A novel fusion protein, gene, recombinant vector, host cell and application for immunotherapy

By linking the IL-23P40 subunit to the PD-1 fragment via a Pro-rich linker, a heterodimeric fusion protein is formed, which solves the selectivity and safety issues of existing fusion proteins in tumor treatment, and enhances the anti-tumor function of T cells, especially the killing effect in lung cancer and esophageal cancer cells.

CN116143946BActive Publication Date: 2025-12-09CYTOCRAFT BIOPHARMACEUTICAL CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211654593.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2022-01-05
Filing Date
2022-12-22
Publication Date
2025-12-09
Estimated Expiration
2042-12-22

AI Technical Summary

Technical Problem

Existing immune checkpoint and cytokine fusion proteins have insufficient initiation selectivity and safety issues in tumor therapy, which may lead to significant toxicity due to excessive T cell response.

Method used

A fusion protein was designed, consisting of an IL-23P40 subunit fragment and a PD-1 fragment linked by a Pro-rich linker to form a heterodimer structure. The P19 subunit was expressed only after T cell activation, and in combination with anti-PD-L1, the anti-tumor performance of T cells was enhanced. The fusion protein was produced in a mammalian cell system using a lentiviral expression vector.

Benefits of technology

This study achieved selective functional expression of the fusion protein in T cells, reduced the risk of T cell overreaction, and improved anti-tumor efficacy, especially the killing ability in lung cancer and esophageal cancer cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116143946B_ABST
    Figure CN116143946B_ABST
Patent Text Reader

Abstract

The application provides a novel fusion protein, gene, recombinant vector, host cell and application for immunotherapy. The fusion protein provided by the application is a fusion protein formed by connecting an IL-23P40 subunit fragment and an immune checkpoint PD-1 fragment through a linker. The amino acid sequence of the fusion protein is shown in SEQ ID NO:1 or SEQ ID NO:3. The novel fusion protein for immunotherapy of the application is constructed by combining a cytokine IL-23P40 subunit and an immune checkpoint PD-1 blocking. The P19 subunit is highly expressed in activated T cells, the P40 subunit of the fusion protein can form IL-23 with the P19 subunit, thereby enhancing the function of T cells, and combining anti-PD-L1 to improve the anti-tumor performance.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of fusion proteins, and particularly relates to a novel fusion protein for immunotherapy, a gene, a recombinant vector, a host cell and application. BACKGROUND

[0002] Cytokines have a wide range of anti-tumor activity, and a variety of cytokines have been used for cancer treatment. There are several FDA-approved cytokine drugs, such as high-dose IL-2 for treating melanoma and renal cell carcinoma, and IFN-α for adjuvant therapy of stage III melanoma. More cytokines have entered the clinical trial stage, such as GM-CSF, IL-7, IL-12, IL-15, IL-18 and IL-2.

[0003] Immune checkpoints refer to some inhibitory signal pathways existing in the immune system. In the case of normal anti-tumor immune response, the balance between co-stimulatory signals and co-inhibitory signals is maintained to maintain immune tolerance by regulating the strength of the immune response. When the body is invaded by tumors, the immune checkpoint signal pathway is usually blocked to inhibit the body's own immune response, providing opportunities for tumor cell growth and escape. How to determine the effective target in each pathway and develop corresponding anti-tumor drugs has become an important task and direction of tumor treatment in recent years.

[0004] PD-1 is a member of the CD28 family, expressed on the surface of activated T cells. Its function is to inhibit T cell response by binding to the ligand PD-L1, prevent T cell overreaction from causing tissue damage, and is a negative regulation mechanism of normal T cell response. Tumor cells express high levels of PD-L1, which binds to PD-1 on the surface of T cells, inhibiting anti-tumor T cells from killing them, which is an important mechanism of tumor immune escape. Scientists have invented an anti-PD-1 antibody that can block the binding of PD-L1 on the surface of tumor cells to the PD-1 receptor on the surface of T lymphocytes, relieving the inhibition of T lymphocytes by tumor cells. The functionally restored T lymphocytes can kill tumor cells and clear the body of tumors. This is the anti-PD-1 antibody, which is currently an internationally popular tumor treatment drug.

[0005] The patent application for invention with international publication number WO 2021 / 092719A1 relates to a fusion protein targeting antigen-specific T cells to induce their differentiation into memory stem cells, which belongs to a fusion protein of an anti-PD-1 antibody and IL-21. It can not only block the binding of PD-L1 to the surface PD-1 of T cells and play the tumor treatment role of anti-PD-1 antibody, but also target IL-21 to tumor-specific T cells to induce the differentiation of T cells and regulate T cell function, so as to improve the tumor treatment effect of PD-1 antibody. The above patent focuses more on the application of fusion proteins of cytokines and immune checkpoints in monomeric proteins or homodimeric proteins, and the initiation lacks regulation and selectivity, which may cause significant toxicity. SUMMARY

[0006] The purpose of the present application is to provide a novel fusion protein for immunotherapy, which has good anti-tumor performance and has initiation selectivity, and is safer.

[0007] The second purpose of the present application is to provide a gene encoding the above-mentioned fusion protein.

[0008] The third purpose of the present application is to provide a recombinant vector comprising the above-mentioned gene.

[0009] The fourth purpose of the present application is to provide a host cell into which the above-mentioned gene or recombinant vector is introduced.

[0010] The fifth purpose of the present application is to provide the use of the above-mentioned fusion protein, recombinant vector or host cell in the preparation of an anti-tumor drug.

[0011] In order to achieve the above purposes, the technical scheme adopted by the present application is:

[0012] The present application provides a fusion protein, which is a fusion protein formed by connecting an IL-23P40 subunit fragment and an immune checkpoint PD-1 fragment through a linker.

[0013] Preferably, the amino acid sequence of the IL-23P40 subunit fragment is shown in SEQ ID NO: 1 1-328; the amino acid sequence of the PD-1 fragment is shown in SEQ ID NO: 1 342-488;

[0014] Preferably, the linker is a Pro-rich linker or a GS linker;

[0015] More preferably, the amino acid sequence of the fusion protein comprises:

[0016] a. the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3; or

[0017] b. a modified amino acid sequence obtained by modifying the side chain group, the amino terminal or the carboxyl terminal of the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3 with hydroxylation, carboxylation, carbonylation, methylation, acetylation, phosphorylation, esterification and / or glycosylation.

[0018] The novel fusion protein for immunotherapy of the present application is constructed by combining the cytokine IL-23 P40 subunit with the immune checkpoint PD-1 blocking, and the P19 subunit is highly expressed in activated T cells, and the P40 subunit of the fusion protein can form IL-23 with the P19 subunit, thereby enhancing the function of T cells, and combining anti-PD-L1 to improve the anti-tumor performance.

[0019] Interleukin-23 (IL-23) is a hematopoietic cytokine with a heterodimeric structure discovered in 2000, which is composed of two subunits p40 and p19, and shares the P40 subunit with IL-12 in structure.

[0020] Different existing immune checkpoints form fusion proteins with cytokines, and the cytokine part is generally a monomer or homodimer, and the function is not selective. In the present application, the fusion protein can only form a complete cytokine and play a function after the other subunit (P19 subunit, commonly found in activated T cells) is up-regulated, which has functional selectivity, reduces T cell overreaction, and is safer.

[0021] In addition, the linker of the fusion protein is also optimized in the present application to enhance the application effect. Specifically, the Pro-rich linker used in SEQ ID NO: 1 has better application effect than the GS linker used in SEQ ID NO: 3.

[0022] The present application also provides a gene encoding the above-mentioned fusion protein, which is used to encode the above-mentioned fusion protein.

[0023] Preferably, the gene encoding the fusion protein as shown in SEQ ID NO: 1 is as shown in SEQ ID NO: 2, and the gene encoding the fusion protein as shown in SEQ ID NO: 3 is as shown in SEQ ID NO: 4. The encoding gene can be used to conveniently and effectively obtain the above-mentioned fusion protein or for the modification of T cells.

[0024] The present application also provides a recombinant vector containing the above-mentioned gene. The recombinant vector can be used to produce the fusion protein or for the modification of T cells.

[0025] The recombinant vector can be used to construct a mammalian cell system, thereby conveniently and effectively producing the fusion protein.

[0026] Preferably, the recombinant vector is a lentiviral expression vector, and the lentiviral expression vector is used to facilitate the preparation of CAR-T cells.

[0027] Further preferably, the lentiviral expression vector contains a CAR276-BBz fragment or a CARmeso-BBZ fragment, the nucleotide sequence of the CAR276-BBz fragment is shown as SEQ ID NO: 7, and the nucleotide sequence of the CARmeso-BBZ fragment is shown as SEQ ID NO: 12. The lentiviral expression vector has strong targeting ability and good effectiveness on tumors.

[0028] The application also provides a host cell into which the above gene or the above recombinant vector is introduced.

[0029] The host cell can enhance the function of T cells and can be used for tumor treatment. Preferably, the host cell is a T cell or a CAR-T cell.

[0030] The application also provides the use of the above fusion protein, recombinant vector or host cell in the preparation of one or more of the following preparations:

[0031] anti-tumor drugs;

[0032] immunotherapeutic drugs; and / or

[0033] preparations for promoting the function of T cells.

[0034] Preferably, the tumor is lung cancer or esophageal cancer. Experiments have proved that the above drugs have good killing ability on lung cancer or esophageal cancer cells, so in the field it can be proved that such drugs can be used for the immunotherapy of such tumors, and have good application prospect for the treatment of solid tumors. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 Effects of different transient supernatants on T cell function markers in the application;

[0036] Figure 2 Effects of different linkers on the functional activity of fusion proteins in the application;

[0037] Figure 3 Effects of different treatments on T cell function in the presence or absence of PD-L1 Fc fragments in the application;

[0038] Figure 4 Effects of different treatments on T cell proliferation in the presence or absence of PD-L1 Fc fragments in the application;

[0039] Figure 5Figure for killing effect of different CAR-T cells on H322 lung cancer cell line and KYSE150 esophageal cancer cell line;

[0040] Figure 6 Figure for detection result of analyzing cytokine of different CAR-T cells;

[0041] Figure 7 In vivo experiment effect of different CAR-T cells;

[0042] Figure 8 Inhibition effect of different CAR-T cells on tumor. DETAILED DESCRIPTION

[0043] In the present application, the subunit of the cytokine composed of heterodimer is selected as part of the fusion protein, and the natural cytokine can be formed through one of the subunits, and the other subunit has stronger function. And the limitation of the other subunit makes the fusion protein closely contact with T cells to avoid causing significant toxicity.

[0044] The implementation process of the present application will be described in detail below in combination with specific examples. The main materials and reagents involved in the following examples and experimental examples are described as follows:

[0045] Healthy human peripheral blood from Henan Red Cross Blood Center;

[0046] Lung cancer cell line H322 and human embryonic kidney cell 293T, Hela cell line, KYSE150 cell line, 293T cell line, purchased from Shanghai Cell Library of Chinese Academy of Sciences;

[0047] Competent E. coli DH5α, competent E. coli Tstbl3, purchased from Beijing Genki Biotechnology Co., Ltd.; DMEM high-sugar culture medium, RPIM1640 culture medium, PBS buffer, protease inhibitor, phosphatase inhibitor DMSO (dimethyl sulfoxide), PMSF (phenylmethylsulfonyl fluoride), etc. are all products of Sigma Company in the United States;

[0048] Opti-MEM medium, fetal bovine serum, etc. are products of Gibco Company in the United States;

[0049] x-vivo15 culture medium, product of LONZA Biotechnology Company in Switzerland;

[0050] Human peripheral blood lymphocyte separation medium, product of Tianjin Haoyanghua Biological Technology Co., Ltd.;

[0051] Human CD8 microbeads, Human CD3 microbeads, MACS buffer, T cell TransAct T cell activation beads, magnetic sorting LS column, products of Miltenyi Biotec, Germany;

[0052] RIPA lysis buffer, product of Biyun Tian Biotechnology Co., Ltd., Shanghai, China;

[0053] RNAiso Plus, product of Thermo, USA;

[0054] Reverse transcription kit, Gt-551 medium, EcoR I restriction enzyme, BamHI restriction enzyme, products of Hoshino Bio, Japan;

[0055] Immunohistochemical kit, product of Beijing Zhongsu Jinqiao Biotechnology Co., Ltd.;

[0056] Protein electrophoresis gel kit, product of Beijing Dakewe Biotechnology Co., Ltd.;

[0057] One-step directional cloning kit, product of Shanghai Jinshanjian Technology Co., Ltd.;

[0058] DNA gel recovery kit, product of Axygen, USA;

[0059] ELISA kit, product of Hangzhou Link Biological Technology Co., Ltd.;

[0060] Calcium transfer kit (CalPhos TM Mammalian Transfection Kit User Manual), product of Takara;

[0061] 100× penicillin-streptomycin mixture, trypsin powder, 0.25% trypsin digestion solution, 0.05% trypsin digestion solution, 20× TBST, 50× TAE buffer, etc., products of Solabio Technology Co., Ltd., Beijing, China;

[0062] Recombinant human IL-2, CD28 monoclonal antibody, CD3 monoclonal antibody, Annexin V binding buffer, 10x membrane breaking agent, PE-anti-human CD69, APC-CY7 anti-human CD8, APC anti-human Ki67, APC-A700 anti-human TNF-A, Percp anti-human GranzymeB, FITC anti-human IFN-G, APC anti-human IL-2, APC-A700 anti-human Perforin, PE-Anti-human CD137 (4-1BB), PE-cy7-Anti-human IFN-γ, APC-Anti-human CD107a, APC-cy7-Anti-human CD25, APC-cy7-Anti-human CD4 RO FITC-Anti-human CCR7, AF700-Anti-human / mouse Granzyme B, etc., all products of biolegend company in the United States;

[0063] Peprotech recombinant human IL-23 2 μg package;

[0064] Recombinant Fc fragment of PD-L1, Yiqiao Shenzhou;

[0065] SYBER Green fluorescent quantitative premix, product of BCS company in Australia;

[0066] NC membrane, product of GE company in the United States;

[0067] PE anti-PLPP1, Wuhan Bo'ou Biological Technology Co., Ltd.;

[0068] 10% FBS-DMEM high-sugar complete medium, 10% FBS-RPIM1640 complete medium, cell freezing solution, protein lysis solution, electrophoresis solution, membrane transfer solution, 1x TBST buffer, Western blocking solution, 5% BSA solution, etc. can be prepared according to existing technology. Flow buffer containing 2% serum is prepared with PBS according to conventional method;

[0069] Main instruments and equipment:

[0070] PCR instrument, gel imaging system, product of Bio-Rad company in the United States;

[0071] DxFLEX flow analysis system, Moflo-XDP high-speed flow sorting system, product of Beckman Coulter company in the United States;

[0072] IVIS live imaging system, product of PerkinElmer, USA;

[0073] Miltenyi magnetic sorting magnetic field, product of Miltenyi, Germany.

[0074] Fusion protein, encoding gene of Example 1

[0075] The novel fusion protein for immunotherapy of this example has an amino acid sequence as shown in SEQ ID NO: 1, and the connecting peptide is Pro-rich linker, with an amino acid sequence of papap. The nucleotide sequence of the gene encoding the above fusion protein is shown in SEQ ID NO: 2.

[0076] Fusion protein, encoding gene of Example 2

[0077] The novel fusion protein for immunotherapy of this example has an amino acid sequence as shown in SEQ ID NO: 3, and the connecting peptide is GS linker, with an amino acid sequence of ggggsggggs. The nucleotide sequence of the gene encoding the above fusion protein is shown in SEQ ID NO: 4.

[0078] Recombinant vector, method for obtaining fusion protein of Example 3

[0079] The recombinant vector of this example clones the gene with the sequence shown in SEQ ID NO: 2 to a mammalian expression vector.

[0080] 3.1 The construction method of the above recombinant vector (fp40 plasmid) is as follows:

[0081] First, the gene sequence of human IL-23 P40 subunit was queried from the NCBI website respectively, and according to the high affinity sequence of the mutant PD-1, the proline-rich linker PAPAP was selected for the connection between the protein domains, and the start and stop codons were added to obtain the sequence.

[0082] Then, cloning was performed on the mammalian expression vector pcDNA3.1(-), and based on the needs of subsequent experiments, the enzyme digestion site was selected as XhoI / EcoRI, the above ligation product was transformed into Stabl3 competent cells, and cultured overnight, and single colonies were picked for sequencing verification, and the strain with correct sequence was selected, expanded and cultured to extract plasmid, or frozen for standby.

[0083] 3.2 The method for obtaining the above fusion protein: using the expression vector of this example to transfect 293T cells, protein expression and purification were performed. The specific steps are as follows:

[0084] (1) Passage of 293T

[0085] 293T cell culture and passage: TC culture flask (Nest blue cap) and complete culture medium are used; the culture medium is restored to room temperature before use; during the culture process, attention should be paid to not let the 293T cells grow too much (high cell fusion degree or clump growth), otherwise the transfection will be affected; when the cell fusion degree is 60%-80%, digestion and passage are carried out; 0.05% trypsin (Gibco) is used during digestion; according to the cell fusion degree, 1:3-1:5 passage is carried out, and the remaining cells should not be too few, otherwise the cell state will be affected; during the culture process, attention should be paid to observe the cell state (the cell state is good when the cell growth is vigorous and the morphology is stretched); and the cell detachment should be avoided during the operation.

[0086] (2) Transient transfection of plasmid

[0087] Cell plating: according to the cell state, 293T cells are inoculated into a 6-well plate (Nest) 18-24 h in advance (to ensure that the cell fusion rate reaches about 60% when transfection is carried out) 6x10 5 Cell amount, 3 ml of DMEM culture medium containing 10% serum per dish, a total of two six-well plates; attention should be paid to whether the incubator is placed horizontally during plating, and if it is not placed horizontally, it will lead to uneven cell growth and affect virus production; the cells should be moved as little as possible or the incubator should be opened and closed as gently as possible within 6 h after plating;

[0088] Cell medium change: the next morning, the cells are observed, and if the cell state is good, the growth is uniform, and the fusion degree is 60%-70%, the transfection culture medium (the old culture medium is completely aspirated as much as possible) is changed, otherwise the cells are allowed to grow for a period of time; 2 ml of transfection culture medium (DMEM-high glucose culture medium (Sigma), containing 5%-10% FBS and 25 μM chloroquine diphosphate (MCE)) is added per dish;

[0089] Transfection: after 2 h of transfection medium change, transfection is prepared; the transfection reagent is restored to room temperature before use; A liquid is prepared: (1.5 μg of plasmid, 12.4 μl of 2M CaCl2, and the balance is sterile water to 100 μl) and B liquid (2x HEPES) 100 μl; after B liquid is added to A liquid and mixed, it is incubated at 22°C for 15 min; after mixing by gently blowing, it is uniformly added to the surface of the cells to be transfected (without touching the cells); after being added to the cells, it is confirmed under a microscope whether a precipitate is formed; the operation should be rapid to avoid the cells staying in room temperature for too long;

[0090] End of transfection: after 6 h of transfection, the medium is changed; after the supernatant is gently aspirated, the complete culture medium is carefully added to avoid cell detachment; the complete culture medium should be restored to room temperature before use; the operation should be rapid to avoid the cells staying in room temperature for too long;

[0091] The transfection supernatant (containing the fusion protein) was collected 24 hours after the transfection medium was changed, centrifuged at 2000r for 10 minutes to remove cell debris, and stored at 4°C until use.

[0092] Protein purification steps:

[0093] 1. Plasmid expression: P19-His and P40-PD-1-Flag (fP40) in pcDNA3.1(-) vector were expressed in CHO eukaryotic expression system, following the conventional operation steps. CHO cells were cultured in a 37°C incubator with a CO2concentration of 8%. One day before transfection, the cells were inoculated into the plates at an appropriate density. On the day of transfection, the cell state was observed, the DNA was mixed with the transfection reagent at the optimal ratio, and the mixture was added to the plates ready for transfection. The recombinant plasmid encoding the target protein was transiently transfected into a 30-ml suspension containing CHO cells. The cell density and viability were detected on the 5th, 7th, and 9th days after transfection. The cell culture supernatant on the 5th, 7th, and 9th days after transfection was used to verify protein expression.

[0094] 2. Protein expression analysis and purification: The cell culture supernatant on the 5th, 7th, and 9th days after transfection was collected for protein expression analysis by SDS-PAGE and Western blot. The cell culture supernatant was collected on the 10th day after transfection for protein purification. The concentrated supernatant was filtered through a 0.2-μm membrane at a speed of 2 ml / min and then injected into a HisTrap FF column, followed by washing and elution with appropriate buffers. The peak fractions were mixed together, and the sample buffer was exchanged to PBS (pH 7.2). The gel filtration standard used in this purification was a lyophilized mixture of molecular weight markers from Bio-Rad, ranging from 1350 KD to 670,000 KD. It is a calibration standard for gel filtration / size exclusion chromatography (SEC) columns used in non-denaturing conditions for protein purification and analysis, suitable for gels with exclusion limits of approximately 60,000 to 5,000,000 daltons. This mixture contains thyroglobulin, gamma globulin, ovalbumin, myoglobin, and vitamin B12. Both vitamin B12 and myoglobin are visible when applied to the column, ensuring that the column is properly packed and that the sample is eluted uniformly. TM

[0095] Example 4 Application of the fusion protein in promoting T cell function

[0096] This example describes experiments on the application of the fusion protein in promoting T cell function, and the relevant general experimental procedures are briefly described as follows.

[0097] (1) Isolation of peripheral blood mononuclear cells

[0098] ​Take 10ml peripheral blood, 500g, 22°C centrifugation for 5min, after absorbing the plasma (or-80°C storage for standby), dilute with 1 times volume of PBS for standby;

[0099] Take a 50ml centrifuge tube, add 20ml lymphocyte separation medium, blow the above diluted peripheral blood evenly and add gently to the upper layer of lymphocyte separation medium;

[0100] 22°C, 1100g centrifugation for 25min, after centrifugation, carefully suck the lymphocyte layer, add the same volume of PBS (as the lymphocyte layer sucked), 1800rpm centrifugation for 5min to clean the cells; again discard the supernatant, and add 5ml of PBS to clean the cells once, centrifuge and discard the PBS, the obtained precipitate is peripheral blood mononuclear cells.

[0101] (2) Activation of CD3 + T cell sorting

[0102] Centrifuge the peripheral blood mononuclear cells (or tumor tissue single cell suspension) at 500g for 5min, then resuspend the cells with 3ml of MACs (Magnetic activated cell sorting) buffer, centrifuge at 500g for 5min; resuspend the cells with 3ml of MACs buffer and count again;

[0103] Add 10μl of human CD3 magnetic beads and 40μl of MACs buffer to 1×10 7 Cells, vortex mix, 4°C avoid light incubation for 15min, mix every 3min during the period;

[0104] After the last mixing, place the MS magnetic sorting column in the corresponding magnetic field, add 1ml of MACs buffer to rinse the column; after the above incubation operation is completed, add all the cells to the magnetic sorting column, and after the cells pass through the column completely, add 1ml of MACs buffer to remove the unbound cells, repeat twice;

[0105] After the liquid passes through the column completely, add 3ml of MACs buffer, and take the column out of the magnetic field, then use the piston to quickly hit the cells into a sterile centrifuge tube; after counting the cells, centrifuge at 500g for 5min and discard the liquid, resuspend with IL-2 containing RPIM1640 medium and plate, 3-5×10 7 Cells.

[0106] (3) T cell culture

[0107] Human CD3 +T cell line was cultured with RPIM 1640 medium containing 10% FBS + 1% mixed solution of penicillin-streptomycin and 200 IU IL-2. During the culture, the medium was replaced with half of the volume every other day for subculture:

[0108] The medium was restored to room temperature in a clean bench;

[0109] The upper layer of the medium was gently aspirated, and the adherent cells were avoided to be aspirated;

[0110] 1-2 ml of fresh RPIM 1640 medium containing 200 IU IL-2 was added, and the mixture was gently mixed.

[0111] 4.1 Promotion experiment of T cell function

[0112] After transfection with different plasmids according to the method in Example 3, the transfection supernatant containing the fusion protein was co-incubated with semi-activated CD3 + T cells, stimulated by CD3 / CD28 monoclonal antibodies, and the function markers such as CD25, CD137, and CD107a were detected by flow cytometry. The specific operation is as follows:

[0113] The sorted CD3 + T cells were re-counted and plated (1 12-well plate), 1×10 6 cells per well, resuspended in 0.5 ml of RPIM 1640, and 2 ml of each group of transfection supernatant stored at 4°C was added, 3 wells for each co-transfection supernatant, 5 μl of T cell activation beads was added to each well, and the culture was incubated in a 37°C incubator containing 5% CO2 for 24 h;

[0114] After 24 h of incubation in the incubator, the cells were centrifuged at 1800 r for 5 min, the culture medium supernatant was discarded, and the cells were washed twice with PBS containing 2% FBS and centrifuged. The cells were resuspended in 50 μl of the system, incubated with the antibody in the dark on ice for 30 min, washed once with flow buffer after the end of the incubation, centrifuged, resuspended in 200 μl of flow buffer, and subjected to flow cytometry.

[0115] The effects of each treatment group on T cell function markers are shown in Figure 1 . Figure 1 In the experiment, the experimental groups were as follows: vector transfection (vector); P19-His plasmid transfection (P19 subunit is one of the subunits of IL-23); fP40-flag plasmid transfection (fP40 plasmid of Example 3, Figure 1 P40-FLAG group); IL-23-PD-1 group (co-transfection of fP40 plasmid and P19-His plasmid of Example 3, molar ratio 1:1).

[0116] During the construction of the P19-His vector, the gene and protein sequences of the human IL-23P19 subunit were retrieved from the NCBI website. To facilitate protein expression detection, the common protein tag His-tag was added, and the P19-His gene fragment was synthesized. The nucleotide sequence of P19-His is shown in SEQ ID NO:5. The initial vector selected was pcDNA3.1(-). For specific construction methods, please refer to the above examples or related existing technologies.

[0117] Depend on Figure 1 It can be seen that the fusion protein in the cell transfection supernatant has a promoting effect on T cell function. Compared with other control groups, the T cell function of the fusion protein group is significantly enhanced, and this enhancement is limited to the formation of complete IL-23 cytokine.

[0118] 4.2 Comparison Experiment with Different Linkers

[0119] Isolation and activation of CD3 from peripheral blood mononuclear cells + For the steps of T cell sorting, T cell culture, 293T cell passage, transient plasmid transfection, co-incubation of T cells with supernatant containing fusion protein and detection of T cell functional markers, please refer to Part 4.1.

[0120] The fP40-GS linker plasmid was prepared according to the method in Example 3, and its fusion protein linker peptide was GS linker.

[0121] After transient transfection using different plasmids as described in Example 3, the transient transfection supernatant containing the fusion protein was mixed with semi-activated CD3. + T cells were co-incubated, and the cells were collected for flow cytometry analysis to detect functional markers such as CD137, CD69, and CD107a.

[0122] The effects of different linkers on T cell functional markers, such as Figure 2 As shown.

[0123] Figure 2 In the experiment, the groups were: GS linker group (fP40-GS linker plasmid and P19-His plasmid co-transfected at a molar ratio of 1:1) and pro-rich linker group (fP40-pro-rich linker plasmid and P19-His plasmid co-transfected at a molar ratio of 1:1).

[0124] Depend on Figure 2 It can be seen that, compared with the control group using the GS linker, the example using the Pro-rich linker enhanced the functional activity of the fusion protein.

[0125] Example 5 Recombinant vector (lentiviral expression plasmid), host cell (CAR-T cell)

[0126] The recombinant vector of the present example contains a nucleotide sequence as shown in SEQ ID NO: 6, which includes a CAR276-BBz fragment (nucleotide sequence as shown in SEQ ID NO: 7), a P2A sequence (nucleotide sequence as shown in SEQ ID NO: 8), and a fp-40 encoding gene (nucleotide sequence as shown in SEQ ID NO: 2; PAPAP linker).

[0127] 5.1 The lentiviral expression plasmid was constructed as follows:

[0128] First, the fP40 fusion protein sequence was amplified using the recombinant plasmid (fp40 plasmid) containing the fusion protein sequence in Example 3 as a template. The primer sequences for PCR amplification are as follows:

[0129] F: tggaggagaaccctggacctatgtgccaccagcagctg, as shown in SEQ ID NO: 9.

[0130] R: atccagaggttgattgtcgactagaacagatcgctagggtcc, as shown in SEQ ID NO: 10.

[0131] PCR amplification was performed using the above primers, and the PCR amplification product was subjected to electrophoresis and recovered to obtain a fragment of about 600 bp.

[0132] Then, the existing pCDH-EF1-myc-8H9S33(CD276)-BBz vector was subjected to XhoI / EcoRI double digestion, and a fusion protein-containing lentiviral plasmid (CAR276-BBz vector fragment encoding gene as shown in SEQ ID NO: 7) was constructed for the enzyme-digested vector fragment.

[0133] Then, the NovoRec one-step PCR cloning kit was used to link the above cloned fusion protein fragment and the XhoI / EcoRI double-digested linearized pCDH-EF1-myc-8H9S33(CD276)-BBz, and the linking product was transformed into Stabl3 competent cells, screened, and sequenced to ensure correct recombination (this is the fP40 fusion protein lentiviral plasmid). The plasmid was extracted from the strain with correct sequencing or frozen for standby use.

[0134] 5.2 The host cell (CAR-T cell) was constructed as follows:

[0135] First, when packaging lentivirus: well-grown 293T cells were plated in 10 cm cell culture dishes, 6 x 10 6 , culture overnight; the next day, observe the cells, if the cell state is good, uniform growth, fusion degree in 80%-90%, replace with 25 uM chloroquine phosphate containing transfection medium (old medium as much as possible completely absorbed);

[0136] In a 15 ml centrifuge tube, add sterile water and 10 ug of main plasmid (fP40 fusion protein lentivirus plasmid), 6.25 ug packaging plasmid PsPAX2, 1.875 ug packaging plasmid pMD2.G, 2M CaCl2 145ul, a total of 1170ul system; mix well, then add 1170ul 2M HEPES, mix well, then incubate at 22°C for 15 min;

[0137] The above transfection system is added to the previously described 293T cells, and the culture is continued for 6h; replace the fresh DMEM medium containing 10% FBS, continue to culture for 48h; 16°C, 3000rpm centrifugation for 10 min to remove cell debris, collect the supernatant, which is the packaged lentivirus.

[0138] Subsequently, the above lentivirus is used to infect T cells to prepare CAR-T cells, the specific operation is as follows:

[0139] Take CD3 + T cells from healthy human peripheral blood, resuspend to 3 x 10 6 / ml with T cell culture medium;

[0140] Add 10ul CD3 CD28 activation beads to 1 x 10 6 cells, mix well and plate in a 12-well cell culture plate, 2ml per well;

[0141] After 48h, collect the T cells, centrifuge at 1500rpm for 5min, discard the supernatant; resuspend the cells with fresh 1640 medium and count them;

[0142] Centrifuge the cells at 500g for 5min, resuspend to 2 x 10 6 / ml, plate in a 12-well plate, 0.5ml per well;

[0143] Add 2ml virus supernatant (supernatant prepared after the above virus packaging) and 0.6ug of polybrene infection aid reagent; place the 12-well plate in a horizontal rotor centrifuge, 32°C, 1000g, 9 for acceleration and 5 for deceleration, centrifuge for 1.5h;

[0144] After centrifugation, carefully discard the medium and add 1ml of fresh T cell culture medium, repeat this step once;

[0145] The cells were placed in an incubator for continued culture, and 72 h later, flow cytometry was used to detect the myc positive rate to determine the transfection efficiency of the CAR.

[0146] In the above examples, the isolation and culture of T cells use general experimental operations, which can refer to Example 4. The plasmid transformation, plasmid extraction and the like can refer to conventional operations in the prior art, or can specifically refer to the following.

[0147] When transforming the plasmid: 100 μl of competent cells were dissolved on ice, then the ligation system (or 10 ng of plasmid) was added to the competent cells, which were mixed by flicking 2-3 times, incubated on ice for 30 min, heated at 42°C for 45 s, and then placed on ice for 2 min; 400 μl of LB medium without antibiotics was added, and the bacteria were shaken at 37°C and 200 rpm for 30 min; 100 μl of bacterial solution was spread on an LB plate containing 200 μg / ml of ampicillin, and incubated at 37°C overnight; and further positive single colonies were picked and cultured.

[0148] When extracting the plasmid, the Genview Plasmid Miniprep Kit was used for extraction, and when referring to the specific reference, the instructions thereof were referred to, or the following was referred to:

[0149] 15 ml of bacterial solution to be extracted was centrifuged at 3000 rpm for 10 min, the culture medium was discarded, and the bacterial solution was resuspended in saline and transferred to a 2 ml centrifuge tube, which was centrifuged at 12000 rpm for 3 min, and the supernatant was discarded;

[0150] 500 μl of reagent P1 was added, vortexed to suspend the bacteria, mixed, then 500 μl of bacterial lysis solution P2 was added. The mixture was mixed by gently inverting 8 times, and then 500 μl of reagent P4 was added and immediately mixed;

[0151] After standing at room temperature for 10 min, the mixture was centrifuged at 12000 rpm for 10 min; the supernatant was transferred to an endotoxin removal filter column and centrifuged; 0.3 times the volume of isopropanol was added to the filtrate, mixed, and then the liquid was added to the plasmid binding column (500 μl of equilibrium buffer was added to the plasmid binding column in advance, and the column was centrifuged at 12000 rpm for 1 min to activate it), and the mixture was centrifuged at 12000 rpm for 1 min;

[0152] The column was washed once with 500 μl of protein removal solution PD, and twice with PW, and centrifuged at 12000 rpm for 2 min to remove residual liquid;

[0153] The plasmid binding column was placed in a new 1.5 ml centrifuge tube, 200 μl of sterile deionized water was added to the center of the DNA binding column, and the mixture was allowed to stand at room temperature for 2 min;

[0154] The plasmid was eluted by centrifugation at 12000 rpm for 1 min, and the plasmid concentration was detected.

[0155] Based on the present embodiment, a fusion protein with a GS linker as the connecting peptide (nucleotide sequence as shown in SEQ ID NO: 4) can be constructed in the same way.

[0156] Example 6 Recombinant vector (lentiviral expression plasmid), host cell (CAR-T cell)

[0157] The recombinant vector of the present embodiment contains CARmeso-fP40-BBz, the nucleotide sequence of which is shown in SEQ ID NO: 11, which includes the CARmeso-BBz fragment (nucleotide sequence as shown in SEQ ID NO: 12), the P2A sequence (nucleotide sequence as shown in SEQ ID NO: 8), and the fp-40 encoding gene (nucleotide sequence as shown in SEQ ID NO: 2; PAPAP linker). The specific construction method can refer to Example 5.

[0158] Example 7 Experiment on the effect of T cell function in the presence or absence of PD-L1

[0159] In view of the influence of PD-L1 on the function of cytokine IL-23 on T cell function, the effect of fusion protein fP40 (PAPAP linker) on T cell function and proliferation in the presence or absence of PD-L1 is compared and constructed.

[0160] 7.1 Effect on T cell function

[0161] The experimental method is as follows:

[0162] Sorted CD3 + T cells were re-counted and plated (2 12-well plates), 1 x 10 6 The amount of cells was resuspended with 0.5 ml of RPIM 1640, and 4°C-stored transfection supernatants of each group were added, 1.5 ml per well, 3 wells for each co-transfection supernatant, 5 μl of T cell activation beads was added per well, BSA was added according to the grouping, commercial IL-23 recombinant protein (0.1 μg), purified fP40 fusion protein (0.1 μg; i.e. Figure 3 fIL-23), purified haf-PD-1 protein (0.1 μg). Another 12 groups (as a comparison, PD-L1 is present) added 0.5 μg of PD-L1 recombinant protein, and cultured in a 37°C incubator containing 5% CO2 for 24 h.

[0163] The nucleotide sequence of the Haf-PD-1 encoding gene is shown in SEQ ID NO:13. The Haf-PD-1 fragment was inserted into pcDNA3.1(-), with NheI and BamHI restriction enzyme sites. It was then expressed and purified in the CHO cell line, following the purification steps for the fP40 protein.

[0164] After culturing in an incubator for 24 hours, harvest cells and centrifuge at 1800 rpm for 5 min. Discard the culture medium supernatant, wash twice with PBS containing 2% FBS, centrifuge, resuspend in 50 μl of the system to stain the surface marker, and incubate on ice in the dark for 30 min. After the incubation, wash once with flow buffer, centrifuge, add 400 μl of 4% paraformaldehyde fixative, and incubate on ice in the dark for 30 min. After the incubation, centrifuge at 2000 rpm for 5 min, wash once with flow buffer, add 500 μl of 1× membrane lysis agent, and incubate on ice in the dark for 30 min. After centrifugation and discarding the supernatant, use 50 μl of membrane lysis agent per tube for intrinsic factor staining, and incubate on ice in the dark for 30 min. After the incubation, wash once with flow buffer, centrifuge, resuspend in 200 μl of flow buffer, and run on a flow cytometer.

[0165] Experimental results are as follows Figure 3 As shown. By Figure 3 It can be seen that, compared with the cytokine control group, the fusion protein group can still exert an effect on T cells when the PD-L1Fc fragment is present, and the T cell function of the corresponding experimental group is the best.

[0166] 7.2 Effects on T cell proliferation

[0167] Sorted CD3 + T cells were re-counted and plated (8 wells of a 12-well plate), 2 × 10⁶ cells per well. 6 Cell volume was determined by resuspending cells in 2 ml of RPIM 1640. 5 μl of activated T cell beads were added to each well. BSA, commercially available recombinant IL-23 protein (0.1 μg), purified fP40 fusion protein (0.1 μg), and purified haf-PD-1 protein (0.1 μg) were added according to the cell groupings. Twelve groups required the addition of 0.5 μg of recombinant PD-L1 protein. Cells were cultured at 37°C in a 5% CO2 incubator for 0, 2, 4, and 6 days. Cell counts were performed three times under a microscope. Results are shown below. Figure 4 As shown.

[0168] Depend on Figure 4 It can be seen that, compared with the cytokine control group, the fusion protein group had the highest number of T cells in the presence of the PD-L1 Fc fragment.

[0169] Example 8: In vitro killing experiment of CAR-T cells

[0170] CAR-T cells prepared by the embodiments were used for in vitro killing experiments, and the specific experimental conditions are briefly introduced as follows:

[0171] The H322 lung cancer cell line and KYSE150 esophageal cancer cell line expressing luciferase were taken and counted, and an appropriate amount of cells was taken and adjusted to a cell concentration of 3x10 5 / ml in RPMI1640 medium.

[0172] The CAR-T cells prepared as described above were counted, and 2x10 4 tumor cells were plated in each well of a 96-well plate, and CAR-T cells were plated at an effector-to-target ratio of 1:1 and 1:5, with 200 μl of medium in each well of the 96-well plate.

[0173] The cells were incubated in an incubator overnight for a total of 16 h for luciferase analysis, 1 μl of diluted luciferin was added to each well, and after 10 min of reaction, the tumor cell activity was detected using an IVIS imaging system to detect the killing effect, and the results are shown in Figure 5 .

[0174] Figure 5 Various CAR-T cell construction methods are as follows: The P40, fP40, and haf-PD-1 fragments were cloned from pcDNA3.1(-)fP40-flag plasmid (PAPAP linker) and pcDNA3.1(-)haf-PD-1 plasmid, respectively. The primers used for cloning are as follows:

[0175] hafPD1-F: tggaggagaaccctggacctgactacaaggatgacgatg, as shown in SEQ ID NO: 14.

[0176] hafPD1-R: atccagaggttgattgtcgactagaacagatcgctagg, as shown in SEQ ID NO: 15.

[0177] P40-F: tggaggagaaccctggacctatgtgccaccagcagctg, as shown in SEQ ID NO: 16.

[0178] P40-R: atccagaggttgattgtcgactacttatcatcgtcatccttgtagtcg, as shown in SEQ ID NO: 17.

[0179] Fusion-F (fP40-F): tggaggagaaccctggacctatgtgccaccagcagctg, as shown in SEQ ID NO: 9.

[0180] Fusion-R (fP40-R): atccagaggttgattgtcgactagaacagatcgctagggtcc, as shown in SEQ ID NO: 10.

[0181] The cloned fragments were ligated with CAR276-BBZ plasmid to construct the corresponding CAR-T cells (for details, refer to Example 5).

[0182] The results of the killing experiment are shown in Table 1. Figure 5 As can be seen from Table 1, in the two tumor cell lines, at different time points and different effector-target ratios, the killing effect of the CAR-T cells modified by the fusion protein is significantly enhanced. Figure 5

[0183] Example 9: Detection of cytokines secreted by CAR-T cells

[0184] Using the CAR-T cells prepared in the examples, the inventors further detected the cytokines secreted by the CAR-T cells, and the specific experimental conditions are briefly introduced as follows:

[0185] The supernatant of the in vitro killing of Example 6 was collected, centrifuged, and stored at -80°C for use;

[0186] 1. Before use, mix all reagents thoroughly to avoid foam.

[0187] 2. According to the number of experimental wells (blank and standard), determine the number of required strips. Both samples (including standards) and blanks should be done in duplicate.

[0188] 3. Add sample: 100 μl / well of diluted Cytokine standard to standard wells, 100 μl / well of sample to sample wells, and 100 μl / well of Dilution buffer R (1x) to blank control wells.

[0189] 4. Add detection antibody: 50 μl / well of Biotinylated antibody working solution. Mix well, cover with sealing film, and incubate at room temperature (18-25°C) for 1 hour.

[0190] 5. Wash the plate: remove the liquid in the wells, add 300 μl / well of 1x Washing buffer working solution; stay for 1 minute, then discard the liquid in the wells. Repeat 3 times, and dry on filter paper each time. ​

[0191] 6. Add 100 μl / well of Streptavidin-HRP working solution. Cover the plate with a sealing membrane and incubate at room temperature (18-25°C) for 20 minutes.

[0192] 7. Wash the plate: repeat step 5.

[0193] 8. Color development: add 100 μl / well of TMB and incubate at room temperature (18-25°C) for 5-30 minutes in the dark. Stop the reaction according to the color intensity (dark blue) in the well. Usually, 10-20 minutes of color development can achieve good results.

[0194] 9. Stop the reaction: quickly add 100 μl / well of Stop solution to stop the reaction.

[0195] 10. Read the plate: read the values within 10 minutes after stopping, using a measurement wavelength of 450 nm. It is recommended to read the plate using a dual wavelength, i.e., a measurement wavelength of 450 nm and a reference wavelength or correction wavelength of 610-630 nm, to obtain more accurate results.

[0196] Figure 6 The construction of each CAR-T cell is described in reference example 8. The CAR-T cells were prepared by Figure 6 It can be seen that the CAR-T cells modified by the fP40 fusion protein (PAPAP linker) have significantly enhanced secretion of functional cytokines.

[0197] Example 10: In vivo animal experiment

[0198] Using severe immunodeficient NOD-SCID mice (which can be directly inoculated with human tumor cell lines and form tumors), the above CAR-T cells were used to perform in vivo animal experiments, and the specific experimental process is briefly described as follows.

[0199] On day 0, 1 x 10 6 Human esophageal cancer cell line KYSE150 (or Hela cells) was inoculated subcutaneously into 5-6-week-old (about 25 g) NOD-SCID mice, and 5 x 10 6 CAR-T cells were used for treatment, and the tumor size was measured every 3 days thereafter.

[0200] The changes in tumor size at different treatment times are shown in Figure 7 The mice were sacrificed when the ethical requirements were met, and the tumors were peeled off and placed neatly according to the group for photography. The results are shown in Figure 8Mock T, CAR meso, CAR PD-1, CAR P40, CAR fP40 groups are as follows:

[0201] Mock T is an ordinary T cell without transfection. The construction of various CAR-T cells is as follows: the fragments of P40, fP40 and haf-PD-1 are cloned from pcDNA3.1(-)fP40-flag plasmid and pcDNA3.1(-)haf-PD-1 plasmid respectively. The primers for cloning are as follows:

[0202] hafPD1-F: tggaggagaaccctggacctgactacaaggatgacgatg, as shown in SEQ ID NO: 14.

[0203] hafPD1-R: atccagaggttgattgtcgactagaacagatcgctagg, as shown in SEQ ID NO: 15.

[0204] P40-F: tggaggagaaccctggacctatgtgccaccagcagctg, as shown in SEQ ID NO: 16.

[0205] P40-R: atccagaggttgattgtcgactacttatcatcgtcatccttgtagtcg, as shown in SEQ ID NO: 17.

[0206] Fusion-F (fP40-F): tggaggagaaccctggacctatgtgccaccagcagctg, as shown in SEQ ID NO: 9.

[0207] Fusion-R (fP40-R): atccagaggttgattgtcgactagaacagatcgctagggtcc, as shown in SEQ ID NO: 10.

[0208] The cloned fragments are ligated with CARmeso-BBZ plasmid to construct the corresponding CAR-T cells (for details, refer to Examples 5 and 6).

[0209] From the above results, it can be seen that in the in vivo experiment, the CAR-T cells modified by fP40 fusion protein (PAPAP linker) have significantly improved tumor inhibition effect.

Claims

1. A fusion protein, which is a fusion protein composed of an IL-23 P40 subunit fragment and an immune checkpoint PD-1 fragment connected by a linker; the amino acid sequence of the IL-23 P40 subunit fragment is shown as positions 1-328 of SEQ ID NO: 1; the amino acid sequence of the PD-1 fragment is shown as positions 342-488 of SEQ ID NO:

1.

2. The fusion protein of claim 1, wherein, the linker is a Pro-rich linker or a GS linker.

3. The fusion protein of claim 1, wherein, the amino acid sequence of the fusion protein is: the amino acid sequence shown as SEQ ID NO: 1 or SEQ ID NO:

3. 4.A gene encoding the fusion protein of claim 2 or 3.

5. The gene of claim 4, wherein, the gene encoding the fusion protein shown as SEQ ID NO: 1 is shown as SEQ ID NO: 2; the gene encoding the fusion protein shown as SEQ ID NO: 3 is shown as SEQ ID NO:

4. 6.A recombinant vector comprising the gene of claim 4 or 5.

7. The recombinant vector of claim 6, wherein, the recombinant vector is a lentiviral expression vector.

8. The recombinant vector of claim 7, wherein, the lentiviral expression vector contains a CAR276-BBz fragment, the nucleotide sequence of the CAR276-BBz fragment is shown as SEQ ID NO:

7.

9. The recombinant vector of claim 7, wherein, the lentiviral expression vector contains a CARmeso-BBZ fragment, the nucleotide sequence of the CARmeso-BBz fragment is shown as SEQ ID NO:

12.

10. A host cell, characterized in that, the host cell into which the gene of claim 4 or 5 is introduced, or the recombinant vector of any one of claims 6-9.

11. The host cell of claim 10, wherein the host cell is a T cell.

12. The host cell of claim 11, wherein the host cell is a CAR-T cell. 13.Use of the recombinant vector of claim 8 in the preparation of a drug for treating lung cancer or esophageal cancer. 14.Use of the recombinant vector of claim 9 in the preparation of a drug for treating breast cancer or esophageal cancer.

Citation Information

Patent Citations

  • Fusion protein that targets antigen-specific t cells to induce differentiation thereof into memory stem cells

    WO2021092719A1