A recombinant bacterium for improving the robustness of Escherichia coli and a method for constructing the same

Abstract

The present invention discloses a recombinant bacterium for improving the robustness of Escherichia coli and a method for constructing the same; by replacing the methylglyoxal synthase gene mgsA with a truncated squalene synthase gene tErg9 from yeast; on this basis, replacing the phosphotransacetylase gene pta with a squalene-hopene cyclase gene shc from Alicyclobacillus acidocaldarius, artificially introducing an exogenous artificially synthesized non-natural membrane component hopanoids pathway, and artificially regulating the key rate-limiting enzyme of the endogenous MEP pathway. The obtained recombinant bacterium contains a brand-new non-natural membrane component in its cell membrane, enabling the remodeling of its cell membrane, and significantly improving the tolerance and product synthesis ability of the recombinant engineering bacterium.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, relates to the field of microbial synthetic biology, and particularly relates to a recombinant bacterium for improving the robustness of Escherichia coli and a construction method thereof, and more particularly relates to a recombinant bacterium for improving the tolerance and product synthesis ability of Escherichia coli and a construction method thereof. Background Art

[0002] Biomass is a renewable clean resource. Through biomanufacturing technology, it can be converted into fuels, bulk chemicals and natural products, thus partially replacing petrochemical refining and plant extraction. At present, in industrial biotechnology, some important microorganisms, including bacteria and yeasts, have been widely used in fermentation processes as cell factories to produce pharmaceuticals, health products, enzymes, food ingredients, fuels and biochemicals (Marta Tous Mohedano et al., 2022). To meet commercial demands, microbial cells usually need to be engineered to effectively biosynthesize valuable chemicals and ultimately achieve specific metrics such as efficiency, yield and productivity. Microbial fermentation has obvious advantages such as low cost, no chemical residues and high yield, and is considered the core of biomanufacturing. Among them, Escherichia coli is widely used as the most common chassis cell for the construction of microbial cell factories due to a series of advantages such as clear genetic background, clear physiological background, easy cultivation, short doubling time and mature genetic manipulation techniques.

[0003] The core technology of biomanufacturing is to construct efficient microbial cell factories to convert biomass raw materials into various end products. However, during the production of compounds by microbial cell factories, they are often exposed to various different stresses, which come from raw materials, metabolism or industrial production processes, such as impurities such as furans and phenolic compounds generated during the preparation of upstream biomass-derived sugars (such as cellulose hydrolysate), toxic intermediates and unwanted by-products accumulated during the production process, adverse industrial conditions such as high temperature, acid-base and high salt existing in the downstream fermentation process, and the backfiring of the synthesized end products on the cells themselves. This series of adverse conditions will have a toxic effect on the cell factory, thus greatly limiting the growth and product synthesis ability of the strain.

[0004] Research shows that the synthesis products cause E. coli There are various mechanisms of cell toxicity, including causing cell membrane damage, DNA damage, protein denaturation and inducing the production of reactive oxygen species (ROS). Although the toxicity mechanisms of different compounds to cells are different, cell membrane damage is considered an important common mechanism of cell toxicity caused by various compounds. E. coliThe cell membrane, as a cell barrier, is responsible for maintaining the stability of the intracellular microenvironment and participating in the processes of material exchange, energy transport, and information transmission with the external environment. Additionally, the cell membrane contains a rich enzyme system that performs many important metabolic functions and is crucial for maintaining and regulating cell physiology and metabolism. Therefore, constructing a robust E. coli cell membrane and improving its tolerance to toxic products and substrates is an effective strategy to solve the problem of cell membrane damage. Summary of the Invention

[0005] To solve the above technical problems, the object of the present invention is to provide a recombinant bacterium with improved robustness of Escherichia coli and its construction method. The present invention introduces non-natural membrane components into Escherichia coli through an artificial synthesis pathway, and modifies the tolerance of the Escherichia coli chassis cells by remodeling E. coli the cell membrane to construct an efficient microbial cell factory, which can greatly improve the fermentation ability of current industrial microorganisms and enhance their physiological performance. Specifically, the present invention uses the CRISPR-cas9 gene editing technology to replace the gene mgsA encoding methylglyoxal synthase in the host bacterium MG1655 with a truncated squalene synthase gene tErg9 from yeast, and uses the artificial promoter strategy to up-regulate tErg9 the expression; on the basis of the obtained recombinant bacterium, the CRISPR-cas9 gene editing technology is used to continue to replace the phosphoacetyltransferase gene pta of the recombinant bacterium with a squalene-hopene cyclase gene shc from Alicyclobacillus acidocaldarius, and uses the artificial promoter strategy to up-regulate shc the expression to obtain a recombinant engineering bacterium. The obtained recombinant Escherichia coli has no resistance and has broad-spectrum tolerance to a variety of compound inhibitors and can produce C8 compounds. Among them, the artificial promoter element is M1-93, and its nucleotide sequence is as shown in SEQ ID NO.5.

[0006] The object of the present invention is achieved by the following technical solutions:

[0007] In the first aspect, the present invention provides a recombinant Escherichia coli with improved robustness. This recombinant bacterium is a recombinant Escherichia coli into which non-natural membrane components hopanoids are introduced; the synthesis of non-natural membrane components hopanoids is carried out through the combination of the endogenous MEP pathway in Escherichia coli and the introduced exogenous artificial synthesis pathway.

[0008] Furthermore, artificial regulation is carried out on the key rate-limiting enzymes of the endogenous MEP pathway.

[0009] The key rate-limiting enzymes of the endogenous MEP pathway The key rate-limiting enzymes of the endogenous MEP pathway include the 1-deoxy-D-xylulose-5-phosphate synthase geneDxs and isopentenyl pyrophosphate isomerase gene idi。

[0010] The endogenous MEP pathway in Escherichia coli includes the (by-product synthesis gene) methylglyoxal synthase gene mgsA and the phosphate acetyltransferase gene pta。

[0011] The introduced exogenous synthetic pathway includes the (truncated from yeast) squalene synthase gene S. cerevisiae erg9 tErg9 and the (from Alicyclobacillus acidocaldarius) squalene-hopene cyclase gene shc。

[0012] Specifically, the recombinant Escherichia coli sequentially knocks out two by-product synthesis genes and introduces an artificial synthetic pathway, that is, sequentially integrates the truncated squalene synthase gene from yeast tErg9 , the squalene-hopene cyclase gene from Alicyclobacillus acidocaldarius shc into MgsA and pta two loci.

[0013] In the present invention, the truncated squalene synthase from yeast can catalyze the synthesis of squalene from the precursor farnesyl diphosphate (FPP) in Escherichia coli. Subsequently, the squalene-hopene cyclase from Alicyclobacillus acidocaldarius catalyzes squalene into hopane, which is a sterol analogue. Hopane inserts into the phospholipid bilayer, reducing the fluidity of the cell membrane and enhancing the acid and alkali tolerance and osmotic pressure tolerance of Escherichia coli.

[0014] As an embodiment of the present invention, the methylglyoxal synthase gene in Escherichia coli mgsA is replaced with the squalene synthase gene tErg9 , and the expression of tErg9 is up-regulated using an artificial promoter strategy; the phosphate acetyltransferase gene pta is replaced with the squalene-hopene cyclase gene shc , and the expression of shc is up-regulated using an artificial promoter strategy; a recombinant Escherichia coli (introduced with an exogenous synthetic pathway) is obtained. Denoted as recombinant E. coli bacterium Δ mgsA::tErg9 Δ pta::shc .

[0015] As an embodiment of the present invention, the nucleotide sequence encoding the methylglyoxal synthase gene in Escherichia coli mgsA comprises the sequence shown in SEQ ID NO.1; the nucleotide sequence encoding the phosphoacetyltransferase gene in Escherichia coli pta comprises the sequence shown in SEQ ID NO.3; the nucleotide sequence encoding the (truncated from yeast of the exogenous synthetic pathway) squalene synthase gene tErg9 , the (from Alicyclobacillus acidocaldarius) squalene-hopene cyclase gene shc comprises the sequences shown in SEQ ID NO.2 and SEQ ID NO.4.

[0016] As an embodiment of the present invention, the yeast includes S. cerevisiae BY4742, and the Alicyclobacillus acidocaldarius includes Alicyclobacillus acidocaldarius subsp. acidocaldarius .

[0017] As an embodiment of the present invention, the exogenous artificial synthetic pathway includes the artificial regulatory element M1-93-tErg9 + M1-93-shc; specifically, M1-93 is used as tErg9 and shc the artificial regulatory element to form M1-93-tErg9 and M1-93-shc. The nucleotide sequence of M1-93 is as shown in SEQ ID NO.5.

[0018] As an embodiment of the present invention, it further includes the step of artificially regulating the key rate-limiting enzyme of the endogenous MEP pathway in the obtained recombinant engineering bacteria. The artificial regulation of the key rate-limiting enzyme of the endogenous MEP pathway is to replace the promoters of the 1-deoxy-D-xylulose-5-phosphate synthase gene Dxs and the isopentenyl pyrophosphate isomerase gene idi with the artificial enhanced promoters M1-37 and M1-46 respectively; the nucleotide sequence of M1-37 includes that shown in SEQ ID NO.6, and the nucleotide sequence of M1-46 includes that shown in SEQ ID NO.7. The artificial enhanced regulation of the two key enzymes of the endogenous MEP pathway, the 1-deoxy-D-xylulose-5-phosphate synthase gene Dxs and the isopentenyl pyrophosphate isomerase gene idi is carried out to make more carbon metabolic flux flow towards the synthesis of IPP / DMAPP, thereby further improving the level of hopanoids produced by the engineering bacteria.

[0019] The present invention obtains recombinant Escherichia coli introduced with an exogenous artificial synthetic pathway through the CRISPR-Cas9 technology. As an embodiment of the present invention, the host of the recombinant Escherichia coli is Escherichia coliE. coli MG1655。

[0020] Furthermore, a control strain of recombinant Escherichia coli, Escherichia coli E. coli MG1655 Δ mgsA Δ pta 。

[0021] In a second aspect, the present invention provides a method for constructing a recombinant Escherichia coli with improved robustness, comprising the following steps:

[0022] (1) According to the gene to be replaced mgsA, the required integrated M1-93- tErg9 artificial regulatory element, construct the corresponding pTargetF-N20 plasmid and DonorDNA;

[0023] According to the gene to be replaced pta ,the required integrated M1-93- shc artificial regulatory element, construct the corresponding pTargetF-N20 plasmid and DonorDNA;

[0024] (2) Transform one of the pTargetF-N20 plasmids and DonorDNA into Escherichia coli competent cells containing the pCas plasmid by electroporation;

[0025] Induce the transcription of sgRNA on the plasmid pCas plasmid, eliminate the pTargetF-N20 plasmid and screen out the strains with successful gene modification;

[0026] (3) Transform the other untransformed pTargetF-N20 plasmid and DonorDNA into the strain obtained in step (2), induce the transcription of sgRNA on the plasmid pCas plasmid, eliminate the pTargetF-N20 plasmid and screen out the strains with successful gene modification;

[0027] (4) Eliminate the pCas plasmid to obtain a recombinant Escherichia coli into which an exogenous artificial synthesis pathway has been introduced. Denote it as E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc 。

[0028] In the present invention, the artificial regulatory elements M1-93- tErg9 、M1-93- shc are operated by the CRISPR-cas9 gene editing technology.

[0029] As an embodiment of the present invention, in step (2), the Escherichia coli competent cells containing the pCas plasmid are obtained by transforming the plasmid pCas into the cells to obtain the recipient bacteria containing the pCas plasmid.

[0030] Further, the recombinant Escherichia coli introduced with the exogenous artificial synthesis pathway replaces the promoters of the endogenous rate-limiting enzyme genes dxs and idi with the artificial enhanced promoters M1-37 and M1-46 respectively by the λ-Red one-step recombination method. The nucleotide sequence of M1-37 includes that shown in SEQ ID NO.6, and the nucleotide sequence of M1-46 includes that shown in SEQ ID NO.7. The obtained recombinant Escherichia coli with improved robustness is denoted as Escherichia coli Δ mgsA::tErg9 Δ pta::shc M1-37- dxs M1-46- idi ; meanwhile, a control strain Δ mgsA Δ pta M1-37- dxs M1-46- idi of the engineering strain is constructed.

[0031] As an embodiment of the present invention, in step (2), the transformed plasmid is the pTargetF-N20 plasmid and DonorDNA according to the artificial regulatory element M1-93- tErg9 to be integrated; in step (3), the transformed plasmid is the pTargetF-N20 plasmid and DonorDNA constructed according to the gene pta to be replaced and the artificial regulatory element M1-93- shc to be integrated.

[0032] As an embodiment of the present invention, in step (1), when constructing the pTargetF-N20 plasmid, according to the gene mgsA and pta to be replaced, a suitable N20 nucleotide sequence is found, and the whole plasmid PCR is carried out using the plasmid pTargrtF as the template.

[0033] As an embodiment of the present invention, in step (1), when constructing the DonorDNA, according to the upstream and downstream homologous arms of the artificial regulatory elements M1-93- tErg9 and M1-93- shc , they are respectively integrated with M1-93 and tErg9 , and M1-93 and shc by one-step homologous recombination.

[0034] As an embodiment of the present invention, in steps (2) and (3), IPTG induction is adopted.

[0035] As an embodiment of the present invention, in steps (2) and (3), the engineered bacteria are obtained by screening on spectinomycin and kanamycin resistance plates.

[0036] As an embodiment of the present invention, in step (4), the strain constructed in step (3) is cultured overnight at 37 °C without adding any antibiotics to eliminate the pCas plasmid.

[0037] In a third aspect, the present invention provides a recombinant Escherichia coli with improved robustness, and the recombinant Escherichia coli is the Hop1 strain, with the preservation number of CGMCC NO. 26270, and the genus name Escherichia coli , Chinese translation name Escherichia coli, and the preservation date is December 26, 2022.

[0038] The present invention deposits the Hop1 strain with an institution recognized by the patent; the microbial deposit number of the Hop1 strain is: CGMCC NO. 26270; the taxonomic name is: Escherichia coli Escherichia coli ; Depositary institution: General Microbiology Center of China Committee for Culture Collection of Microorganisms; Deposit time is December 26, 2022; Deposit address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0039] In a fourth aspect, the present invention provides an application of a recombinant Escherichia coli with improved robustness in producing a target compound as a chassis cell.

[0040] As an embodiment of the present invention, the above application includes various target compounds, such as the product display of different compounds such as short-chain and long-chain fatty acids, trihydroxypropionic acid, phloroglucinol, etc., and specifically includes the following steps:

[0041] (1) Transfer the utilization plasmids of different products into the control bacteria and the engineered bacteria respectively;

[0042] (2) Further, in step (1), the product utilization plasmids are corresponding to the following table:

[0043]

[0044] (3) For short-chain and long-chain fatty acids, culture in MOPS + 2% (wt / v) Glucose medium;

[0045] For trihydroxypropionic acid, culture in M9 + 2% (wt / v) Glycerol medium;

[0046] For phloroglucinol, culture in M9 + 2% (wt / v) Glucose medium.

[0047] Among them: The formula of the MOPS medium is as follows:

[0048]

[0049] 40X “M”

[0050]

[0051] Among them, the components of the micronutrient solution are as follows:

[0052]

[0053] ZnCl 2 solution, Na 2 SeO 3 solution, Na 2 MoO 4 The components of the solution are as follows:

[0054]

[0055] The formula of the M9 + 2% (wt / v) Glycerol medium is:

[0056]

[0057] The formula of the M9 + 2% (wt / v) Glucose medium is:

[0058]

[0059] 5X M9 salts

[0060]

[0061] Using 0.1 mM IPTG as the inducer, culturing at 30 °C for 72 h, and sampling every 24 h during this period. The supernatant of the long-chain and short-chain fatty acid fermentation broth is subjected to GC-MS analysis after extraction and esterification; the fermentation broth of trihydroxypropionic acid and phloroglucinol is subjected to high-performance liquid chromatography analysis after centrifugation and filtration. As another embodiment of the present invention, the application includes the following steps:

[0062] (1) Transfer the products into the recombinant Escherichia coli using plasmids pXZ18Z (long-chain fatty acids), pJMYEE182564 (short-chain fatty acids), pTrc99A-phlD (phloroglucinol), pTrc99a- dhaB-aldH respectively;

[0063] (2) Culture with the MOPS + 2% (wt / v) Glucose medium;

[0064] (3) Using 0.1 - 0.5 mM IPTG as the inducer, culture at 30 °C for 24 - 72 h to obtain the target compound.

[0065] In the above step (3), during the culture, samples of the supernatant of the fermentation broth were taken every 24 h, and after extraction and esterification, GC-MS analysis was carried out.

[0066] Compared with the prior art, the present invention has the following beneficial effects:

[0067] 1) The present invention uses the CRISPR-cas9 gene editing technology to introduce the synthesis pathway of non-natural membrane component hopanoids into Escherichia coli. Through artificial construction, the cell membrane of Escherichia coli is reshaped, the fluidity of the cell membrane is improved, and the tolerance of Escherichia coli is effectively enhanced.

[0068] 2) The recombinant Escherichia coli with improved robustness of the engineering strain of the present invention has improved the synthesis ability of the target compound while enhancing the tolerance.

[0069] 3) The engineering strain of the present invention does not contain plasmids, there is no risk of plasmid loss, and antibiotics are not added during fermentation, and it has the potential for industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] By reading the detailed description of the non-limiting embodiments with reference to the following drawings, other features, objectives and advantages of the present invention will become more apparent:

[0071] Figure 1 Construction strategy and schematic diagram for introducing non-natural membrane components into the cell membrane of Escherichia coli to construct recombinant Escherichia coli with improved robustness;

[0072] Figure 2 Schematic diagram of the steps to eliminate the pCas plasmid;

[0073] Figure 3 For the pTargetF- in Example 2 mgsA Recombinant plasmid structure diagram;

[0074] Figure 4 For the pTargetF- in Example 2 pta Recombinant plasmid structure diagram;

[0075] Figure 5 For the vector plasmid map pCDF-P1-SHC containing shc in Example 3;

[0076] Figure 6 For constructing the engineering strain E. coli MG1655 Δ mgsA Δ ptaM1-37- dxs M1-46- idi 、 E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc M1-37- dxs M1-46- idi Tolerance tests for adverse industrial conditions and various compounds;

[0077] Figure 7 To construct an engineered strain E. coli MG1655 Δ mgsA Δ pta M1-37- dxs M1-46- idi 、 E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc M1-37- dxs M1-46- idi Tolerance tests for typical inhibitors in cellulosic hydrolysates;

[0078] Figure 8 To construct an engineered strain E. coli MG1655 Δ mgsA Δ pta M1-37- dxs M1-46- idi 、 E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc M1-37- dxs M1-46- idi Tolerance tests for one-carbon compounds;

[0079] Figure 9 To construct an engineered strain E. coli MG1655 Δ mgsA Δ pta M1-37- dxs M1-46- idi 、 E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc M1-37- dxs M1-46- idi Tolerance tests for inhibitory products;

[0080] Figure 10 To construct an engineered strain E. coli MG1655 Δ mgsA Δ pta M1-37-dxs M1-46- idi 、 E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc M1-37- dxs M1-46- idi Growth in a complex of cellulose hydrolysate at a certain concentration;

[0081] Figure 11 This is the pTrc99A-phlD vector and the verification map. The thin arrows above the nucleic acid sequence indicate the sequencing alignment;

[0082] Figure 12 This is the pTrc99A-dha-aldH vector and the verification map. The thin arrow above the nucleic acid sequence is the sequencing alignment;

[0083] Figure 13 For constructing an engineered strain E. coli MG1655 Δ mgsA Δ pta M1-37- dxs M1-46- idi 、 E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc M1-37- dxs M1-46- idi For the product synthesis ability of short-chain fatty acids;

[0084] Figure 14 For constructing an engineered strain E. coli MG1655 Δ mgsA Δ pta M1-37- dxs M1-46- idi 、 E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc M1-37- dxs M1-46- idi For the product synthesis ability of long-chain fatty acids;

[0085] Figure 15 For constructing an engineered strain E. coli MG1655 Δ mgsA Δ pta M1-37- dxs M1-46- idi 、 E. coli MG1655 Δ mgsA::tErg9 Δ pta::shcM1-37- dxs M1-46- idi For the product synthesis ability of trihydroxypropionic acid;

[0086] Figure 16 To construct an engineered strain E. coli MG1655 Δ mgsA Δ pta M1-37- dxs M1-46- idi 、 E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc M1-37- dxs M1-46- idi For the product synthesis ability of phloroglucinol. Specific implementation manner

[0087] The following combines examples to further describe in detail the specific implementation manner of the present invention. The following examples are used to illustrate the present invention and will help those skilled in the art to further understand the present invention, but are not used to limit the scope of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the concept of the present invention, several changes and improvements can still be made. These all belong to the protection scope of the present invention.

[0088] The present invention provides a recombinant bacterium for improving the robustness of Escherichia coli, its construction method and application; the recombinant bacterium contains a non-natural membrane component, which remodels its cell membrane, thereby comprehensively improving the robustness and product synthesis ability of Escherichia coli. The non-natural membrane component is from Alicyclobacillus acidocaldarius, a thermophilic acidophilic archaeon that can adapt to extreme environments. The recombinant bacterium of the present invention has the following characteristics: A. It contains an exogenous artificial synthesis pathway that does not exist in E. coli ; B. The artificially introduced pathway can synthesize the non-natural membrane component hopanoids and insert them into Figure 1 ; C. Different from the previous transformation of its natural components, the cell membrane of this recombinant bacterium contains a brand-new non-natural membrane component, and the tolerance and product synthesis ability of the recombinant engineering bacterium are significantly improved. E. coli the phospholipid bilayer of the cell membrane to make E. coli the cell membrane remodelled; C. Different from the previous transformation of its natural components, the cell membrane of this recombinant bacterium contains a brand-new non-natural membrane component, and the tolerance and product synthesis ability of the recombinant engineering bacterium are significantly improved.

[0089] Specifically, the Escherichia coli CRISPR-Cas9 system consists of two basic plasmids, pCas and pTargetF. The plasmid pCas is an Escherichia coli episomal plasmid, containing an L-arabinose-inducible expression Red recombinase element, the coding gene of the Cas9 protein Cas9 、a temperature-sensitive element and thesgRNA , kanamycin resistance gene KanR Etc. All plasmids containing pCas derivatives must be cultured at 30°C to ensure that the plasmids can replicate normally without loss. Plasmid pTargetF is an E. coli free plasmid containing the spectinomycin resistance gene aadA and promoter pJ23119 for transcription of sgRNA.

[0090] According to the sequence of the target editing site, primers are designed to amplify a 20-base sequence that matches the target site.

[0091] Column (N20), then clone the sequence into the pTargetF vector to obtain a knockout plasmid; secondly, transform the plasmid pCas into the host cell, induce the λ-Red recombination system to express, prepare competent cells, and then transform the knockout plasmid pTargetF and DonorDNA into competent cells for gene editing and recombination, spread culture to obtain transformants, and sequence to verify the genome recombination; then, induce the plasmid repair system on the pCas plasmid in the strain to cut the pTargetF knockout plasmid to complete a round of genetic modification. The above work can be performed in sequence to modify multiple gene sites in the host genome to achieve gene deletion or insertion; finally, culture at 37°C to eliminate the pCas plasmid.

[0092] Example 1 E.coli Construction of MG1655 CRISPR-Cas9 system

[0093] (1) Transformation of the basic plasmid pCas into Escherichia coli by heat shock transformation

[0094] Preparation of E. coli E. coli MG1655 competent state, the plasmid pCas was transformed into the cell to obtain the recipient bacteria containing the pCas plasmid E. coli MG1655 / pCas.

[0095] (2) Preparation of competent cells for electroporation of recipient bacteria

[0096] a. Escherichia coli containing pCas plasmid ( E. coli MG1655 / pCas) was inoculated into liquid LB medium (containing kanamycin at a final concentration of 50 μg / mL) and cultured at 30°C and 220 rpm / min until the logarithmic phase.

[0097] b. Inoculate into a 50 mL Erlenmeyer flask containing 20 mL of LB medium (with a final kanamycin concentration of 50 μg / mL) at an inoculation amount of 1%. Incubate at 30 °C and 200 rpm / min until the OD600 reaches 0.2 - 0.3, then add an L - arabinose inducer with a final concentration of 10 mmol / L to fully express the λ - Red recombinase on pCas. Stop culturing when OD 600 reaches 0.4 - 0.5 (2 - 3 h).

[0098] c. Transfer the culture broth into a 50 mL sterile centrifuge tube in a laminar flow hood and place it on ice for 15 min.

[0099] d. Centrifuge the bacterial suspension in the centrifuge tube at 4 °C and 6000 rpm for 10 min.

[0100] e. Discard the supernatant, add 20 mL of pre - cooled ddH 2 O to gently resuspend the bacterial cells, centrifuge at 4 °C and 6000 rpm for 10 min; repeat the operation once again.

[0101] f. Discard the supernatant, add 20 mL of pre - cooled 10% glycerol to gently resuspend the bacterial cells, centrifuge at 4 °C and 6000 rpm for 10 min.

[0102] e. Discard the supernatant, resuspend the bacterial cells in 5 mL of pre - cooled 10% glycerol, aliquot 50 - 80 μL of competent cells into 1.5 mL centrifuge tubes each, and place them on ice for standby.

[0103] (3) Transformation of pTargetF - N20 plasmid and DonorDNA

[0104] a. Add the DNA to be transformed into the competent cells, gently mix evenly, and place on ice for 30 min;

[0105] b. Transfer the mixture into a pre - cooled 2 mm electroporation cuvette, place it on ice for at least 2 min, and wait for electroporation;

[0106] c. Turn on the electroporator and set the parameters to 2.5 kV;

[0107] d. Take out the electroporation cuvette from the ice, blot the surface moisture with a tissue paper, put it into the sample chamber for electroporation. Immediately after electroporation, add room - temperature LB medium to resuspend the cells, recover at 30 °C for 2 h, spread on an LB plate containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin, and culture at 30 °C overnight;

[0108] e. Pick the clones grown on the plate and perform colony PCR verification using the verification primers [for the editing verification of the MgsA locus, the verification primers are (MgsA-L-up1: TCACATGAGGCCTGCCAG SEQ ID NO.12

[0109] & MgsA-R-down1: GCCGATTCCGGTAAAGCT SEQ ID NO.13

[0110] ), for the editing of the pta locus, the verification primers are pta-L-up1: TGAGCGTTGACGCAATCASEQ ID NO.14 & pta-R-down1: GATCCTGAGGTTAATCCTTCAAA SEQ ID NO.15], and obtain the correct gene-edited strains.

[0111] (4) Elimination of the pTargetF-N20 plasmid

[0112] a. Inoculate the verified gene-edited clones into 5 mL of LB medium (containing kanamycin at a final concentration of 50 μg / mL), add IPTG at a final concentration of 0.5 mM to induce the transcription of sgRNA on the pCas plasmid, culture at 30 °C for 12 - 16 hours, and use an inoculation loop to dip an appropriate amount of bacterial liquid and streak it on an LB plate containing kanamycin at a final concentration of 50 μg / mL;

[0113] b. Pick 20 - 30 isolated single colonies and spot them one by one on a plate containing kanamycin at a final concentration of 50 μg / mL, a plate containing kanamycin at a final concentration of 50 μg / mL, and a double-antibiotic plate containing 50 μg / mL of spectinomycin. The plate is cultured at 30 °C. Pick the single colonies that do not grow on the double-antibiotic plate but grow on the kanamycin plate for expansion and preservation. This single colony is a new strain that has eliminated the pTargetF plasmid but retained the pCas plasmid, such as Figure 2 .

[0114] c. Transform the other gene integration plasmids constructed into the above strains, screen to obtain gene integration strains, and then

[0115] perform the elimination of the knockout plasmid to achieve cyclic genome editing. For example: First, transform the pTargetF-N20 plasmid and DonorDNA constructed according to M1-93-tErg9 into Escherichia coli competent cells containing the pCas plasmid, and then perform the elimination of the pTargetF-N20 plasmid; then transform another pTargetF-N20 plasmid and DonorDNA constructed according to M1-93-shc into the strain retaining the pCas plasmid obtained previously, and then perform the elimination of the pTargetF-N20 plasmid;

[0116] Finally, eliminate the basic plasmid pCas. This example details the operation steps of CRISPR-Cas9, and Examples 2 and 3 utilize the specific operations of CRISPR.

[0117] (5) Elimination of the basic plasmid

[0118] After genome editing, inoculate the genome-edited strain containing only the pCas plasmid into LB medium, culture overnight at 37 °C without adding any antibiotics, dip an inoculation loop into an appropriate amount of the bacterial solution and streak it on an LB plate; dilute and spread it on an LB plate, and culture at 37 °C. Pick 20 - 30 isolated single colonies and spot them one by one on an LB plate without any antibiotics (cultured at 37 °C) and an LB plate containing kanamycin at a final concentration of 50 μg / mL (cultured at 30 °C). Pick the single colonies that do not grow on the kanamycin LB plate but grow on the corresponding LB plate. This single colony is the strain with the basic plasmid pCas eliminated, and finally, a gene-edited strain without any plasmids is obtained.

[0119] Example 2: E. coli MG1655 Δ mgsA and E. coli MG1655 Δ mgsA::tErg9 Construction of the strain

[0120] (1) Design primers according to the upstream and downstream sequences of the Escherichia coli mgsA gene. According to the Escherichia coli genome sequence published on NCBI, find the methylglyoxal synthase gene mgsA (Accession IDs: G6497 (EcoCyc)) sequence. Select the cleavage site N20 (AACGTCAACGCGATGTTGAG SEQ ID NO.16) on the mgsA gene, and design the bidirectional amplification primers for pTargetF whole plasmid PCR to obtain the pTargetF- mgsA knockout plasmid, as Figure 3 shown. Among them, the primers are as follows:

[0121] pTargetF-mgsA-up:

[0122] gtcctaggtataatactagtAACGTCAACGCGATGTTGAGgttttagagctagaaatagcSEQ ID NO.17

[0123] pTargetF-down:

[0124] actagtattatacctaggactgag SEQ ID NO.18

[0125] (2) Amplify by PCR mgsA The primers for the upstream homologous arm and downstream homologous arm for knockout are as follows:

[0126] a) Amplify mgsA The primer for the upstream homologous arm for knockout, with the template being the genome of Escherichia coli K-12 substr. MG1655 (Strain):

[0127] MgsA-L up1: TCACATGAGGCCTGCCAGSEQ ID NO.12

[0128] MgsA-L-KO down:

[0129] CTGATGAGCTGGGTGGAACGATCCAGTCGCCGCATTTCAASEQ ID NO.19

[0130] b) Amplify mgsA The primer for the downstream homologous arm for knockout, with the template being the MG1655 genome:

[0131] MgsA-R up: CGTTCCACCCAGCTCATCAGSEQ ID NO.20

[0132] MgsA-R down1: GCCGATTCCGGTAAAGCTSEQ ID NO.21

[0133] c) Amplify mgsA The primer for the DonorDNA1 fragment for knockout, with the template being the recombinant fragment of a + b above (the sequence is SEQ ID NO.8):

[0134] MgsA-L up2: CAACACGCTGGCCGAAGTSEQ ID NO.22

[0135] MgsA-R down2: CTCGCCATTACCTCAACGGSEQ ID NO.23

[0136] (3) Amplify M1-93- by PCR tErg9 The upstream homologous arm, downstream homologous arm for replacement, and the artificial regulatory element M1-93 tErg9 , and the primers are as follows:

[0137] d) Amplify tErg9Replace the upstream homologous arm primer, with the MG1655 genome as the template:

[0138] MgsA-L up1: TCACATGAGGCCTGCCAGSEQ ID NO. 12

[0139] MgsA-L down: ATCCAGTCGCCGCATTTCAASEQ ID NO. 24

[0140] e) Amplify the artificial regulatory element M1-93, with the M1-93 genome as the template

[0141] M1-tErg9-up: TTGAAATGCGGCGACTGGATTTATCTCTGGCGGTGTTG SEQ ID NO. 25;

[0142] M1-tErg9-down: AATTGTAATAGCTTTCCCATAGCTGTTTCCTGGTTTAAAC SEQ ID NO. 26;

[0143] f) Amplify tErg9 The upstream and downstream primers, with the yeast BY4742 genome as the template:

[0144] tErg9-up: ATGGGAAAGCTATTACAATTGGC SEQ ID NO. 27

[0145] tErg9-down: CTGATGAGCTGGGTGGAACGTCAGTACTCTTCTTCTTGTTGGG SEQ ID NO. 28

[0146] g) Amplify tErg9 Replace the downstream homologous arm primer, with the MG1655 genome as the template:

[0147] MgsA-R up: CGTTCCACCCAGCTCATCAGSEQ ID NO. 20

[0148] MgsA-R down1: GCCGATTCCGGTAAAGCTSEQ ID NO. 21

[0149] h) Amplify the primers for the DonorDNA2 fragment of M1-93-tErg9, with the homologous recombination product of the above four fragments d+e+f+g (the sequence is SEQ ID NO. 9) as the template:

[0150] MgsA-L up2: CAACACGCTGGCCGAAGT SEQ ID NO. 22

[0151] MgsA-R down2: CTCGCCATTACCTCAACGG SEQ ID NO. 23;

[0152] After recombining a + b (the said sequence is SEQ ID NO. 8) and recombining d + e + f + g (the said sequence is SEQ ID NO. 9) using one-step homologous recombination technology, then, perform one round of PCR amplification to recover the target fragment, obtaining DonorDNA1 and DonorDNA2 respectively. Subsequently, the pTargetF- mgsA knockout plasmid and the DonorDNA1 fragment or the pTargetF- mgsA knockout plasmid and the DonorDNA2 fragment are co-transformed into the MG1655 strain containing the pCas9 plasmid. Use the CRISPR-Cas9 technology to complete gene knockout or replacement, and screen to obtain the control bacteria mgsA that have successfully knocked out E. coli MG1655 ΔmgsA or the engineered bacteria tErg9 that have replaced the artificial element M1-93- E. coli MG1655 ΔmgsA::tErg9. The specific transformation steps are the same as in Example 1.

[0153] Example 3: E. coli MG1655 Δ mgsA Δ pta and E. coli MG1655 Δ mgsA::tErg9 Δ pta:: shc Construction of strains

[0154] (1) Design primers according to the upstream and downstream sequences of the Escherichia coli pta gene. According to the Escherichia coli genome sequence published on NCBI, find the sequence of the phosphotransacetylase gene pta (Accession IDs: EG20173 (EcoCyc)). Select the cleavage site N 20 (GCTGATTCCGCTGCGGCCTT SEQ ID NO. 29) on the pta gene, and design the bidirectional amplification primers for pTargetF whole plasmid PCR to obtain the pTargetF- pta knockout plasmid, as Figure 4 shown, where the primers are as follows:

[0155] pTargetF-pta-up:

[0156] gtcctaggtataatactagtGCTGATTCCGCTGCGGCCTTgttttagagctagaaatagcSEQ ID NO.30;

[0157] pTargetF-down:

[0158] actagtattatacctaggactgagSEQ ID NO.18;

[0159] (2) Amplify by PCR pta The upstream and downstream homologous arms for knockout, and the primers are as follows:

[0160] a) Amplify pta The primers for the upstream homologous arm for knockout, with the template being the MG1655 genome:

[0161] pta-L up1: TGAGCGTTGACGCAATCASEQ ID NO.14;

[0162] pta-L-KO down: AGCTGCGGATGATGACGAGAGGTTTATCCTCTTTCGTTACCGSEQ ID NO.31;

[0163] b) Amplify pta The primers for the downstream homologous arm for knockout, with the template being the MG1655 genome:

[0164] pta-R up: TCTCGTCATCATCCGCAGSEQ ID NO.32;

[0165] pta-R down1: GATCCTGAGGTTAATCCTTCAAASEQ ID NO.15;

[0166] c) Amplify pta The primers for the DonorDNA3 fragment for knockout, with the template being the recombinant fragment of a + b above (the sequence is SEQID NO.10):

[0167] pta-L up2: TGACCAAAGAGTCTGGCCTSEQ ID NO.33;

[0168] pta-R down2: GTCGTGAACAGCTGTACGCSEQ ID NO.34;

[0169] (3) By the method of artificial synthesis, according to E. coliCodon-optimized synthesis from Alicyclobacillus acidocaldarius shc and amplify the upstream homologous arm, downstream homologous arm, and artificial regulatory element M1-93 with replacement by PCR shc using the following primers: shc

[0170] d) Amplify shc Upstream homologous arm primers with MG1655 genome as template:

[0171] pta-L up1: TGAGCGTTGACGCAATCA SEQ ID NO.14;

[0172] pta-L down: GGTTTATCCTCTTTCGTTACCG SEQ ID NO.35;

[0173] e) Amplify artificial regulatory element M1-93 with M1-93 genome as template:

[0174] M1-SMO-up: GTAACGAAAGAGGATAAACCTTATCTCTGGCGGTGTTG SEQ ID NO.36;

[0175] M1-SMO-down: CCCAGTTCGATGCTGCTCATAGCTGTTTCCTGGTTTAAAC SEQ ID NO.37;

[0176] f) Amplify shc Upstream and downstream primers with the synthesized vector plasmid containing shc as template ( Figure 5 ):

[0177] shc-up: ATGGCTGAACAGCTGGTTGA SEQ ID NO.38;

[0178] shc-down: CTGCGGATGATGACGAGATTAACGACGTTCAATTGCCTGT SEQ ID NO.39;

[0179] g) Amplify shc Downstream homologous arm replacement primers with MG1655 genome as template:

[0180] pta-R up: TCTCGTCATCATCCGCAG SEQ ID NO.32;

[0181] ​pta-R down1: GATCCTGAGGTTAATCCTTCAAASEQ ID NO. 15;

[0182] h) Primers for amplifying the DonorDNA4 fragment, with the template being the homologous recombination product of the above four fragments (the sequence is SEQ ID NO. 11):

[0183] pta-L up2: TGACCAAAGAGTCTGGCCTSEQ ID NO. 33;

[0184] pta-R down2: GTCGTGAACAGCTGTACGCSEQ ID NO. 34;

[0185] After recombining a + b (the sequence is SEQ ID NO. 10) and d + e + f + g (the sequence is SEQ ID NO. 11) using the one-step homologous recombination technique, followed by one round of PCR amplification to recover the target fragments, obtaining DonorDNA3 and DonorDNA4 respectively. Subsequently, the pTargetF- pta knockout plasmid and the DonorDNA3 fragment or the pTargetF- pta knockout plasmid and the DonorDNA4 fragment were co-transformed into the E. coli MG1655 Δ mgsA or E. coli MG1655 Δ mgsA::tErg9 strains respectively. Using the CRISPR-Cas9 technology to complete gene knockout or replacement, and screening to obtain the control strain with successful knockout of pta or the engineered strain with replacement of the artificial element M1-93- E. coli MG1655 Δ mgsA Δ pta . The specific transformation steps are the same as in Example 1. shc The engineered strain E. coli MG1655 ΔmgsA ::tErg9 Δ pta::shc .

[0186] Example 4: Regulation of the rate-limiting enzyme Dxs of the endogenous pathway in the recombinant strain E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc

[0187] By the λ-Red one-step recombination method for the E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc recombinant strain constructed in Example 3 and its control strain​E. coli MG1655 Δ mgsA Δ pta Regulate the expression of the rate-limiting enzymes Dxs and Idi in the endogenous pathway.

[0188] Use the λ-Red one-step recombination method to dxs Replace the in-situ promoter of the gene expression:

[0189] First, chemically transform the pKD46 plasmid into E. coli MG1655 ΔmgsA::tErg9 Δpta::shc strains or control strains E. coli MG1655 Δ mgsA Δ pta , pick a single colony into a liquid medium, culture at 30 °C and 220 rpm until OD 550 ~0.3, place on ice for 30 min, then centrifuge at 6000 rpm at 4 °C for 5 min to prepare electrocompetent cells;

[0190] Electrotransform the constructed recombinant fragment FKF::M1-37-dxs into the competent cells and culture at 30 °C to obtain transformants;

[0191] Replace the M1-37 promoter with its own promoter on the chromosome through one-step recombination to achieve precise regulation dxs of dxs the transcription level.

[0192] The recombinant fragment FKF::M1-37-dxs was obtained by PCR amplification and recovery of the target fragment, with the M1-37 genome as the template and the primers as follows:

[0193] Dxs-M1-up: ACTACATCATCCAGCGTAATAAATAAACAATAAGTATTAATAGGCCCCTGAGGAACACTTAACGGCTGACSEQ ID NO.40;

[0194] Dxs-M1-down: GTGGAGTCGACCAGTGCCAGGGTCGGGTATTTGGCAATATCAAAACTCATAGCTGTTTCCTGGTTTAAACSEQ ID NO.41;

[0195] Eliminate the temperature-sensitive plasmid pKD46 by high-temperature induction at 37 °C to obtain dxs the engineered strain after transformation E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc M1-37- dxsand the corresponding control strains E. coli MG1655 Δ mgsA Δ pta M1-37- dxs 。

[0196] Example 5: Recombinant strains E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc M1-37- dxs and its control strain E. coli MG1655 ΔmgsA Δpta Regulation of the endogenous pathway rate-limiting enzyme Idi of M1-37-dxs

[0197] The specific operation method is the same as that in Example 4. The difference is that the primer sequences of the recombinant fragment FKF::M1-46-idi are as follows, and the template is the M1-46 genome:

[0198] Idi-M1-up: TCACTTGGTTAATCATTTCACTCTTCAATTATCTATAATGATGAGTGATCAGGAACACTTAACGGCTGACSEQ ID NO. 42;

[0199] Idi-M1-down: CCCGTGGGAACTCCCTGTGCATTCAATAAAATGACGTGTTCCGTTTGCATAGCTGTTTCCTGGTTTAAACSEQ ID NO. 43.

[0200] Example 6: Recombinant strains E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc M1-37- dxs M1-46- idi Tolerance analysis

[0201] Pick the E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc M1-37- dxs M1-46- idi recombinant strains constructed in Example 5 for tolerance tests of various compounds.

[0202] In addition, for comparison, the control strain constructed in Example 5 E. coli MG1655 Δ mgsA Δ pta M1-37- dxs M1-46- idi is tested in the same way.

[0203] The specific operation steps are as follows:

[0204] Pick the monoclonal that has been activated by streaking and inoculate it into 15 mL of MOPS medium. Incubate overnight at 37°C and 200 rpm until the logarithmic phase (OD550 ~ 1.5 - 2.0); measure the OD 550 ; Select common substrates (such as formaldehyde, formic acid, methanol) and common products (such as octanoic acid, TAL) as test inhibitors. Dilute the bacterial liquid cultured to the logarithmic phase with MOPS medium containing a certain concentration of inhibitor to OD 550 ~0.1; Take 200 μL and add it to a 96-well plate (in triplicate); Use the bacterial liquid diluted with MOPS medium without any inhibitor as a control to monitor the growth status of the strain. Use an enzyme-linked immunosorbent assay (ELISA) reader to perform OD 550 value readings every 10 minutes continuously for 24 hours and then terminate the measurement; Finally, plot the growth curve and compare the μ values by fitting the exponential trend line in the logarithmic phase to determine the tolerance of the engineered bacteria to the inhibitor.

[0205] The results of the broad-spectrum tolerance test show that the tolerance of the engineered strain after transformation has been significantly improved. First, the engineered strain has improved its tolerance to adverse industrial conditions ( Figure 6 ), such as at a high temperature of 42°C, the specific growth rate has increased by 312%; under a high osmotic pressure condition of 35 g / L NaCl, the specific growth rate has increased by 167%; under a strong oxidation condition of 5 Mm H2O2, the specific growth rate has increased by 60%. In addition, it has improved its tolerance to cellulose hydrolysate ( Figure 7 ), one-carbon compounds ( Figure 8 ), and inhibitory products such as organic acids and organic alcohols ( Figure 9 ); When measuring the glucose consumption of the cellulose hydrolysate complex (20 g / L glucose + 2 g / L HMF + 5 g / L levulinic acid + 0.5 g / L vanillic acid), it was found that the control strain did not grow, while the highest OD value of the engineered strain was nearly 3.0 and the glucose consumption reached 10 g / L ( Figure 10 ).

[0206] Example 7: Recombinant strain E. coli MG1655 Δ mgsA::tErg9 Δ pta::shc M1-37- dxs M1-46- idi Analysis of product synthesis ability

[0207] A recombinant Escherichia coli with enhanced robustness constructed by the present invention can be used as a chassis cell to produce a variety of target compounds, such as the product display of different compounds like short- and long-chain fatty acids, trihydroxypropionic acid, phloroglucinol, etc., and specifically includes the following steps:

[0208] (1) Respectively transfer the utilization plasmids of different products into the control bacteria and the engineered bacteria;

[0209] (2) Further, in step (1), the product utilization plasmids are as follows in the table:

[0210]

[0211] Among them, for the phlD gene on the pTrc99A-phlD vector and the dha-aldH gene of pTrc99A-dha-aldH, both were entrusted to GENEWIZ (Suzhou Genewiz Biotechnology Co., Ltd.) for optimization and conventional synthesis. They are respectively the phloroglucinol synthase gene from Pseudomonas protegens, the glycerol dehydratase gene dhaB from Klebsiella pneumoniae 21, and the aldehyde dehydrogenase gene aldH from Ralstonia eutropha. The genes were cloned into the vector pCDFDuet-1 (Spectinomycin) to prepare mini-scale recombinant plasmid DNA and stab cultures containing the recombinant plasmid.

[0212] After obtaining the recombinant plasmid in this laboratory, the synthesized genes were constructed into the pTrc99A vector by the method of Gibson homologous recombination. Specifically:

[0213] By designing primers containing homologous sequences on the left and right sides of the insertion site of the pTrc99A vector, the primer sequences are as follows:

[0214] Vector backbone primers:

[0215] 99A-F: TACGTGATTGATAAATCCGCSEQ ID NO. 44;

[0216] 99A-R: GGTCTGTTTCCTGTGTGAAASEQ ID NO. 45;

[0217] PhlD gene:

[0218] phlD-up: TTTCACACAGGAAACAGACCATGAGCACCCTGTGCCTGSEQ ID NO. 46;

[0219] PhlD-down: GCGGATTTATCAATCACGTATTACGCGGTCCATTCGCCSEQ ID NO. 47;

[0220] dha-aldH gene:

[0221] 3-HP-up: TTTCACACAGGAAACAGACCATGTATCAGGATCTGGCGCTSEQ ID NO. 48;

[0222] 3-HP-down: GCGGATTTATCAATCACGTAttaattcgcctgaccggcSEQ ID NO. 49;

[0223] The vector backbone and gene fragments were separately cloned by PCR. After purifying and recovering the PCR products, seamless cloning of the vector backbone and gene fragments was carried out. The assembled products were used for heat shock transformation to screen monoclonal colonies for sequencing verification to obtain the target plasmids pTrc99A-phlD (the vector and verification map are shown in Figure 11 ) and pTrc99A-dha-aldH (the vector and verification map are shown in Figure 12 ).

[0224] (3) For long-chain and short-chain fatty acids, culture in MOPS + 2% (wt / v) Glucose medium;

[0225] For 3-hydroxypropionic acid, culture in M9 + 2% (wt / v) Glycerol medium;

[0226] For phloroglucinol, culture in M9 + 2% (wt / v) Glucose medium;

[0227] Among them: The formula of MOPS medium is:

[0228]

[0229] 40X “M”

[0230]

[0231] Among them, the components of the micronutrient solution are:

[0232]

[0233] ZnCl 2 solution, Na 2 SeO 3 solution, Na 2 MoO 4 The solution components are:

[0234]

[0235] The formula of M9 + 2% (wt / v) Glycerol medium is:

[0236]

[0237] The formula of M9 + 2% (wt / v) Glucose medium is:

[0238]

[0239] 5X M9 salts

[0240]

[0241] Using 0.1 mM IPTG as the inducer, culturing at 30 °C for 72 h, and sampling every 24 h during this period. The supernatant of the short-chain and long-chain fatty acid fermentation broth was analyzed by GC-MS after extraction and esterification; the fermentation broth of trihydroxypropionic acid and phloroglucinol was analyzed by high-performance liquid chromatography after centrifugation and filtration. Finally, the engineered strain significantly improved the synthesis ability of common target products such as short-chain fatty acids ( Figure 13 ), long-chain fatty acids ( Figure 14 ), trihydroxypropionic acid ( Figure 15 ), and phloroglucinol ( Figure 16 ). It can be seen that the present invention uses genetic engineering technology to introduce an artificial synthesis pathway into Escherichia coli and combines the optimization of the endogenous pathway, which can effectively improve the tolerance of the recombinant engineered strain.

[0242] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art can make various changes or modifications within the scope of the claims, which do not affect the essence of the present invention. Without conflict, the embodiments of the present application and the features in the embodiments can be combined with each other arbitrarily.

Claims

1. A recombinant Escherichia coli with increased production of a target compound, characterized in that, the recombinant Escherichia coli is a recombinant Escherichia coli into which non-natural membrane component hopanoids are introduced; the synthesis of the non-natural membrane component hopanoids is carried out through the combination of the endogenous MEP pathway of Escherichia coli and the introduced exogenous artificial synthesis pathway; the target compound is long-chain fatty acid, trihydroxypropionic acid and phloroglucinol; the construction method of the recombinant Escherichia coli includes: (1) Replace the methylglyoxal synthase gene with the sequence shown in SEQ ID NO. 1 in Escherichia coli E. coli MG1655 with the truncated squalene synthase gene with the sequence shown in SEQ ID NO. 2 mgsA and use the artificial promoter strategy to upregulate tErg9 its expression; tErg9 ​ (2)Replace the phosphoacetyltransferase gene with the sequence shown in SEQ ID NO. 3 in the Escherichia coli obtained in step (1) pta with the squalene-hopene cyclase gene with the sequence shown in SEQ ID NO. 4 shc , and up-regulate the shc expression using the artificial promoter strategy to obtain a recombinant engineering bacterium; (3)Steps for artificially regulating the key rate-limiting enzymes of the endogenous MEP pathway of the obtained recombinant engineering bacteria: replacing the promoters of the 1-deoxy-D-xylulose-5-phosphate synthase gene Dxs and the isopentenyl pyrophosphate isomerase gene idi with the artificial enhanced promoters M1-37 and M1-46 respectively; the nucleotide sequence of M1-37 is shown in SEQ ID NO. 6, and the nucleotide sequence of M1-46 is shown in SEQ ID NO.

7.

2. A recombinant Escherichia coli, characterized in that, The recombinant Escherichia coli is Escherichia coli Escherichia coli Strain Hop1, with the preservation number of CGMCC NO.26270.

3. Use of the recombinant Escherichia coli according to claim 1 in the production of a target compound by a chassis cell, wherein the target compound is long-chain fatty acid, trihydroxypropionic acid and phloroglucinol.

Images