One-step detection method for urinary tract infection escherichia coli with non-disease diagnosis or non-treatment purpose

Abstract

The invention relates to the technical field of rapid detection methods, in particular to a one-step detection method for urinary tract infection escherichia coli with a non-disease diagnosis or non-treatment purpose. According to recombinase polymerase amplification provided by the invention, target DNA is specifically amplified through primers, CRISPR / Cas12a specifically recognizes a target sequence through crRNA, and through double screening of RPA and CRISPR / Cas12a, the target sequence is specifically recognized through crRNA; the rapid, sensitive and specific detection on the Escherichia coli infected with the urinary tract can be realized. Meanwhile, an RPA primer, crRNA and reaction conditions are optimized, so that an RPA reaction system and a CRISPR / Cas12a reaction system can be premixed in a tube, and the reaction can be completed only by a one-step method. The method can specifically detect urinary tract infection escherichia coli and has no cross reaction with common pathogenic bacteria, optimized conditions can avoid the competitive effect of CRISPR / Cas12a and RPA, the reaction rate and sensitivity are guaranteed, and meanwhile, the risk of nucleic acid aerosol pollution is also avoided due to the fact that a cover does not need to be opened.

Description

Technical Field

[0001] The present invention relates to the technical field of rapid detection methods, and particularly to a one-step detection method for Escherichia coli in urinary tract infections for non-disease diagnosis or non-therapeutic purposes. Background Art

[0002] Uropathogenic Escherichia coli (UPEC) is one of the most common pathogens causing urinary tract infections, and its infection route usually involves migration from the intestine to the urinary system. UPEC is part of the intestinal flora and usually resides in the intestine, coexisting with the human body. Under normal circumstances, the beneficial flora in the intestine can inhibit the growth and spread of UPEC. However, when the balance of the intestinal flora is disrupted or the host's defense mechanism is damaged, UPEC may overgrow and migrate from the intestine to the urinary system.

[0003] Conventional detection methods for Uropathogenic Escherichia coli (UPEC) cover a variety of techniques, including microbial culture, molecular biology detection (such as polymerase chain reaction, PCR), and mass spectrometry analysis. Microbial culture, as a traditional method for detecting UPEC, is considered the gold standard for detection. This method involves inoculating urine samples onto specific culture media and then culturing the bacteria under suitable conditions. Based on the bacterial culture, the biochemical characteristics of the bacteria are observed to confirm whether it is UPEC. However, this method takes a long time, usually 12 - 24 hours to complete, requires professional laboratory equipment and operators, and some UPEC strains that do not grow or grow slowly may not be detected by the culture method. Other methods include molecular biology methods, usually including PCR and its derivative techniques, and immunological methods such as enzyme-linked immunosorbent assay. Methods such as PCR usually require expensive laboratory equipment and professional technical personnel for operation, and immunological methods have detection windows. Although molecular biology methods are highly sensitive, they do not always meet the requirements of rapidity, low cost, and simple operation simultaneously. Mass spectrometry analysis identifies UPEC by analyzing the mass fingerprint of bacterial proteins or peptides, and there are also problems such as the high cost of mass spectrometers and the need for professional training for operation and maintenance.

[0004] To overcome these limitations, researchers are developing new detection techniques, such as the RPA-CRISPR / Cas12a method, which combines isothermal nucleic acid amplification and CRISPR gene editing technology, can complete the detection of UPEC in a shorter time, has simple operation, does not rely on expensive laboratory equipment, and is expected to become an ideal on-site rapid detection method.

[0005] However, the existing RPA-CRISPR / Cas12a method for detecting Escherichia coli in urinary tract infections still has some defects. For example, in the existing detection operation process, the RPA amplification reaction is first carried out, and then the PRA reaction product is transferred to the CRISPR / Cas12a reaction system. It is necessary to open the lid to transfer the amplification product, which increases the risk of aerosol contamination. In addition, there are also problems of relatively high cross-reactivity and the need for further improvement in sensitivity and specificity. Summary of the Invention

[0006] The object of the present invention is to provide a one-step detection method for Escherichia coli in urinary tract infections for non-disease diagnosis or non-therapeutic purposes, aiming at the problems existing in the prior art, such as the risk of aerosol contamination during detection, relatively high cross-reactivity, and the need for further improvement in sensitivity and specificity. By optimizing the RPA primers, crRNA and reaction conditions, under these optimized conditions, the RPA reaction system and the CRISPR / Cas12a reaction system can be premixed in one tube and the reaction can be completed by a one-step method, which can specifically detect UPEC without cross-reaction with common pathogenic bacteria, can avoid the competitive effect between CRISPR / Cas12a and RPA, ensuring the reaction rate and sensitivity. At the same time, since there is no need to open the lid, the risk of nucleic acid aerosol contamination is also avoided; secondly, the method provided by the present invention can achieve rapid, sensitive and specific detection of Escherichia coli in urinary tract infections.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is as follows: A one-step detection method for Escherichia coli in urinary tract infections for non-disease diagnosis or non-therapeutic purposes, comprising the following steps: Extract DNA from the sample to be tested; Add the extracted DNA into a reaction tube and mix it with the RPA-CRISPR / Cas12a premix in the reaction tube; react at 37 °C to 42 °C for 25 min to 30 min; Perform fluorescence method or lateral flow biosensing strip detection to check whether there is a signal of Escherichia coli in urinary tract infections; Wherein, the RPA-CRISPR / Cas12a premix includes RPA primers; The RPA primer sequences are: RPA-F: 5’-GTTTGAGTTTGTTGGCTTTGGCTGTTTCTG-3’, RPA-R: 5’-CCACGCATATTTACATCCTGACCGTTGGTT-3’; The RPA-CRISPR / Cas12a premix includes crRNA and ssDNA signal probe; The sequence of crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUCGGCAACGGGGAAUGCACGU-3’; The sequence of the ssDNA signal probe is: 5’-FAM-TTATT-BHQ-3’.

[0008] A rapid detection method for Escherichia coli causing urinary tract infection based on RPA-CRISPR / Cas12a provided by the present invention. RPA specifically amplifies target DNA through primers, and CRISPR / Cas12a specifically recognizes the target sequence through crRNA. Through the dual screening of RPA and CRISPR / Cas12a, rapid, sensitive and specific detection of Escherichia coli causing urinary tract infection can be achieved. At the same time, the RPA reaction system and CRISPR / Cas12a reaction system provided in this application can be premixed in one tube and the reaction can be completed by a one-step method, which can specifically detect UPEC, has no cross-reaction with common pathogenic bacteria, can avoid the competitive effect between CRISPR / Cas12a and RPA, ensures the reaction rate and sensitivity. At the same time, because there is no need to open the lid, the risk of nucleic acid aerosol contamination is also avoided, achieving unexpected technical effects.

[0009] Further, the sample to be tested is a pretreated urine sample; The pretreated urine sample is prepared by the following method: Take the urine to be tested and perform centrifugation. Discard the supernatant, take sterile water to resuspend the precipitate, and obtain the pretreated urine sample.

[0010] Further, the specific method for DNA extraction is as follows: Place the pretreated urine sample under the condition of heating at 95 °C to 100 °C, perform centrifugation, and take the supernatant to obtain the extracted DNA.

[0011] Further, heating is carried out using a metal bath or a water bath.

[0012] Further, heat for 5 min to 8 min.

[0013] Further, the rotation speed for centrifugation is 4000 rpm to 5000 rpm, and the centrifugation time is 30 s to 60 s.

[0014] The DNA extraction method provided by the present invention does not require extraction with a kit, has a low cost, and a short extraction time.

[0015] Further, add the extracted DNA into a reaction tube and mix it with the RPA-CRISPR / Cas12a premix in the reaction tube. Each 35 μL of the mixed material includes the following raw materials: 14.5 μL - 15 μL of RPA Basic reaction buffer, 1 μL - 1.5 μL of 280 mM MgOAc, 0.8 μL - 1.2 μL of 10 μM RPA-F, 0.8 μL - 1.2 μL of 10 μM RPA-R, 1 μL - 1.5 μL of DNA, 0.5 μL - 1 μL of 1 μM CRISPR / Cas12a, 1.5 μL - 2 μL of 1 μM crRNA, 0.5 μL - 1 μL of 10 μM ssDNA probe, 3 μL - 4 μL of 10X R2.1 buffer, and the balance is DEPC-treated water.

[0016] Further, perform fluorescence method or lateral flow biosensing strip to detect the signal of Escherichia coli causing urinary tract infection: if the fluorescence increases or the test line shows color, it indicates that the sample to be tested contains Escherichia coli causing urinary tract infection.

[0017] A rapid detection method for Escherichia coli causing urinary tract infection based on RPA-CRISPR / Cas12a provided by the present invention. RPA specifically amplifies the target DNA through primers, and CRISPR / Cas12a specifically recognizes the target sequence through crRNA. Through the double screening of RPA and CRISPR / Cas12a, rapid, sensitive and specific detection of Escherichia coli causing urinary tract infection can be achieved. At the same time, the reaction system and CRISPR / Cas12a reaction system provided by the present invention can be premixed in one tube and the reaction can be completed by a one-step method, which can specifically detect UPEC, has no cross-reaction with common pathogenic bacteria, can avoid the competitive effect between CRISPR / Cas12a and RPA, ensures the reaction rate and sensitivity. At the same time, because there is no need to open the lid, the risk of nucleic acid aerosol contamination is also avoided, achieving unexpected technical effects.

[0018] The one-step detection method for Escherichia coli causing urinary tract infection provided by the present invention has a fast reaction speed, and the one-step RPA-CRISPR / Cas12a does not require additional lid opening or centrifugation, and can complete the detection of UPEC in about 25 minutes.

[0019] The one-step detection method for Escherichia coli causing urinary tract infection provided by the present invention has high specificity. RPA specifically amplifies the target DNA through primers, and CRISPR / Cas12a specifically recognizes the target DNA through crRNA. Through the double screening of RPA and CRISPR / Cas12a, UPEC can be specifically detected, and there is no cross-reaction with common pathogenic bacteria.

[0020] 4. The one-step detection method for Escherichia coli in urinary tract infection provided by the present invention has high sensitivity. Through the double amplification of RPA and CRISPR / Cas12a, the UPEC target with a concentration of 2.8 copies / µL can be detected. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is a data graph of RPA primer analysis in the embodiment.

[0022] Figure 2 It is a data graph of crRNA screening in the embodiment.

[0023] Figure 3 It is a data graph of the process of condition optimization in the embodiment.

[0024] Figure 4 It is a data graph of the sensitivity test results in the embodiment.

[0025] Figure 5 It is a data graph of the specificity test results in the embodiment. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0026] In order to make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Embodiment

[0027] Aiming at the problems existing in the prior art, such as the risk of aerosol contamination during detection, relatively high cross-reactivity, and the need to further improve sensitivity and specificity.

[0028] This embodiment provides a one-step detection method for Escherichia coli in urinary tract infection for non-disease diagnosis or non-therapeutic purposes, including the following steps: Extract DNA from the sample to be tested; The sample to be tested is a pretreated urine sample; the pretreated urine sample is prepared by the following method: Take 1 mL of the urine sample to be tested and place it in a 1.5 mL PCR tube, centrifuge at 4000 rpm for 45 s; Discard the supernatant, add 100 μL of sterile water to resuspend the precipitate, and shake well to obtain the pretreated urine sample.

[0029] Place the pretreated urine sample in a metal bath or water bath at 95°C and heat for 5 min, centrifuge at 4000 rpm for 45 s, and take the supernatant, which is the extracted DNA sample.

[0030] Add the extracted DNA into a reaction tube and mix it with the RPA-CRISPR / Cas12a premix in the reaction tube; react at 39 °C for 25 min.

[0031] Perform fluorescence method or lateral flow biosensing strip to detect the signal of Escherichia coli causing urinary tract infection; if the fluorescence increases or the test line shows color, it indicates that the sample to be tested contains Escherichia coli causing urinary tract infection.

[0032] Among them, the RPA-CRISPR / Cas12a premix includes RPA primers; The RPA primer sequences are: RPA-F: 5’-GTTTGAGTTTGTTGGCTTTGGCTGTTTCTG-3’, RPA-R: 5’-CCACGCATATTTACATCCTGACCGTTGGTT-3’; The RPA-CRISPR / Cas12a premix includes crRNA and ssDNA signal probe; The sequence of crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUCGGCAACGGGGAAUGCACGU-3’; The sequence of ssDNA signal probe is: 5’-FAM-TTATT-BHQ-3’.

[0033] The RPA provided by the present invention specifically amplifies the target DNA through primers, and CRISPR / Cas12a specifically recognizes the target sequence through crRNA. Through the double screening of RPA and CRISPR / Cas12a, rapid, sensitive and specific detection of Escherichia coli causing urinary tract infection can be achieved. At the same time, the RPA reaction system and CRISPR / Cas12a reaction system provided by the present invention can be premixed in one tube and the reaction can be completed by one-step method, which can specifically detect UPEC, has no cross-reaction with common pathogenic bacteria, can avoid the competitive effect between CRISPR / Cas12a and RPA, ensures the reaction rate and sensitivity. At the same time, because there is no need to open the lid, the risk of nucleic acid aerosol contamination is also avoided, achieving unexpected technical effects.

[0034] In some embodiments, the specific method for extracting DNA is as follows: Place the pretreated urine sample under the condition of heating at 95 °C - 100 °C, perform centrifugation, take the supernatant to obtain the extracted DNA.

[0035] In some embodiments, heating is performed using a metal bath or a water bath.

[0036] In some embodiments, heat for 5 min - 8 min.

[0037] In some embodiments, the rotation speed for centrifugation is 4000 rpm to 5000 rpm, and the centrifugation time is 30 s to 60 s.

[0038] In some embodiments, the extracted DNA is added into a reaction tube and mixed with the RPA-CRISPR / Cas12a premixed solution in the reaction tube. For every 35 μL of the mixed material, it includes the following raw materials: 14.5 μL to 15 μL of RPA Basic reaction buffer, 1 μL to 1.5 μL of 280 mM MgOAc, 0.8 μL to 1.2 μL of 10 μM RPA-F, 0.8 μL to 1.2 μL of 10 μM RPA-R, 1 μL to 1.5 μL of DNA, 0.5 μL to 1 μL of 1 μM CRISPR / Cas12a, 1.5 μL to 2 μL of 1 μM crRNA, 0.5 μL to 1 μL of 10 μM ssDNA probe, 3 μL to 4 μL of 10X R2.1 buffer, and the balance is DEPC-treated water.

[0039] Specifically, this embodiment provides the exploration process of the rapid detection method of the embodiment: Step 1. Plasmid and clinical sample preparation The chuA gene of Escherichia coli causing urinary tract infection (GenBank: U67920.1) is selected as the detection target gene, and a plasmid carrying the chuA gene is synthesized by Sangon Biotech (Shanghai) Co., Ltd. The clinical strain is cultured in Luria-Bertani (LB) broth culture medium at a constant temperature of 37 °C with shaking (120 r / min) for 12 hours, heated at 95 °C for 5 minutes, and then centrifuged, and the supernatant is taken as the template.

[0040] Step 2. Primer design Using the chuA gene of Escherichia coli causing urinary tract infection as the detection target gene, according to the RPA primer design principle, 3 pairs of RPA forward and reverse candidate primers are designed using the primer design software Primer Premier 6, and the specificity of the primers is verified online using NCBI-BLAST. The primers and the target fragment are shown in Table 1, and all primers are synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0041] Table 1 Primer sequences Name Sequence (5’→3’) F1 TTACCTCGTTGCGTTTGAGTTTGTTGGCTTTG R1 GCAGTTTGATTTTCAGGAGCGGAAGTGTCG F2 GCGTTTGAGTTTGTTGGCTTTGGCTGTTTC R2 GCAGTTTGATTTTCAGGAGCGGAAGTGTCG F3 GTTTGAGTTTGTTGGCTTTGGCTGTTTCTG R3 CCACGCATATTTACATCCTGACCGTTGGTT Step 3. RPA amplification reaction system 14.7 μL of RPA Basic reaction buffer (the DNA isothermal rapid amplification kit (basic type) was purchased from AmpFuture (Changzhou) Biotechnology Co., Ltd.), 1.25 μL of 280 mM MgOAc, 1 μL of 10 μM upstream primer (F), 1 μL of 10 μM downstream primer (R), 1.2 μL of template, 5.85 μL of DEPC-treated water, for a total of 25 μL. The prepared reaction system is reacted at 39 °C for 15 minutes, and then the results can be observed.

[0042] Step 4. Reaction system of one-step RPA-CRISPR / Cas12a reaction The one-step reaction integrates the RPA reaction and the CRISPR / Cas12a (EnGen® Lba Cas12a (Cpf1) nuclease was purchased from NEB England Biolabs (Beijing)) reaction in one tube. The reaction system is as follows: 14.7 μL of RPA Basic reaction buffer, 1.25 μL of 280 mM MgOAc, 1 μL of 10 μM upstream primer (F), 1 μL of 10 μM downstream primer (R), 1.2 μL of template, 0.875 μL of 1 μM CRISPR / Cas12a, 1.75 μL of 1 μM crRNA, 0.875 μL of 10 μM ssDNA probe, 3.5 μL of 10X R2.1 buffer, 8.85 μL of DEPC-treated water, and the total volume of the system is 35 μL. Subsequently, the reaction is carried out at 37 °C for 25 minutes in a real-time fluorescence quantitative PCR instrument, and the fluorescence signal is observed in real time.

[0043] Step 5. Condition optimization RPA primer screening: Using the plasmid with the chuA gene of Escherichia coli with urinary tract infection at a concentration of 10 4 copies / μL as the template, and using DEPC-treated water instead of the plasmid as a control, amplify with different RPA primer pairs according to the conditions in Step 3. Subsequently, add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) extraction solution to the reaction tube, mix well, centrifuge at 12000 rpm for 5 min, aspirate the supernatant, and extract the amplification product. The amplification product is added with 6×SuperStain Loading Buffer at a ratio of 5:1, fully mixed, and electrophoresed on a 1.5% agarose gel at a constant voltage of 90 V for 30 min, and developed with a gel imager to observe the results. The results are as shown in Figure 1 A. According to the thickness of the bands of the amplification products, primer 3 has the best effect. The sensitivity of primer 3 is verified and can reach 10 1 copies / μL, as shown in Figure 1 B.

[0044] Figure 1 For A in it, screening of RPA primers for Escherichia coli causing urinary tract infection. Lane 1: 250 bp DNA Ladder; Lane 2: F1R1 control; Lane 3: F1R1 (172 bp); Lane 4: F2R2 control; Lane 5: F2R2 (162 bp); Lane 6: F3R3 control; Lane 7: F3R3 (250 bp).

[0045] Figure 1 For B in it, analysis of RPA amplification sensitivity of F3R3 primer set. Lane 1: 250 bp DNA Ladder; Lane 2: plasmid concentration 10 2 copies / μL; Lane 3: plasmid concentration 10 1 copies / μL; Lane 4: plasmid concentration 10 0 copies / μL; Lane 5: negative control.

[0046] (2) Design and screening of crRNA: Design crRNA according to the optimal RPA primer amplification sequence, and the specific sequences are shown in Table 2; React with different crRNAs in the system described in step 4, and select the best crRNA according to the intensity of the fluorescence signal and the time to reach the plateau. The results are as Figure 2 shown. The time for crRNA1 to reach the plateau is shorter and the end-point fluorescence value is higher, so crRNA1 is selected for the following experiments.

[0047] Table 2 Sequences of crRNA and ssDNA probes Name Sequence (5’→3’) crRNA1 UAAUUUCUACUAAGUGUAGAUCGGCAACGGGGAAUGCACGU crRNA2 UAAUUUCUACUAAGUGUAGAUGAAGGAACUACGUGCAUUCC ssDNA probe FAM-TTATT-BHQ (3) Optimization of CRISPR / Cas12a system: Using plasmid (2.82×10 4 copies / μL) as a template, optimize reaction conditions such as Cas12a concentration (25 nM, 50 nM, 75 nM, 100 nM), Cas12a / crRNA ratio (1:1, 1:1.5, 1:2), ssDNA probe concentration (150 nM, 250 nM, 350 nM), etc. Plot the fluorescence values at 25 min of reaction. The results are as Figure 3 in A Figure 3 in B Figure 3For C in it, the fluorescence values vary little at different Cas12a concentrations. Considering cost - effectiveness, the lowest concentration of 25 nM was selected as the final concentration. As the ratio of crRNA:Cas12a increases, the fluorescence value gradually increases, and finally the ratio of Cas12a:crRNA = 1:2 was selected as the final ratio. As the concentration of the ssDNA probe increases, the fluorescence value also increases, but there is no significant difference in the fluorescence values of the 250 nM and 300 nM ssDNA probes. Therefore, 250 nM probe was selected as the final concentration. Figure 3 A. Optimization of Cas12a concentration in it; Figure 3 B. Optimization of the Cas12a / crRNA ratio in it; Figure 3 C. Optimization of the ssDNA probe concentration in it; The concentration of the plasmid template used was 10 4 copies / μL; Error bars represent the standard deviation of three repeated experiments.

[0048] Step 6, Nucleic acid extraction method for Escherichia coli causing urinary tract infection Nucleic acids of Escherichia coli causing urinary tract infection were extracted by the boiling method. The suspension of Escherichia coli causing urinary tract infection was directly thermally lysed at 95 °C for 5 min, centrifuged, and the supernatant was used as the template for the RPA - CRISPR / Cas12a reaction.

[0049] Step 7, Sensitivity test of the one - step RPA - CRISPR / Cas12a detection method For the sensitivity detection using the plasmid as the template, the plasmid standard containing the chuA target fragment of Escherichia coli causing urinary tract infection was serially diluted to 2.8×10 2 copies / μL, 2.8×10 1 copies / μL and 2.8×10 0 copies / μL. At the same time, DEPC - treated water was used as a negative control. According to the optimized reaction system in Step 4, 1.2 μL of the plasmid dilution was taken, and the RPA - CRISPR / Cas12a reaction was carried out at 39 °C for 30 min. The fluorescence signal was collected in real - time using a real - time fluorescence quantitative PCR instrument, and the fluorescence value at 25 min of the reaction was plotted ( Figure 4 ), and the reaction results showed that this method can detect plasmid standards as low as 1×10 0 copies / μL.

[0050] Step 8, Specificity test of the one - step RPA - CRISPR / Cas12a detection method DNA of pathogenic bacteria such as Escherichia coli causing urinary tract infection and Klebsiella oxytoca was extracted by the boiling method as the template, and the one - step RPA - CRISPR / Cas12a detection was carried out. The fluorescence value at 25 min of the reaction was plotted ( Figure 5). The results showed that this method had high specificity for Escherichia coli in urinary tract infections, and there was no cross-reaction during the detection process.

[0051] From the results of the above-mentioned various embodiments, it can be seen that the present invention can quickly, sensitively, specifically and accurately detect UPEC. It avoids cross-contamination of samples or the environment. This method has strong anti-interference ability, does not require complex nucleic acid extraction steps, and only simple thermal lysis can complete the sample pretreatment link. This method realizes one-step RPA-CRISPR / Cas12a detection, does not require complex liquid preparation and liquid transfer links, simplifies the experimental steps, and reduces the possibility of aerosol contamination. In summary, this method can achieve rapid and accurate on-site UPEC detection.

[0052] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A one-step detection method for Escherichia coli in urinary tract infections for non-diagnostic or non-therapeutic purposes, characterized in that, It includes the following steps: Extract DNA from the sample to be tested; Add the extracted DNA into a reaction tube and mix it with the RPA-CRISPR / Cas12a premix in the reaction tube; React at 37°C to 42°C for 25 min to 30 min; Perform fluorescence method or lateral flow biosensing strip detection to check for signals of Escherichia coli causing urinary tract infection; Among them, the RPA-CRISPR / Cas12a premix includes RPA primers; The RPA primer sequences are: RPA-F: 5’-GTTTGAGTTTGTTGGCTTTGGCTGTTTCTG-3’, RPA-R: 5’-CCACGCATATTTACATCCTGACCGTTGGTT-3’; The RPA-CRISPR / Cas12a premix includes crRNA and ssDNA signal probes; The sequence of crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUCGGCAACGGGGAAUGCACGU-3’; The sequence of ssDNA signal probe is: 5’-FAM-TTATT-BHQ-3’.

2. The one-step detection method according to claim 1, characterized in that, The sample to be tested is a pretreated urine sample; The pretreated urine sample is prepared by the following method: Take the urine to be tested and perform centrifugation; Discard the supernatant, take sterile water to resuspend the precipitate, and shake well to obtain the pretreated urine sample.

3. The one-step detection method according to claim 2, characterized in that The specific method for DNA extraction is as follows: Place the pretreated urine sample under the condition of 95°C to 100°C and heat for 5 min to 8 min, perform centrifugation, and take the supernatant to obtain the extracted DNA.

4. The one-step detection method according to claim 1, characterized in that Add the extracted DNA into a reaction tube and mix it with the RPA-CRISPR / Cas12a premix in the reaction tube. Each 35 μL of the mixed material includes the following raw materials: 14.5 μL to 15 μL of RPA Basic reaction buffer, 1 μL to 1.5 μL of 280 mM MgOAc, 0.8 μL to 1.2 μL of 10 μM RPA-F, 0.8 μL to 1.2 μL of 10 μM RPA-R, 1 μL to 1.5 μL of DNA, 0.5 μL to 1 μL of 1 μM CRISPR / Cas12a, 1.5 μL to 2 μL of 1 μM crRNA, 0.5 μL to 1 μL of 10 μM ssDNA probe, 3 μL to 4 μL of 10X R2.1 buffer, and the balance is DEPC-treated water.

5. The one-step detection method according to any one of claims 1 to 4, characterized in that Perform fluorescence method or lateral flow biosensing strip detection to check for signals of Escherichia coli causing urinary tract infection: If the fluorescence increases or the test line shows color, it indicates that the sample to be tested contains Escherichia coli causing urinary tract infection.

Images