A method for detecting MHC class I gene polymorphism in white-feathered broiler chickens

Abstract

The invention provides a method for detecting the polymorphism of MHC class I gene of white-feathered broiler chickens, which can quickly and stably amplify the exon 2 sequence of MHC class I gene of white-feathered broiler chickens, and quickly type the MHC gene of white-feathered broiler chickens by high-throughput sequencing; at the same time, by analyzing the Staphylococcus aureus resistant population and the non-resistant population, the allele related to the Staphylococcus aureus resistance of chickens is obtained; the allele can be used for screening the Staphylococcus aureus resistant individuals of white-feathered broiler chickens.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic breeding, and in particular relates to a method for detecting the polymorphism of major histocompatibility complex (MHC) class I gene MHC I of white-feathered broilers, and provides alleles related to chicken staphylococcus resistance. Technical Background

[0002] The commercial broiler breeds in my country mainly include white-feathered broilers, yellow-feathered broilers and small white-feathered broilers (also known as 817 broilers). Compared with white-feathered broilers and yellow-feathered broilers, small white-feathered broilers have the advantages of smaller market weight, suitable for deep processing of whole chickens, moderate meat quality, and cheap chicks. The market consumption is gradually increasing, with about 800 million listed each year, accounting for about 10% of the broiler market output. However, the small white-feathered broiler breeds currently sold on the market are mixed in origin, mainly using fast-growing white-feathered broilers and high-yielding egg-laying parent or commercial generation chickens for simple economic hybrid seed production, without targeted systematic breeding and hybrid matching combination tests, low production efficiency, and non-standard seed production. Listed commercial broilers generally have the disadvantages of poor disease resistance, low uniformity, and low meat production rate.

[0003] Staphylococcus aureus is a common disease in chicken farming. It is caused by Staphylococcus aureus or other Staphylococci. Sick chickens have systemic symptoms, lack of energy or depression, do not like to run, often stand still or crouch, with wings drooping, neck retracted, eyes half closed and sleepy. Feathers are fluffy and messy, dull. Sick chickens drink and lose their appetite or lose their appetite. A small number of sick chickens have diarrhea and discharge gray or yellow-green loose feces. The more characteristic symptoms are that when the sick chickens are caught for inspection, subcutaneous edema can be seen in the abdomen and chest, even around the crop, and the inner thighs, with varying amounts of bloody exudate, purple or purple-brown in appearance, with a sense of fluctuation, and partial feathers falling off, or they can be taken off by touching. Some of the sick chickens can be seen to have natural ulceration, with brown or purple liquid flowing out, which is contaminated with the surrounding feathers and locally dirty. Some sick chickens have bleeding and inflammatory necrosis of varying sizes on the skin of different parts such as the head and neck, dorsal and ventral sides of the wings, wing tips, tails, faces, backs and legs. Local dry crusting, dark purple, and hairless; in early cases, the local subcutaneous moist, dark purple, hemolysis, and erosion. The above manifestations are common forms of staphylococcal disease, which mostly occur in middle-aged chicks. Sick chickens die in 2 to 5 days, and the fastest is 1 to 2 days. At present, the treatment of chicken staphylococcus is mostly used with Daron Yanqing combined with Daron Yizhimou antibacterial and anti-inflammatory drugs, but the use of this chemical drug often causes severe stress reactions in sick chickens, resulting in a decrease in economic value.

[0004] MHC is a genetic region composed of tightly linked, highly polymorphic sites on vertebrate chromosomes. It is a multi-gene family closely related to immune response and disease resistance. It plays a vital role in vertebrate adaptive immunity and has therefore received great attention from geneticists and immunologists. The immune molecules encoded by MHC genes specifically recognize and bind to antigenic peptides inside and outside cells and present them to T lymphocytes, triggering a series of immune responses and ultimately clearing the antigens to complete the immune response. MHC polymorphism enables populations to produce corresponding immune responses to various pathogens and adapt to changing environmental conditions to maintain the stability of the population.

[0005] The antigen binding region of MHC class I molecules is in the α1 and α2 domains encoded by exon 2 and exon 3, and these domains are highly polymorphic. Relevant studies have shown that MHC genes are closely related to animal disease resistance and susceptibility, and individuals with high MHC polymorphism can better resist viral invasion.

[0006] Traditional MHC gene polymorphism analysis mostly uses SSCP or first-generation Sanger sequencing typing methods. The first-generation Sanger sequencing analysis is costly and has low sequencing efficiency. Although SSCP typing has high sensitivity, it can only type known sites. In recent years, with the rapid development of high-throughput sequencing, MHC gene sequencing analysis has risen to a new level. So far, the second-generation high-throughput sequencing of MHC diversity is mostly limited to Passeriformes, which restricts the possibility of comparative analysis of other birds.

[0007] Currently, the most studied animal in terms of disease resistance is chickens and MHC, especially the relationship between MHC and resistance to Marek's disease and Salmonella in chickens. However, there are no relevant research reports on the relationship between chickens' resistance to Staphylococcus aureus and MHC class II genes. Summary of the invention

[0008] The invention provides a method for detecting the polymorphism of MHC class I gene of white-feathered broiler chickens, which can quickly and stably amplify the exon 2 sequence of MHC class I gene of white-feathered broiler chickens, and quickly type the MHC gene of white-feathered broiler chickens by high-throughput sequencing; at the same time, by analyzing the Staphylococcus aureus resistant population and the non-resistant population, the allele related to the Staphylococcus aureus resistance of chickens is obtained; the allele can be used for screening the Staphylococcus aureus resistant individuals of white-feathered broiler chickens.

[0009] The present invention first provides a nested PCR primer combination for detecting chicken MHC class I gene polymorphism, which comprises an outer primer pair and an inner primer pair, wherein the outer primer pair comprises:

[0010] Upstream primer Outer-1: 5′-GAGCTCCATACCCTGCGGTACAT-3′ (SEQ ID NO: 1), downstream primer Outer-2: 5′-GTGGAAGGAGGAGAGGGAAATA-3′ (SEQ ID NO: 2),

[0011] The inner primer pair contains:

[0012] Upstream primer INNER-1: 5′-GTACCACACCTGGGTCACCATCGAT-3′ (SEQ ID NO: 3),

[0013] Downstream primer INNER-2: 5′-CCCCTGCTCTGGTTGTAG-3′ (SEQ ID NO: 4).

[0014] In another aspect, the present invention provides a use of the nested PCR primer combination, namely, use in detecting MHC class I gene polymorphism of white-feathered broilers.

[0015] The present invention also provides a method for detecting MHC class I gene polymorphism in a white-feathered broiler chicken population, which uses the above-mentioned nested PCR primer combination for detection, and the specific steps are as follows:

[0016] 1) Extracting blood samples from multiple white-feathered broiler chickens to be tested, performing nested PCR amplification on the extracted genomic DNA using the above-mentioned primer pair, purifying the amplified product, and quantifying the concentration using a fluorescence quantifier; mixing samples according to the quantitative concentration, building a library for multiple samples, completing library construction through end repair, adding adapters and magnetic bead purification, and sequencing;

[0017] 2) First, the sequencing data was preprocessed to remove the barcode sequence, split the original sequence into single sample data and remove low-quality and adapter sequences, merge the double-end sequences, identify and remove the primer sequences; then cluster the reads, remove the mitochondrial and chloroplast source sequences, merge the redundant sequences, and select the sequences with abundance > 1000 for subsequent data analysis;

[0018] 3) Data Analysis: Bioinformatics software Mega was used to compare the obtained MHC sequences, calculate the number of alleles, and complete the MHC genotyping of white-feathered broiler chickens.

[0019] In another aspect, the present invention provides a genotype associated with Staphylococcus aureus resistance in white-feathered broiler chickens, wherein the sequence of the genotype is as follows:

[0020] GCGCAGCCGGGGGACGGGGACAAGTACCAGTGCCGCGTGGAGCAC

[0021] GCCAGCCTGCCCCAGCCCGGCCTCTTTCTCGTGGGAGCCGCCACAGCCCA

[0022] ACCTGGTGCCCATCGTGGCGGGGGTGCCTGTCGCCATTGTGGCCATCGCC

[0023] ATCGTGGTTCGTGTTGGATACATCATCTACAGACGCCAT (SEQ ID NO: 5).

[0024] In yet another aspect, the present invention provides a method for screening white-feathered broiler parents resistant to Staphylococcus aureus, which comprises screening individuals with the above genotype by PCR sequencing method.

[0025] The primer combination of the present invention can effectively amplify the exon 2 sequence of the chicken class I MHC gene. In addition, the operation steps of using nested PCR to amplify the target fragment are simple, and the specificity and sensitivity of the detection method can be improved. A trace amount of white-feathered broiler DNA sample can be used as a template for determination. The 454 high-throughput sequencing based on the PCR method can sequence specific polymorphic regions of MHC, with low sequencing costs and high detection efficiency. Compared with the disadvantage that the traditional Sanger sequencing method can only read a single gene sequence at a time, high-throughput sequencing can perform population sequencing and genotyping at one time, thereby realizing the evaluation of the class I MHC gene polymorphism of white-feathered broiler individuals in the population. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The electrophoresis detection results of PCR amplification of different chicken individuals using the designed outer primers Outer-1 / Outer-2 of the present invention. Lanes 1-7 shown in the figure are the product fragments obtained by PCR amplification of 7 different white-feathered broiler blood DNA by primers Outer-1 / Outer-2, lane 8 is the positive control, and lane 9 is the negative control.

[0027] Figure 2 The electrophoresis test results of PCR amplification of different chicken individuals using the designed inner primers INNER-1 / INNER-2 of the present invention. Lanes 1-7 shown in the figure are the product fragments obtained by PCR amplification of 7 different white-feathered broiler blood DNA using primers INNER-1 / INNER-2, lane 8 is the positive control, and lane 9 is the negative control. DETAILED DESCRIPTION

[0028] The present invention designs universal primers in the conserved region of exon 2 of the class I MHC gene of white-feathered broiler chickens, successfully amplifies the sequence of the class I MHC gene of white-feathered broiler chickens, uses second-generation high-throughput sequencing combined with bioinformatics software MEGA to perform polymorphism analysis on the class I MHC gene of white-feathered broiler chickens, evaluates the pathogen resistance of white-feathered broiler chickens, and lays a foundation for breeding excellent varieties of white-feathered broiler chickens.

[0029] The present invention is described in detail below in conjunction with embodiments and drawings.

[0030] Example 1: Nested PCR primer design and PCR amplification method establishment

[0031] 1. Design and synthesis of PCR outer primers

[0032] The primers of the invention are used for amplifying the major histocompatibility complex (MHC) class I gene sequence of white-feathered broiler chickens. The primers are used to search the chicken class I MHC gene sequence in Genbank, and the gene sequence is compared and analyzed by using biological software such as MAGA and DNAMAN, and the conserved region of exon 2 of the class I MHC gene is found as a PCR amplification region. Primers Premier 5 is used to design nested primers, and the specificity and feasibility of the primers are verified by online BLAST, and the primers are synthesized according to a conventional method in the art.

[0033] The nested PCR primer combination includes an outer primer pair and an inner primer pair, wherein the outer primer pair includes:

[0034] Upstream primer Outer-1: 5′-GAGCTCCATACCCTGCGGTACAT-3′ (SEQ ID NO: 1), downstream primer Outer-2: 5′-GTGGAAGGAGGAGAGGGAAATA-3′ (SEQ ID NO: 2),

[0035] The inner primer pair contains:

[0036] Upstream primer INNER-1: 5′-GTACCACACCTGGGTCACCATCGAT-3′ (SEQ ID NO: 3),

[0037] Downstream primer INNER-2: 5′-CCCCTGCTCTGGTTGTAG-3′ (SEQ ID NO: 4).

[0038] The size of the fragment amplified by the outer primers was 1540 bp, and the size of the fragment amplified by the inner primers was 231 bp.

[0039] The DNA sample extracted from the blood of white-feathered broilers was used as a template, and the outer primers Outer-1 / Outer-2 were used as the first set of amplification primers. The 25 μL PCR reaction system contained the following components: 5 μL PCR Ehancer, 12.5 μL 2×Phanta Max Master Mix, 2 μL chicken blood DNA template, 1 μL upstream and downstream primers, and the volume was made up to 25 μL with sterile double distilled water. A positive control and a negative control were set. The above PCR reaction solution was added to the reaction tube and amplified in a PCR instrument. The amplification program was denaturation at 95°C for 5 min, followed by pre-denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 1.5 min. A total of 22 cycles were amplified, and finally extension at 72°C for 5 min to obtain the first round of PCR products.

[0040] The first round of PCR product DNA was used as a template, and the primers INNER-1 / INNER-2 were used as the second set of amplification primers. The 25 μL PCR reaction system contained the following components: 5 μL PCR Ehancer, 12.5 μL 2×Phanta Max Master Mix, 2 μL chicken blood DNA template, 1 μL each of upstream and downstream primers, and sterilized double distilled water to make up the volume to 25 μL. Positive and negative controls were set. The above PCR reaction solution was added to the reaction tube and placed in a PCR instrument for amplification. The amplification program was 95°C denaturation for 5 min, then 95°C pre-denaturation for 15 s, 53°C annealing for 15 s, 72°C extension for 30 s, a total of 32 cycles, and finally 72°C extension for 5 min for the second round of PCR. After the reaction was completed, the PCR product was taken and electrophoresed on a 1% agarose gel. After the electrophoresis was completed, the gel was placed in a UV imager to observe the results.

[0041] The nested PCR primers and detection method of the present invention are used to perform PCR amplification on the DNA sample. If the target band is observed during ultraviolet imaging after agarose gel electrophoresis and there are no mixed bands, it is preliminarily determined to be the target band. Then, the clone culture is recovered by gel excision, and a single colony is selected for culture for first-generation Sanger sequencing verification. Finally, the second-generation high-throughput sequencing result is combined with the obtained chicken class I MHC to determine that it is the target sequence.

[0042] The specific method of using this set of nested PCR primers to amplify the white-feathered broiler MHC gene and high-throughput sequencing analysis is as follows:

[0043] 1. Extract DNA from the blood sample of white-feathered broiler chickens to be tested by phenol-chloroform extraction method as a DNA template: Take out the chicken blood sample with EDTA anticoagulant from the -20℃ refrigerator, take 20μL sample after thawing, add lysis solution and proteinase K to a 1.5mL centrifuge tube for overnight digestion, and extract genomic DNA from the chicken blood sample by phenol-chloroform extraction method. Use MD2000 to detect the concentration of the extracted DNA solution, use 1% agarose gel electrophoresis with DL2000 DNA marker to detect the length range and quality of the extracted DNA fragments, take the DNA stock solution and dilute it to a diluent with a concentration of about 200ng / μL, and store it at -20℃.

[0044] 2. Take the qualified chicken blood DNA sample as template, use the primer pair Outer-1 / Outer-2 as the first set of amplification primers, and use the 25 μL PCR reaction system, which contains the following components: 5 μL PCR Enhancer, 12.5 μL 2×Phanta Max Master Mix, 2 μL chicken blood DNA template, 1 μL upstream and downstream primers, and make up the volume to 25 μL with sterile double distilled water. Set positive control and negative control, add the above PCR reaction solution to the reaction tube, and amplify in a PCR instrument. The amplification program is denaturation at 95°C for 5 minutes, then pre-denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 1.5 minutes. A total of 22 cycles are performed, and finally extension at 72°C for 5 minutes to obtain the first round of PCR products.

[0045] 3. Using the DNA of the first round of PCR product as a template and the primer pair INNER-1 / INNER-2 as the second set of amplification primers, a 25 μL PCR reaction system contained the following components: 5 μL PCR Ehancer, 12.5 μL 2×Phanta Max Master Mix, 2 μL chicken blood DNA template, 1 μL each of upstream and downstream primers, and sterile double distilled water to make the volume up to 25 μL. Positive and negative controls were set up, and the above PCR reaction solution was added to a reaction tube, and amplified in a PCR instrument. The amplification program was denaturation at 95°C for 5 min, followed by pre-denaturation at 95°C for 15 s, annealing at 53°C for 15 s, and extension at 72°C for 30 s. A total of 32 cycles were performed, and finally extension was performed at 72°C for 5 min for the second round of PCR.

[0046] 4. Electrophoresis detection of PCR products: Prepare 1% agarose gel, take 5.0μL of PCR product with a pipette, and spot it into the loading hole of the prepared 1% agarose gel, and use 3.0μL DNA Marker as the relative molecular mass indicator to perform agarose gel electrophoresis. The electrophoresis buffer is TAE buffer, and the electrophoresis instrument voltage is set to 120 volts. After electrophoresis for about 20 minutes, take out the agarose gel and observe the results in a UV analyzer, and take pictures.

[0047] 5. Perform agarose electrophoresis on the PCR products of each sample, separate and purify the PCR products by gel cutting, and use the Invitrogen Qubit 4.0 fluorescence quantifier to quantify the concentration of the purified PCR products. Mix the samples according to the quantitative concentration, and use one library for multiple samples. Use the KAPA library construction kit to perform end repair, add adapters, and purify the magnetic beads to complete the library construction. Use qPCR to quantify the library, and use the Agilent 2100bioanalyzer for length analysis. Finally, use the Illumina NovaSeq 6000 sequencer to complete the sequencing at 2*250 times depth.

[0048] 6. After the data is downloaded, the Barcode sequence is truncated and the original sequence is split into single sample data. Trimmomatic is used to perform quality control on the split data. The bases with a quality value of less than 2 at the end of the sequence are filtered out. A 4bp window is set. If the average quality value in the window is less than 15, the back-end bases are truncated from the window and sequences with too short lengths are filtered out. USEARCH is used to splice the filtered sequence data to obtain spliced ​​data. The spliced ​​sequence contains amplification primers, which may affect OTU construction. It is necessary to remove the double-ended primers (allowing 2bp base mismatches) and filter out the data that does not contain normal primer sequences to obtain high-quality Tags data.

[0049] 7. Use the UNOISE algorithm to denoise all Clean Tags sequences of all samples to form a ZOTU set. First, use USEARCH fastq filter to remove low-quality sequences in Clean reads, merge the processed sequences, and use USEARCH fastx_uniques to obtain non-redundant sequences sorted by abundance. Use the USEARCH unoise 3 algorithm (minsize=8) to denoise non-redundant sequences and obtain ZOTU sequences. Finally, align all Clean reads to the representative sequences to obtain the relative abundance of ZOTU in each sample. After merging redundant sequences, select sequences with abundance >1000 for subsequent data analysis.

[0050] 8. Use the bioinformatics software Mega to compare and analyze the obtained MHC sequences and calculate the number of alleles.

[0051] The primer set and method of the present invention were used to type 30 white-feathered broiler samples, and 8 alleles were obtained. The number of alleles varied greatly between different individuals, and each individual had 3-8 alleles. We therefore inferred that white-feathered broiler MHC class I exon 2 had at least 2-4 gene loci.

[0052] Example 2: Screening for resistance alleles

[0053] The primer set and method of Example 1 were used to detect the Staphylococcus aureus antibody white-feathered broiler group and the susceptible group. In general, the mortality rate of the host after the invasion of the pathogen can fundamentally reflect the resistance of the white-feathered broiler to the pathogen. The longer the average death time of the individual and the lower the mortality rate, the stronger the disease resistance of the allele. The lower the mortality rate is, the staphylococcus resistant group, and the higher the mortality rate is, the susceptible group.

[0054] In November 2021, the same strain of Staphylococcus aureus was continuously infected in the white-feathered broiler population with the same genetic background at the breeding farm of Yantai Dadi Animal Husbandry Co., Ltd., and the dead white-feathered broilers were counted during feeding, and the chickens were raised for 90 days after the infection. According to the death records within 90 days of feeding, the survivors from the beginning of feeding to the 90th day were judged as staphylococcal resistance survivors, and the death time of different allele types was counted. The results are shown in Table 1.

[0055] In the final results, individuals containing the allele Ggd-MHC05 had the longest average death time, the lowest mortality rate, and the strongest disease resistance, while individuals containing the allele Ggd-MHC04 had the shortest average death time of 18.5 days, the highest mortality rate of 90%, and the highest susceptibility.

[0056] Table 1: MHC Ⅰ genotypes and pathogenicity of Staphylococci in white-feathered broiler chickens

[0057]

[0058]

[0059] The resistance allele type Ggd-MHC05 was finally determined, and its nucleotide sequence was GCGCAGCCGGGGGACGGGGACAAGTACCAGTGCCGCGTGGAGCACGCCAGCCTGCCCCAGCCCGGCCTCTTCTCGTGGGAGCCGCCACAGCCCAACCTGGTGCCCATCGTGGCGGGGGTGCCTGTCGCCATTGTGGCCATCGCCATCGTGGTTCGTGTTGGATACATCATCTACAGACGCCAT.

[0060] Finally, parents containing this allele were selected for hybridization to cultivate an excellent white-feather broiler breed resistant to staphylococcal disease. Their offspring were subjected to Staphylococcus aureus gratitude experiments. The results showed that compared with other groups, the selected offspring individuals had better staphylococcal resistance.

[0061] The high-throughput sequencing analysis method based on nested PCR amplification designed by the present invention can effectively amplify most of the exon 2 sequences of the class I MHC of white-feathered broiler chickens. The high-throughput sequencing depth is high, and the sequencing results meet the requirements for MHC polymorphism analysis. In addition, the present invention conducts an association analysis between MHC gene exon 2 and resistance to staphylococcal disease to determine the resistance allele to staphylococcal disease. This method can be used to evaluate the genetic diversity of highly polymorphic and multi-site MHC genes, thereby evaluating the ability of white-feathered broiler chickens to resist pathogens, laying the foundation for breeding excellent varieties of white-feathered broiler chickens.

Claims

1. A method for screening parents related to Staphylococcus aureus resistance in white-feathered broiler chickens, characterized in that: The method is to perform PCR amplification on the individual to be detected, and then sequence the amplified product to screen the MHC class I genotype, and screen the individual with the genotype of SEQ ID NO:

5.

2. The method according to claim 1, characterized in that The primer pair used in the PCR amplification is an upstream primer with a nucleotide sequence of SEQ ID NO: 3 and a downstream primer with a nucleotide sequence of SEQ ID NO: 4.

Images