A class of nucleic acid aptamers targeting thyrotropin receptor and its application

Abstract

The present invention relates to a type of nucleic acid aptamer targeting thyrotropin receptor, wherein the nucleotide sequence of the nucleic acid aptamer is shown in any one or several sequences of SEQ ID NO: 1 to SEQ ID NO: 6; or a derivative of the nucleic acid aptamer having the same function obtained by chemically modifying, chemically labeling or changing the base on the basis of any one sequence of SEQ ID NO: 1 to SEQ ID NO: 6. The nucleic acid aptamer involved in the present invention has the advantages of high affinity, strong specificity, small molecular weight, good stability, simple synthesis, low cost, easy modification, no immunogenicity, etc., and can meet the current requirements for rapid detection of thyrotropin receptor.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology and clinical medicine, and relates to a nucleic acid aptamer sequence targeting a thyrotropin receptor and its application in the preparation of drugs or preparations for diagnosing and treating diseases in which the thyrotropin receptor participates in the pathogenesis, such as Graves' disease, thyroid-related eye disease, and thyroid cancer. Background Art

[0002] The thyrotropin receptor is a G protein-coupled receptor that can be stimulated by thyrotropin, thereby activating the transmission of downstream signaling pathways. The thyrotropin receptor is mainly expressed in thyroid epithelial cells. Under pathological conditions, the thyrotropin receptor can also be expressed in blood fibroblasts and orbital fibroblasts, such as Graves' disease and thyroid-associated eye disease.

[0003] Thyroid-related eye disease is the most common orbital disease in adults, and its clinical manifestations are complex and diverse, including eyelid retraction and proptosis. Currently, the treatments for thyroid-related eye disease mainly include drug therapy, radiotherapy and surgical treatment. Commonly used first-line drug treatments mainly include glucocorticoids, selenium supplementation, etc. However, due to the lack of clear therapeutic targets, traditional drug treatments usually have obvious side effects. The pathogenesis of thyroid-related eye disease is complex, and it is currently believed that it is mainly related to the disorder of the immune system. CD34-positive orbital fibroblasts, as a cell that appears in the pathogenesis of thyroid-related eye disease, are mainly derived from circulating fibroblasts and enter the orbit through chemokine interactions. CD34-positive orbital fibroblasts express a large number of thyrotropin receptors, which can proliferate and differentiate under the stimulation of thyrotropin receptor antibodies and cause a series of orbital tissue pathological changes.

[0004] As a single-stranded DNA, aptamers can curl themselves into complex three-dimensional structures under the conditions of electrostatic forces, hydrogen bonds and other interaction forces, and bind to targets through intermolecular forces. Aptamers are widely used in the fields of detection and targeted drug synthesis due to their simple chemical synthesis, high affinity, high stability and easy editing. Aptamers were originally composed of ribonucleotides. However, due to the shortcomings of ribonucleotide chains being easily degraded and unstable, aptamers are currently composed more of deoxyribonucleotides. The screening of aptamers for proteins is based on the systematic evolution of ligands by exponential enrichment (SELEX). The aptamers screened can specifically identify the forward screening targets and cause the regulation of the signal pathways involved in the targets. Since the targets are clear, the aptamers screened can identify the same targets expressed in different cells and tissues, and can be used for target detection and treatment.

[0005] Currently, there is no specific nucleic acid aptamer for the thyrotropin receptor. Screening out nucleic acid aptamers that specifically recognize the thyrotropin receptor through SELEX technology is of great significance for the targeted detection of the thyrotropin receptor and the treatment of the thyrotropin receptor. Summary of the invention

[0006] The purpose of the present invention is to provide a thyrotropin receptor-targeting nucleic acid aptamer with high specificity, strong affinity, good stability and wide practicability and an application thereof.

[0007] To achieve the above object, the technical solution of the present invention is as follows:

[0008] A type of nucleic acid aptamer targeting a thyrotropin receptor, the nucleotide sequence of the nucleic acid aptamer is shown in any one or several sequences among SEQ ID NO:1 to SEQ ID NO:6; or a derivative of the nucleic acid aptamer with the same function obtained by chemical modification, chemical labeling or base change based on any one of the sequences among SEQ ID NO:1 to SEQ ID NO:6.

[0009] Wherein, SEQ ID NO:1:

[0010] CACGCATAACATTTCGGGGGACTGCTCGGGATTGCGGATACGATGTGTTATGCGTG;

[0011] SEQ ID NO:2:

[0012] CACGCATAACTTAGCGGGGGACTGCTCGGGATTGCGGATACGATGTGTTATGCGTG

[0013] SEQ ID NO: 3: AACATTTCGGGGGACTGCTCGGGATTGCGGATACGATGTGTT;

[0014] SEQ ID NO:4:ATTTCGGGGGACTGCTCGGGATTGCGGATACGAT;

[0015] SEQ ID NO: 5: TTAGCGGGGGACTGCTCGGGATTGCGGATACGAT;

[0016] SEQ ID NO:6:TTAGCGGGGGACTGCTCGGGATTG.

[0017] Preferably, the above-mentioned chemical modification or base change includes one or more of phosphorylation, methylation, amination, carboxylation, sulfhydrylation or isotopization.

[0018] Preferably, the chemical labels include one or more of biotin, avidin, fluorescent groups, radioactive substances, digoxin, enzymes, antibodies, proteins, peptides, polymers, nanoluminescent materials or any other therapeutic substances.

[0019] Preferably, the nucleotide sequence of the nucleic acid aptamer has a homology of more than 60% with any one of SEQ ID NO: 1 to SEQ ID NO: 6.

[0020] The present invention also includes a nucleotide sequence having a homology of more than 60% with any one of the nucleotide sequences SEQ ID NO: 1 to SEQ ID NO: 6.

[0021] Preferably, the nucleotides include ribonucleotides and peptide nucleic acids.

[0022] The present invention also includes a kit for detecting and diagnosing diseases associated with thyrotropin receptors, comprising the nucleic acid aptamer or the nucleotide sequence.

[0023] Preferably, the diseases associated with thyrotropin receptor include Graves' disease, thyroid-associated eye disease, and thyroid cancer.

[0024] The present invention also includes a molecular probe, comprising the nucleic acid aptamer or the nucleotide sequence.

[0025] The present invention also includes the use of the nucleic acid aptamer or the nucleotide sequence in diagnostic reagents, molecular imaging probes or targeting media.

[0026] The present invention also includes the use of the nucleic acid aptamer or the nucleotide sequence in the design and preparation of preparations for detecting, diagnosing and treating diseases related to thyrotropin receptors.

[0027] The present invention adopts exponential enrichment ligand system evolution technology, designs the thyrotropin receptor to be combined with carboxyl magnetic beads to form a positive screening target, uses carboxyl magnetic beads that bind to BSA protein as a negative screening target, and obtains a nucleic acid aptamer sequence that can specifically bind to the thyrotropin receptor through 6 rounds of exponential enrichment ligand system evolution technology screening and verification through high-throughput sequencing technology and surface plasmon resonance technology.

[0028] The invention obtains thyrotropin receptor protein by molecular cloning technology, virus vector and protein purification technology, and identifies the sequence in the aptamer library by high-throughput sequencing technology.

[0029] Aptamers from high-throughput sequencing results were synthesized, and the affinity of aptamers to thyrotropin receptors was identified by surface plasmon resonance technology. The secondary structure of the target aptamer was obtained by NUPACK software, and the aptamers were truncated and optimized. The affinity of different truncated and optimized sequences to thyrotropin receptors was compared by surface plasmon resonance technology. The specificity of aptamers for thyrotropin receptor binding was detected by flow cytometry, and the serum stability of aptamers was detected. Aptamers were used to detect thyrotropin receptors at different temperatures, and aptamers were used to detect the expression of TSHR in blood fibroblasts and orbital fibroblasts of patients with Graves' disease and thyroid-related eye disease.

[0030] The beneficial effects of the present invention are:

[0031] The nucleic acid aptamer involved in the present invention has the advantages of high affinity, strong specificity, small molecular weight, good stability, simple synthesis, low cost, easy modification, non-immunogenicity, etc., and can meet the current requirements for rapid detection of thyrotropin receptors. Each aptamer in the present invention can stably bind to the target cell within 30 minutes without binding to other cells. By appropriately modifying or labeling the nucleic acid aptamer, it can be used for rapid detection and diagnosis of diseases in which the thyrotropin receptor participates in the pathogenesis. In summary, the new DNA nucleic acid aptamer involved in the present invention is of great significance for the clinical detection and diagnosis of thyrotropin receptors. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is a graph showing the affinity between the products of different screening rounds and the thyrotropin receptor detected by surface plasmon resonance.

[0033] Figure 2 This is a graph showing the dissociation rate of the products from different screening rounds after binding to the thyrotropin receptor detected by surface plasmon resonance.

[0034] Figure 3 This is a result diagram of the affinity between different nucleic acid aptamers and thyrotropin receptor detected by surface plasmon resonance instrument;

[0035] Figure 4 This is the result of the surface plasmon resonance test of the affinity between the truncated and optimized nucleic acid aptamer and the thyrotropin receptor;

[0036] Figure 5 This is the result of surface plasmon resonance detection of the equilibrium dissociation constant of the binding of nucleic acid aptamer to thyrotropin receptor. Specific implementation plan

[0037] The present invention is further described in detail below in conjunction with examples. However, these examples are limited to illustrating the present invention and are not intended to limit the scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified, and the reagents, methods and equipment used are conventional reagents, methods and equipment in the art unless otherwise specified.

[0038] Example 1

[0039] Preparation of positive and negative screening targets

[0040] 1.1. Carboxyl magnetic beads to immobilize BSA protein:

[0041] Take 300 μL of carboxyl magnetic beads, wash the carboxyl magnetic beads 3 times with 200 μL of ultrapure water, fish the magnetic beads through the magnetic rack and discard the supernatant. Thaw 100 μL of NHS (N-hydroxysuccinimide) and 100 μL of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride) at room temperature and mix well, add to the carboxyl magnetic beads, incubate on a horizontal shaker at room temperature for 20 minutes, and after incubation, separate the magnetic beads using a magnetic rack and wash the magnetic beads twice with 200 μL of DPBS. Take 100 μL of 10 mg / ml BSA protein, add 80 μL of sodium acetate solution with a pH of 4.2, mix well and add to the magnetic beads, incubate on a horizontal shaker at room temperature for 1 hour, separate the magnetic beads and the solution on a magnetic rack, add 100 μL of 1 M ethanolamine, incubate on a horizontal shaker for 10 minutes, separate the magnetic beads using a magnetic rack and wash the magnetic beads 3 times with DPBS, store the magnetic beads at 4°C, and mark them as MB-BSA.

[0042] 1.2. Carboxyl magnetic beads to immobilize thyrotropin receptor protein:

[0043] Purchase thyrotropin receptor protein from Shenggong Bioengineering Company, take 50 μL carboxyl magnetic beads, wash the carboxyl magnetic beads 3 times with 200 μL ultrapure water, and discard the supernatant after fishing the magnetic beads through a magnetic rack. Thaw 50 μL NHS and 50 μL EDC at room temperature and mix well, add to the carboxyl magnetic beads, incubate on a horizontal shaker at room temperature for 20 minutes, separate the magnetic beads using a magnetic rack after incubation and wash the magnetic beads 2 times with 200 μL DPBS. Take 2 μL thyrotropin receptor protein (0.5 mg / ml), add 30 μL sodium acetate solution with pH = 4.2, mix well and add to the magnetic beads, incubate on a horizontal shaker at room temperature overnight, separate the magnetic beads and solution on a magnetic rack, add 100 μL 1M ethanolamine, incubate on a horizontal shaker for 10 minutes, separate the magnetic beads using a magnetic rack and wash the magnetic beads 3 times with DPBS, store the magnetic beads at 4°C, and mark them as MB-TSHR.

[0044] Example 2

[0045] Screening of nucleic acid aptamers using SELEX technology

[0046] The nucleic acid aptamer library used in the design and synthesis is GGGACCAGCACACGCATAAC(N36)GTGTTATGCGTGCTACCGTG (SEQ ID NO: 7), wherein N36 represents a random nucleotide sequence of 36 A, T, C or G, and the length of this sequence ranges from 10 10 -10 12 The screening method used is SELEX technology, and the specific operation steps are as follows:

[0047] 2.1. Take 1OD of the initial library, centrifuge at 15000rpm for 1min, then add an appropriate amount of enzyme-free sterile water, vortex to dissolve, and then centrifuge to collect the library solution. Denature at 95℃ for 10min and immediately place on ice for 10min. Add 1μL of 100μM 6His peptide to the solution to reduce nonspecific binding of the library during incubation, and mix well.

[0048] 2.2. Add 50 μL MB-BSA to the library, mix well and shake horizontally at room temperature for 50 minutes. After incubation, use a magnetic stand to separate the magnetic beads and the supernatant (labeled as pool-). MB-BSA was washed 3 times with 200 μL DPBS, and 200 μL enzyme-free sterile water was added after discarding the supernatant. After boiling in a water bath for 10 minutes, it was immediately placed on ice for 10 minutes. The supernatant was marked as Elution-. Add 50 μL MB-TSHR to the pool- solution, mix well and shake horizontally at room temperature for 50 minutes. After incubation, use a magnetic stand to separate the magnetic beads and the supernatant, and discard the supernatant. The magnetic beads were washed 3 times with 200 μL DPBS, and 100 μL enzyme-free sterile water was added after discarding the supernatant. After boiling in a water bath for 10 minutes, it was immediately placed on ice for 10 minutes. The supernatant was marked as Elution+.

[0049] 2.3. Take 8 Roche PCR tubes, add 30 μL QPCRmix (purchased from Qingke Biotechnology) to each well, add 1 ul of Elution- and Elution+ respectively, and amplify by QPCR. The amplification program is as follows: 95℃2min; 95℃0.5min, 60℃0.5min, 72℃0.5min, 25cycles. The primers used are as follows: Lib1S1: GGGACCAGCACACGCATAAC (SEQ ID NO: 8); Lib2A2: CACGGTAGCACGCATAACAC (SEQ ID NO: 9). The amplification system is shown in Table 1:

[0050] Table 1 QPCR amplification system

[0051]

[0052] 2.4. Thaw 2 ml of ePCR mix (purchased from Bio-Tech Biotech) at room temperature and add it to the remaining Elution+. Transfer it to a 50 ml centrifuge tube and mix well. Add 8 ml of EM90 oil and vortex on a vortex oscillator to prepare an emulsion.

[0053] 2.5. The emulsion was divided into 90 μL portions and then amplified by ePCR. The amplification procedure was as follows: 95°C for 2 min; 95°C for 1 min, 60°C for 1 min, 72°C for 1 min, 25 cycles. The product was recovered after amplification. The primers used were as follows: Lib2A2-ployA: AAAAAAAAAAAAAAAAAAAAAAAAAAA-Spacer18-CACGGTAGCACGCATAACAC (SEQ ID NO: 10), Lib1S1-FAM: GGGACCAGCACACGCATAAC (SEQ ID NO: 11), and the amplification system was shown in Table 2:

[0054] Table 2 ePCR amplification system

[0055]

[0056] 2.6. Transfer the amplified product to a 10ml centrifuge tube, add 2ml of n-butanol, mix well and centrifuge at 12000rpm for 10min. Collect the lower layer of amplified product and transfer it to a 1.5ml centrifuge tube and add 100μL of Urea loading buffer. Mix well and denature at 95℃ for 10min and then immediately put it on ice for 10min.

[0057] 2.7. Perform PAGE gel electrophoresis on the recovered product to recover ssDNA. Add n-butanol to concentrate the ssDNA and place it in a 3.5KD dialysis bag. Use DPBS buffer to dialyze the ssDNA overnight and then measure the concentration by micro-UV.

[0058] 2.8. The above screening process was carried out for 6 rounds, named pool 1, pool 2, pool 3, pool 4, pool 5 and pool 6. After each round of screening, the screening pressure was increased: the amount of nucleic acid aptamer library, the amount of positive screening target and the time of positive screening were reduced, the amount of negative screening target and the time of negative screening were increased, and the number, intensity and time of washing after incubation were increased.

[0059] Example 3

[0060] Aptamer affinity identification.

[0061] 3.1. Replace the surface plasmon resonance instrument chip with a new CM5 chip and the Running Buffer with DPBS. Wash the chip twice with 50nM NaOH solution containing SDS and then wash it twice with 50nM NaOH without SDS.

[0062] 3.2. Take equal volumes of NHS and EDC and mix them, then inject them at 5 μL / min for 3 min. Then mix the thyrotropin receptor protein with sodium acetate (10 mM, pH = 4.0), dilute the thyrotropin receptor to 25 μg / mL, and inject them at 5 μL / min for 3 min. Take 100 μL of ethanolamine (1 M, pH = 8.5) for blocking, and inject them at 5 μL / min for 5 min.

[0063] 3.3. Dilute pool0 (initial library), pool4, pool5, and pool6 to 500 nM using DPBS, denature at 95°C for 10 min, and immediately place on ice for 10 min. Inject each sample at 10 μL / min for 3 min, wait for 3 min, and then inject using regeneration (2 M NaCl) for 1 min.

[0064] 3.4. The results showed that as the number of screening rounds increased, the affinity of the library obtained after each round of screening to the thyrotropin receptor continued to increase ( Figure 1 ), and the dissociation rate after binding pool6 is smaller than pool5( Figure 2 ), so the sixth round of screening products was used as the final round of screening.

[0065] Example 4: High-throughput sequencing and affinity detection of nucleic acid aptamers.

[0066] 4.1. Take the screening round with the highest affinity, that is, the 6th round, for high-throughput product preparation. First, take 2 μL of product as a template, use the conditions used in the SELEX screening process as the amplification conditions used for this PCR amplification for PCR amplification, obtain the product used for high-throughput sequencing, and send the product to Sangon Biotechnology Co., Ltd. for high-throughput sequencing. In this process, due to the changes in the screening conditions in each of the 6 rounds of previous screening and the inconsistency of the amplification templates obtained after screening, the results of the samples sent for sequencing in each round were inconsistent. In addition, due to the long screening time, multiple experimental variables affect the experimental results at different time points during the screening process, so the results of the entire SELEX screening have a certain degree of randomness.

[0067] 4.2. Perform sequence cluster analysis based on high-throughput sequencing results. Classify the high-throughput sequencing results and select the top aptamers in each category as candidate aptamers. Since the binding ability of aptamers depends on their complex spatial structure, and the complex spatial structure is closely related to the secondary structure of aptamers. Therefore, in this process, the secondary structure of aptamers also needs to be analyzed. Usually, aptamers that can form complex secondary structures such as stem-loops are retained. Through a large number of high-throughput sequencing and countless verification experiments, it is found that some secondary structures of aptamers are bound to the target molecule through hydrogen bonds, hydrophobic interactions, pseudobase pair stacking and shape matching to form a complex with strong affinity. However, the form is complex and there are many forms of action, so its selection is very difficult. Therefore, the selection results need to rely on years of experience and subjective judgment.

[0068] 4.3. The selected candidate aptamers were synthesized, and a total of 50 sequences were synthesized. The affinity of the candidate aptamers to the thyrotropin receptor protein was detected by surface plasmon resonance ( Figure 3 ). Among them, the nucleic acid aptamer with the highest affinity is sequence 1 (CACGCATAACATTTCGGGGGACTGCTCGGGATTGCGGATACGATGTGTTATGCGTG), followed by sequence 2 (CACGCATAACTTAGCGGGGGACTGCTCGGGATTGCGGATACGATGTGTTATGCGTG). Subsequent experiments were conducted on sequence 1 and sequence 2.

[0069] Example 5

[0070] Truncation optimization of nucleic acid aptamers.

[0071] 5.1. Use NUPACK software to optimize nucleic acid aptamers.

[0072] 5.2. First, use NUPACK software to simulate the secondary structure of the screened nucleic acid aptamers and find the optimized truncation sites.

[0073] 5.3. By combining the truncated optimized sites at different positions and removing the remaining bases, the truncated optimized nucleic acid aptamer sequences were obtained. The sequences obtained by truncating and optimizing sequence 1 were sequence 3 (AACATTTCGGGGGACTGCTCGGGATTGCGGATACGATGTGTT) and sequence 4 (ATTTCGGGGGACTGCTCGGGATTGCGGATACGAT), and the sequences obtained by truncating and optimizing sequence 2 were sequence 5 (TTAGCGGGGGACTGCTCGGGATTGCGGATACGAT) and sequence 6 (TTAGCGGGGGACTGCTCGGGATTG).

[0074] Example 6

[0075] Identify the affinity of the truncated and optimized nucleic acid aptamer to the thyrotropin receptor.

[0076] 6.1. The nucleic acid aptamer sequence obtained in Example 5 was sent to Sangon Biotech Co., Ltd. to synthesize the corresponding sequence.

[0077] 6.2. Detection of the affinity of truncated aptamers to thyrotropin receptor using surface plasmon resonance ( Figure 4 ), the results showed that sequence 3 had the highest affinity.

[0078] 6.3. The truncated aptamer with the highest affinity was taken for diploid dilution. The affinity of the diluted aptamer to the thyroid stimulating receptor was detected by surface plasmon resonance and the equilibrium dissociation constant was calculated. The best aptamer sequence was determined to be sequence 3, and its equilibrium dissociation constant was 76.48 nM, showing its strong binding ability to target cells, which was significantly higher than that of other aptamers ( Figure 5 ).

[0079] Example 7

[0080] The specificity of the nucleic acid aptamer shown in sequence 3 for binding to the thyrotropin receptor was detected by flow cytometry.

[0081] 7.1. Place the magnetic beads bound to the thyrotropin receptor in a flow tube, wash the magnetic beads with 1 ml of washing buffer, separate the magnetic beads and washing buffer using a magnetic rack, wash twice, and set aside. Wash the BSA protein magnetic beads in the same way.

[0082] 7.2. Take 2.5 μL of FITC fluorescent group modified sequence 2 aptamer in a PCR tube, add 2.5 μL enzyme-free sterile water and mix well. Then incubate at 95℃ for 10 minutes, and immediately place the aptamer on ice for 10 minutes.

[0083] 7.3. Mix the magnetic beads with 95 μL of binding buffer and add the nucleic acid aptamer to the suspension. Incubate on a 3D shaker at 4°C for 1 h.

[0084] 7.4. After incubation, wash the pellet twice with washing buffer, and then resuspend the pellet with 100 μL washing buffer.

[0085] 7.5. The suspension was detected by flow cytometry to detect the difference in fluorescence values ​​between the experimental group and the control group. The results showed that the fluorescence value of the thyroid stimulating hormone receptor increased, and the fluorescence value of the BSA protein group was negative. This indicates that the nucleic acid aptamer shown in sequence 3 has good specificity for binding to the thyroid stimulating hormone receptor and does not bind to other proteins. This proves that the nucleic acid aptamer of the present invention has great application value in the differential diagnosis of thyroid stimulating hormone receptors.

[0086] Example 8

[0087] Detection of serum stability of nucleic acid aptamers.

[0088] 8.1. Take 9 PCR tubes and add 95 μL of serum and 5 μL of aptamer into each tube.

[0089] 8.2. Place the above solution in a 37°C constant temperature incubator for incubation. Take out a PCR tube after 0, 2, 4, 6, 8, 16, 24, 48, and 72 hours and place it at -80°C.

[0090] 8.3. Take 0.6g agarose powder and add 30ml electrophoresis buffer, mix well and boil until the liquid is transparent. Add ethidium bromide and pour into the gelatin plate and wait for it to cool.

[0091] 8.4. The PCR tube was taken out from the -80℃ refrigerator, and the sample was loaded on a gel plate for electrophoresis. The results showed that as the incubation time increased, the nucleic acid aptamer gradually degraded from the 6th hour onwards, indicating that the stability of the nucleic acid aptamer in serum was as long as 6 hours, with good stability, which provided pharmacokinetic evidence for the subsequent drug development and application.

[0092] Example 9

[0093] Aptamers were used to detect the expression of thyrotropin receptor in cells at different temperatures.

[0094] 9.1. Extracting fibroblasts from the blood of patients with thyroid-related eye disease.

[0095] 9.2. The extracted cells were identified as fibroblasts by vimentin and CD34, and the cell lines grown to the logarithmic phase were taken, digested with 5mM EDTA in PBS to form a monodispersed cell suspension, and then washed twice with washing buffer.

[0096] 9.3. Use the thyrotropin receptor to detect whether thyrotropin receptors are expressed on fibroblasts.

[0097] 9.4. Take 2.5 μL of fluorescein-labeled aptamer, which is a fluorescein group FAM coupled to the 5' end of the aptamer (sequence 3), dissolve it in binding buffer, calibrate the concentration (200 nM) according to UV absorption, incubate it at 95°C for 10 minutes, then immediately incubate it on ice for 10 minutes, and leave it at room temperature for 15 minutes to obtain a nucleic acid aptamer-FAM solution.

[0098] 9.5. Incubate the aptamer-FAM solution with the fibroblasts for 1 hour at 4°C and 37°C respectively.

[0099] 9.6. After incubation, wash twice with 200 μL of washing buffer and detect the fluorescence intensity of the fibroblasts by flow cytometry.

[0100] The results showed that there was no significant difference in the affinity between aptamers and fibroblasts at 4°C and 37°C. In addition, aptamer 3 can be used to detect the expression of thyrotropin receptors in cell lines, and it can be seen that fibroblasts express thyrotropin receptors. This shows that aptamer 3 can detect whether thyrotropin receptors are expressed in cells.

[0101] Example 10

[0102] Aptamer 3 is used in cell confocal imaging to measure the expression of thyrotropin receptor in cells

[0103] Take 2.5 μL of fluorescein-labeled aptamer, which is a fluorescein group FAM coupled to the 5' end of the aptamer (sequence 3), dissolve it in binding buffer, calibrate the concentration (200 nM) according to UV absorption, incubate it at 95°C for 10 minutes, then immediately incubate it on ice for 10 minutes, and leave it at room temperature for 15 minutes to obtain a aptamer-FAM solution.

[0104] The fluorescein-labeled aptamer-FAM solution was diluted with binding buffer to a 200 nmol / L DNA solution, added to the fibroblasts extracted from the blood of patients with thyroid-associated eye disease cultured in a confocal culture dish, incubated on ice for 30 min, washed once with PBS, and observed under a FV3000 laser confocal scanning microscope (OLYMPUS / Olympus) at 100 times magnification.

[0105] The results showed that aptamer 3 can be clearly seen to bind well to fibroblasts. Therefore, the aptamer can be used for cell imaging to measure the expression of thyrotropin receptors.

[0106] It should be noted that when the present invention involves a numerical range, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as those in the embodiments, in order to avoid redundancy, the present invention describes a preferred embodiment. Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they know the basic creative concept. Therefore, the attached claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0107] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A type of nucleic acid aptamer targeting thyrotropin receptor, characterized in that: The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO: 3; in, SEQ ID NO:3: AACATTTCGGGGGACTGCTCGGGATTGCGGATACGATGTGTT.

2. A kit for detecting and diagnosing diseases associated with thyrotropin receptors, characterized in that: Comprising the nucleic acid aptamer as claimed in claim 1.

3. The kit according to claim 2, characterized in that The diseases associated with thyrotropin receptor include Graves' disease, thyroid-associated eye disease, and thyroid cancer.

4. A molecular probe, characterized in that Comprising the nucleic acid aptamer as claimed in claim 1.

5. Use of the nucleic acid aptamer according to claim 1 in the preparation of diagnostic reagents, molecular imaging probes or targeting media.

Images