmid small-scale extraction kit, and the recombinant plasmid pET28a-gp21 was further transformed into Escherichia coli BL21 (DE3). E. coli BL21 (DE3) bacteria transformed with expression plasmid pET28a-gp21 were inoculated in a test tube containing 5 mL LB and cultured overnight at 37°C, 200 rpm. The next day, the cells were transferred to fresh LB medium at a ratio of 1:100 and continued to be cultured at 30°C, 200 rpm until OD600nm was 0.6, and then IPTG with a final concentration of 0.5 mM was added to induce at 25°C for 12 hours. The cells were collected by centrifugation, and after the cells were broken by a high-pressure crusher at 4°C, the protein was purified by Ni column, and the free imidazole was removed by dialysis. Finally, the protein was stored in a desalting buffer containing 10% glycerol, and subsequent SDS-PAGE analysis was performed to determine whether the Gp21 protein could be successfully heterologously expressed.

[0039] The results are as follows Figure 2 As shown: SDS-PAGE separation revealed obvious differential bands after IPTG induction, and the size of the protein band position was close to the theoretical molecular weight of Gp21 protein (11KDa), which indicated that Gp21 protein was successfully heterologously expressed in Escherichia coli BL21DE3).

[0040] Example 3 Application of Gp21 protein in helping Escherichia coli BL21 (DE3) resist phage infection

[0041] A single colony of the expression strain BL21 (DE3) (gp21) was picked up in a test tube containing 5 mL LB medium (containing 50 μg / mL kanamycin) and cultured overnight at 37°C, 200 r / min. The next day, the overnight cultured bacteria were transferred to 100 mL of fresh LB medium at a 1% inoculation amount and continued to be cultured at 37°C, 200 rpm for 3 hours. At this time, the bacterial cells grown to the logarithmic phase were divided into two equal parts and treated in different ways, namely, a control group without the inducer IPTG and an experimental group induced by 0.5 mM IPTG for 30 minutes. Combined with the phage plaque assay, the Gp21 element was detected to confer the host Escherichia coli the ability to resist phage infection. The specific steps are as follows: take 100 μL of the above-treated BL21 bacterial solution (induced group and non-induced group), add them into 5 mL of LB semi-solid culture medium respectively, mix evenly, spread them on the plate containing the lower layer of LB solid culture medium, and dry them at room temperature for 5 minutes; after gradient dilution of the Escherichia coli phage vB_EcoM_IME338, vB_EcoM_IME340, vB_EcoM_IME341, vB_EcoM_IME347, and vB_EcoM_IME39 preservation solution, take 3 μL and drop it on the bacterial layer culture medium. After culturing at 37°C for 8 hours, observe the transparency of the phage plaques.

[0042] The results are as follows Figure 3 As shown in the figure: Although different phages have different infection efficiency or plaque formation efficiency on the host Escherichia coli BL21 (DE3), in general, the phage plaques formed by the group without IPTG induction are clear and transparent, while the phage plaques formed by the experimental group induced by IPTG are smaller and less transparent than those of the control group. There is a significant difference in the plaque formation ability between the two groups, which indicates that the expression of Gp21 can significantly enhance the resistance of Escherichia coli BL21 (DE3) to infection by different phages.

[0043] In this specification, each embodiment is described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the embodiments can be referred to each other. For the device disclosed in the embodiment, since it corresponds to the method disclosed in the embodiment, the description is relatively simple, and the relevant parts can be referred to the method part.

[0044] The Gp21 protein encoded by the Pseudomonas aeruginosa phage provided by the present invention and its application in inhibiting Escherichia coli phage infection are introduced in detail above. Specific examples are used herein to illustrate the principles and implementation methods of the present invention, and the description of the above embodiments is only used to help understand the method of the present invention and its core idea. It should be pointed out that for those of ordinary skill in the art, without departing from the principles of the present invention, the present invention can also be improved and modified in a number of ways, and these improvements and modifications also fall within the scope of protection of the claims of the present invention.

Claims

1. A use of a Gp21 protein encoded by a Pseudomonas aeruginosa phage in inhibiting Escherichia coli phage infection, wherein the amino acid sequence of the Gp21 protein is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The Escherichia coli phage is a phage of the family Longicaudae or a phage of the family Myoacaudae.

3. A method for improving the anti-phage ability of Escherichia coli, characterized in that: The method comprises the following steps: over-expressing a gene encoding Gp21 protein whose nucleotide sequence is shown as SEQ ID NO.2 in Escherichia coli.

4. A method for improving the anti-phage ability of Escherichia coli, characterized in that: The method comprises the following steps: transferring an expression vector containing a gene with a nucleotide sequence as shown in SEQ ID NO.2 into Escherichia coli.

5. A method for improving the anti-phage ability of Escherichia coli, characterized in that: The method comprises the following steps: integrating a single copy or multiple copies of a nucleotide sequence such as a gene shown in SEQ ID NO.2 into the genome of Escherichia coli.

6. The method according to claim 3, 4 or 5, characterized in that: The Escherichia coli is Escherichia coli BL21 (DE3).

7. The method according to claim 3, 4 or 5, characterized in that: The Escherichia coli uses the pET series as expression vectors, and the pET series vectors include pET28a(+), pET21a, and pET30a.

8. Use of Escherichia coli BL21 (DE3) obtained by the method according to claim 3, 4 or 5 in inhibiting Escherichia coli phage infection in industrial fermentation.

Images