Molecular marker 45400Indel associated with the number of seeds per silique in Brassica napus and its application

Abstract

The present invention belongs to the technical field of molecular biology and genetic breeding, and specifically relates to a molecular marker 45400Indel related to the number of grains per silique of Brassica napus and its application. The nucleotide sequence of the molecular marker is shown in SEQ ID No.1 and / or SEQ ID No.2. The present invention also provides a primer pair for amplifying the molecular marker, and the nucleotide sequence thereof is shown in SEQ ID No.3 and SEQ ID No.4. The present invention develops a molecular marker that is closely linked to the trait of the number of grains per silique, which can be selected at the seedling stage, not only saving production costs but also greatly improving selection efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker 45400Indel related to the number of grains per silique of Brassica napus and an application thereof. Background Art

[0002] Brassica napus L., AACC, 2n = 38, is the second largest oil crop in the world after soybean. my country's rapeseed planting area and total output account for one-third of the world's total (www.fao.org). With the growing demand for vegetable oil and the continuous reduction of rapeseed production area, cultivating high-yield rapeseed varieties has always been one of the important goals of rapeseed breeders. The number of seeds per silique is an important determinant of rapeseed yield, which is jointly determined by ovule initiation and subsequent ovule / seed development. The number of seeds per silique is usually highly significantly positively correlated with rapeseed yield, indicating that increasing the number of seeds per silique is an effective way to increase rapeseed yield. There is a significant positive correlation between the rapeseed oil yield harvest index and the number of seeds per silique per plant, which also shows that increasing the number of seeds per silique is the key to achieving an increase in the harvest index (Lu et al., 2017). At the same time, seed number is a key trait closely related to plant adaptability, evolution, and crop domestication and improvement. There is a rich variation in the number of siliques in rapeseed, but the number of siliques in existing varieties (~20) is far lower than the maximum value (>40) in the germplasm resources (Chen et al., 2012), indicating that the potential of the number of siliques in increasing rapeseed yield has not yet been effectively utilized.

[0003] The number of silicules involves multiple biological processes and is affected by multiple biological factors, such as the number of ovules in the ovary, the proportion of fertile ovules, the proportion of fertilized embryos, and the proportion of fertilized embryos that develop into seeds (Li et al., 2015). The number of silicules and its related components are typical complex quantitative traits controlled by multiple genes and are highly affected by environmental conditions. In recent years, Jiao et al. (2021) and others used QTL mapping and GWAS analysis to identify more than 100 QTLs related to the number of siliques on 19 chromosomes of the rapeseed genome (Radoev et al., 2008; Shi et al., 2009; Wang et al., 2010; Zhang et al., 2010; Ding et al., 2012; Shi et al., 2013; Cai et al., 2014; Qi et al., 2014; Fu et al., 2014; Shi et al., 2015; Lu et al., 2017; Khan et al., 2019; Xin et al., 2021; Jiao et al., 2021), of which only 4 (located on chromosomes A1, A6, C1 and C9, respectively) showed major effects, with phenotypic variation ranging from 23.5% to 57.8%. Among them, the major QTL qSN.A6 was successfully located in the 267kb region on chromosome A6, and the yield increase effect on the number of siliques was 17.4% (Yang et al., 2016). At present, only the BnaC9.SMG7b gene in the major QTL related to the number of siliques on C09 has been cloned, and the yield increase effect on the number of siliques was 58.7% (Li et al., 2015). Therefore, only by exploring and cloning the genes that control the number of siliques and constructing the molecular regulatory network of the number of siliques can we better understand the biological basis of the formation of the number of siliques in rapeseed and provide theoretical support for the improvement of rapeseed yield and quality.

[0004] As a model plant, Arabidopsis has more than 300 genes reported to regulate the number of pods per silique, which are involved in embryo sac development, embryo development, ovule development, pollen development, double fertilization and other processes (Yang et al., 2016). Based on the close relationship between Brassica napus and Arabidopsis, these genes were mapped to the rapeseed genome (darmor), and about 900 homologous genes of the genes regulating the number of pods per silique were obtained. However, there are two problems that hinder the implementation of inferring the function of rapeseed genes based on the gene function of Arabidopsis. First, each Arabidopsis gene has about 3 to 6 homologous genes in the rapeseed genome (Parkin et al., 2005; Levasseur and Pontarotti, 2011), and some homologous genes may have been inactivated or undergone new functionalization during evolution. In addition, about one-third of Arabidopsis protein-coding genes remain to be functionally characterized (Wang et al., 2019), so there is a great risk in inferring their functions in rapeseed based solely on homology with Arabidopsis.

[0005] In recent years, some important crop reference genomes have been released (Bayer et al., 2017; Chalhoubet al., 2014; Liu et al., 2014; Wang et al., 2011; Sun et al., 2017), creating conditions for the study of some important agronomic traits at the multi-omics level. Summary of the invention

[0006] The present invention aims to provide a major QTL locus for the number of pods per silique of rapeseed, which is applied to the molecular breeding and genetic improvement of the number of pods per silique of rapeseed.

[0007] The technical solution of the present invention is a molecular marker 45400Indel related to the number of grains per silique of Brassica napus, and the nucleotide sequence thereof is shown in SEQ ID No.1 and / or SEQ ID No.2.

[0008] The present invention also provides a primer pair for amplifying the molecular marker, and the nucleotide sequences thereof are shown in SEQ ID No.3 and SEQ ID No.4.

[0009] The invention also provides the use of the molecular marker or primer pair in Brassica napus breeding.

[0010] Furthermore, the use is for predicting or screening Brassica napus with different numbers of seeds per silique.

[0011] Specifically, the use is for improving the number of grains per silique of Brassica napus.

[0012] The present invention also provides a method for predicting or screening Brassica napus with different numbers of seeds per silique by using the molecular marker, comprising the following steps: using DNA of Brassica napus as a template and amplifying with the primer pair shown in SEQ ID No.3 and SEQ ID No.4; separating the amplified products; a heterozygous genotype plant with many seeds is a plant with the sequences shown in SEQ ID No.1 and SEQ ID No.2, a homozygous genotype plant with many seeds is a plant with only the sequence shown in SEQ ID No.1, and a homozygous genotype plant with few seeds is a plant with only the sequence shown in SEQ ID No.2.

[0013] The present invention also provides a method for obtaining the molecular marker, comprising the following steps:

[0014] (1) The rape varieties 6Q006 (about 40 seeds per silique) and 6W26 (about 15 seeds) with extremely significant differences in the number of seeds per silique were crossed, and the hybrid F1 generation was doubled to obtain a DH population containing 152 genotypes. The F1 generation was self-pollinated to produce the F2 population.

[0015] (2) Leaves from each individual plant in the parent and DH populations were taken at the seedling stage and sequenced using a whole-genome rapeseed 60K SNP chip to obtain genotype data; a genetic linkage map was constructed;

[0016] (3) QTL mapping was performed based on markers on the genetic linkage map of the DH population and the phenotypic data of the trait of number of berries per silique, and 17 QTLs controlling the number of berries per silique were obtained. Among them, the QTL located on the C09 linkage group could be repeatedly detected in different environments, and the effect value and contribution rate were large.

[0017] (4) Two extreme pools of strains with significant differences in the number of siliques in the DH population were selected for genome resequencing, and the BSA analysis was used to narrow the QTL interval initially located;

[0018] (5) Transcriptome sequencing was performed on the ovaries (0 days after flowering), siliques (7 days after flowering), and seeds (14 and 21 days after flowering) of the lines with significant differences in the number of siliques between the DH population and the F2 population, and candidate genes were predicted through transcriptome analysis; two differentially expressed genes, BnaC09g44500D and BnaC09.APT5 (BnaC09g45400D), were obtained, which only existed at 14 days and 21 days after flowering;

[0019] (6) Sequence analysis of the differentially expressed genes BnaC09g44500D and BnaC09.APT5 showed that there was no difference in the full length and promoter sequence of the BnaC09g44500D gene between the two parents, and there was a 48 bp insertion-deletion mutation in the promoter region of the BnaC09.APT5 gene;

[0020] (7) A 45400 Indel marker was designed based on the 48 bp sequence difference in the promoter region of the BnaC09.APT5 gene; its nucleotide sequence is shown in SEQ ID No.1 and / or SEQ ID No.2.

[0021] After many years of breeding experiments, the applicant of the present invention screened an inbred line 6Q006 with about 40 pods per silique. The inbred line was hybridized with a line 6W26 with only about 15 pods per silique to create a DH population. The applicant used chip sequencing, genome resequencing, transcriptome sequencing and other methods to locate a major QTL controlling the number of pods per silique, functionally verified the predicted candidate genes, and developed a functional marker closely linked to the number of pods per silique, providing new gene resources for the genetic improvement of the number of pods per silique of Brassica napus.

[0022] Beneficial effects of the present invention: The present invention locates the main effect QTL related to the number of grains per silique, and quickly predicts the candidate genes related to the trait of the number of grains per silique through multi-omics methods such as resequencing analysis and transcriptome analysis. It avoids the use of high-generation segregation populations for fine positioning and map-based cloning, saving manpower and material resources. The present invention develops molecular markers that are closely linked to the trait of the number of grains per silique, which can be selected at the seedling stage, not only saving production costs but also greatly improving selection efficiency. The phenotype of the number of grains per silique is greatly affected by the environment. The detection method can quickly and accurately screen materials with a large number of grains per silique without being affected by the environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 a is the phenotype of the number of pods per silique of the parents and the DH population; a is the phenotype of the parent 6Q006 and the parent 6W26 and their hybrid F1 generation; b is the phenotype of the number of pods per silique of the DH population for 4 years.

[0024] Figure 2 The QTL positioning and BSA analysis results of the number of siliques. a is the QTL scanning result of the number of siliques in 4 years; b is the BSA analysis result of the number of siliques on chromosome C09. a: The horizontal axis represents the chromosome, and the vertical axis represents the LOD value. b: The horizontal axis represents the △SNP / InDel-index value, and the vertical axis represents the physical position of chromosome C09.

[0025] Figure 3 Sequence analysis of the BnaC09.APT5 gene in both parents

[0026] Figure 4The genotype and phenotype analysis of 45400Indel markers in DH population. a is the genotype results of 45400Indel markers in 22 strains of DH population; b is the phenotype of the number of pods per silique of different genotypes in DH population for 4 years. Figure b: The horizontal axis represents different years, and the vertical axis represents the phenotype of the number of pods per silique of different genotypes.

[0027] Figure 5 The haplotype and phenotype analysis of 45400Indel markers in natural populations. a is the genotype results of 45400Indel markers in 18 strains in natural populations; b is the phenotype of the number of pods per silique of different genotypes in natural populations for 5 years. Figure b: The horizontal axis represents different years, and the vertical axis represents the phenotype of the number of pods per silique of different genotypes. DETAILED DESCRIPTION

[0028] The following is a specific implementation of the method of the present invention, but it is not intended to limit the method of the present invention. Any changes that do not depart from the essential content of the present invention should still fall within the protection scope of the present invention.

[0029] Example 1 Obtaining the molecular marker 45400Indel

[0030] (I) Construction and characterization of DH population of rapeseed with different siliques:

[0031] The DH population parents used in this example are the high-grain parent 6Q006 (≈40 grains) and the low-grain parent 6W26 (≈15 grains) ( Figure 1 a). These two parents were provided by the Beibei Rapeseed Resource Bank of Chongqing Crop Seed Resource Bank. The hybrid F1 generation produced by the two parents derived a DH population including 152 strains through microspore culture and colchicine doubling. The two parents and the DH population were planted from 2017 to 2021, and the phenotype of the number of siliques was identified by seed testing at maturity. The phenotypic data of the number of siliques showed that the number of siliques in the DH population showed an approximately bimodal distribution, indicating that the trait of the number of siliques was controlled by a major effect locus ( Figure 1 b).

[0032] Microspore culture method:

[0033] (1) Bud selection: Generally, samples should be collected between 8:00 and 10:00 in clear weather. The main inflorescence or inflorescence with good growth status should be selected as much as possible. Then, buds with a size of 2.5 to 3.5 mm should be selected in the laboratory for use.

[0034] (2) Microspore culture steps:

[0035] Disinfection: The selected flower buds were disinfected with 75% alcohol for 30 seconds, washed once with distilled water, and then disinfected with 10% sodium hypochlorite for 10-15 minutes (shake 3-5 times during the period), and finally washed with sterile water 3 times, 3 minutes each time.

[0036] Preparation: During the disinfection process, you can prepare the pipettes, centrifuge tubes and culture dishes that will be used later.

[0037] ① Drain the alcohol in the ear cleaning bulb, insert a straw, slightly heat it with an alcohol lamp, put one tube into 1 / 2B5 liquid culture medium (dissolve it according to the concentration of B5 culture medium at half, then add 130g sucrose to make the volume 1000mL, and sterilize it at high temperature), and put one tube into a centrifuge tube (one material, one centrifuge tube);

[0038] ②Preparation of culture dishes: Use two culture dishes for every 25 to 30 flower buds. Add a small amount of activated carbon (about the size of two sesame seeds) into each dish.

[0039] Extracting pollen:

[0040] ① Transfer the sterilized and cleaned flower buds to a small tray, drain the water, add a small amount of 1 / 2B5 liquid culture solution, grind with a glass rod to release the pollen, and pour into a filter (300 mesh) for filtration. Use a dropper to suck a small amount of 1 / 2B5 extraction culture solution to rinse the pollen in the filter. After 2 to 3 times, suck all the pollen filtrate into a 10mL centrifuge tube (use a corresponding pipette and centrifuge tube for each material), and add 1 / 2B5 to about 6mL;

[0041] ② Centrifuge the pollen suspension at 1000 rpm for 3 min and discard the supernatant;

[0042] ③ Add 1 / 2 B5 extract and use a pipette to disperse the precipitated pollen. Resuspend and centrifuge at 1000 rpm for 3 minutes. Discard the supernatant and repeat the process.

[0043] Double cultivation:

[0044] ① Preparation of mixed solution: NLN containing colchicine: normal NLN = 1:5, the colchicine concentration is generally 500mg / L. Every 25 to 30 flower buds require 1mL of NLN-13 containing colchicine (diluted according to the concentration provided by NLN and NLN Vitamin culture medium, add 500mg nitric acid, 130g sucrose to make a fixed volume of 1000mL, adjust pH 5.8 to 6.0. Roughly filter with a 0.45um filter membrane, and then finely filter with a 0.22um filter on a clean bench);

[0045] ② Packaging: Add 8 mL of the mixed solution to each centrifuged pollen, and then transfer them into two culture dishes (6-7.5 cm in diameter) with activated carbon added, and seal them;

[0046] ③Constant temperature, dark, 34℃ heat shock culture for 48h;

[0047] ④ After doubling for 48 hours, the suspension can be placed under a microscope to observe whether the pollen cells are swollen (it is effective only if they are swollen by more than 70%, and the embryo production rate of some swollen cells is very low). If no swollen cells are observed, the next step of changing the liquid can be skipped.

[0048] Embryo induction culture (medium change):

[0049] ① Prepare the pipette, centrifuge tube and culture dish first, and pack each material into 5 dishes. Add activated carbon to each culture dish first, and then add 2mL of NLN-13 culture medium;

[0050] ②Pipette the uncontaminated NLN-13 pollen suspension after doubling into the centrifuge tube again and centrifuge (when sucking, you can suck up the liquid and repeatedly rinse the culture dish to wash up the pollen that has settled at the bottom), 1000 rpm, centrifuge for 5 minutes, pour out the NLN-13 liquid, and leave the precipitated pollen;

[0051] ③ Wash the precipitated pollen again with 5 mL of NLN-13 culture medium (to wash away the colchicine), centrifuge at 1000 rpm for 5 min, and discard the supernatant; dilute the washed pollen again with 10 mL of NLN-13 culture medium to form a pollen suspension; divide the suspension into 6-7.5 cm culture dishes, generally add about 2 mL of suspension to each dish, add 2 mL of NLN-13 added in advance to the culture dish, a total of 4 mL of suspension, each mL contains about 1.5-2 flower buds, and seal with paraffin sealing film;

[0052] ④ Place the sealed culture dish in dark culture at 25℃. After about 10 days, check whether there are visible granular embryos. If not, continue to culture. If visible embryos appear, move to a constant temperature shaker at 65rpm and 25℃ and continue dark culture.

[0053] ⑤ When the dark-cultured embryos develop to the stage of cotyledon-shaped embryo formation, they are transferred into 1 / 2MS solid culture medium (dissolved at half the concentration of MS culture medium, and then 30g sucrose and 10g agar powder are added to make a volume of 1000mL, and sterilized at high temperature), and cultured into seedlings at 20℃, 16h light, 8h dark, and 2000LUX light intensity.

[0054] Expansion:

[0055] ① Transfer the unrooted embryos to differentiation medium (dissolved according to the concentration of MS medium, and then add 0.2mg NAA, 3mg 6-BA, 30g sucrose, 10g agar powder, and sterilized at high temperature) to induce callus formation and budding;

[0056] ② Subculture the seedlings on MS medium (dissolve according to the concentration of MS medium, add 30g sucrose, 10g agar powder, and sterilize at high temperature), and replace the medium once a month until transplanting to the field.

[0057] (II) Extraction of total DNA from leaves:

[0058] During the seedling stage of the parent and DH populations, leaves of each individual plant were taken and plant genomic DNA was extracted using the CTAB method:

[0059] (1) Take 0.1 g of young leaves and grind them into powder with liquid nitrogen, then quickly transfer them into a 2 mL centrifuge tube;

[0060] (2) Add 700 μL of CTAB extract preheated at 65°C and 2% β-mercaptoethanol to the tube, cover tightly and shake quickly;

[0061] (3) Incubate in a 65°C water bath for 30-60 min, inverting 3-4 times to mix;

[0062] (4) After cooling, add an equal volume (700 μL) of chloroform / isoamyl alcohol (v:v = 24:1) and gently invert to mix and emulsify for 20 to 30 min;

[0063] (5) Centrifugation at 12000 rpm for 10 min at room temperature;

[0064] (6) Pipette the supernatant into another clean centrifuge tube;

[0065] (7) Add an equal volume of isopropanol (precooled at -20°C) to the supernatant and gently invert to mix. A white flocculent precipitate will appear after about 1 to 2 minutes. (If not, add 0.5 to 1.0 mL of sodium acetate solution and mix until a precipitate forms.) Then place in a 4°C refrigerator and let stand for 10 minutes.

[0066] (8) Centrifuge at 10,000 rpm for 1 min at room temperature;

[0067] (9) After discarding the supernatant, add 1 mL of 75% ethanol and rinse (using a 1 mL blue pipette with the tip cut off to pipette several times). Precipitate the DNA for more than 2 min, discard the ethanol, and repeat once.

[0068] (10) Rinse once with anhydrous ethanol (or 95% ethanol);

[0069] (11) Dry the precipitate in a thermostat at room temperature or below 37°C until it just becomes translucent. Do not over-dry.

[0070] (12) Dissolve the precipitate in 500 μL TE or sterile ddH2O and place in a 4°C refrigerator for half a day to a day, flicking the precipitate 3 to 5 times during the process. The precipitate can then be used for rough PCR or stored at -20°C.

[0071] (III) DH population genotype analysis, genetic linkage map construction and QTL positioning:

[0072] (1) DNA from the two parents and 91 DH individuals were sent to Beijing Yimeitongde Technology Development Co., Ltd. (Beijing, China) for whole-genome rapeseed 60K SNP chip sequencing. Genotyping followed the Infinium chip experimental process. The sequencing results were aligned to the rapeseed "Bra_napus_v2.0" reference genome (https: / / www.ncbi.nlm.nih.gov / assembly / GCF_000686985.2 / ), and a total of 52,157 SNPs were obtained in the experiment.

[0073] (2) Through SNP polymorphism analysis, SNPs with missing rate >25% and minimum allele frequency (MAF) <5% were removed, and finally 7,706 SNPs were obtained for constructing a genetic linkage map. SNPs with the same genotype in the DH population were integrated into one bin using the Perl language.

[0074] (3) Joinmap 4.0 software was used to perform linkage analysis on the SNP genotype data of the DH population to construct a genetic linkage map of Brassica napus. The genetic linkage map covers 19 linkage groups of Brassica napus, contains 1,611 bins, has a total length of 1,613.20 cM, and the average distance between markers is 1.00 cM.

[0075] (4) Based on the genetic map and the phenotypic data of the number of kernels per pod in the DH population, QTL detection was performed using the Windows QTLCartographer 2.5 software. A major QTL with good repeatability (43.47-45.86 Mb) was detected on chromosome C09. Its LOD value and contribution rate were both large, explaining 51.49% of the phenotypic variation in the number of kernels per pod ( Figure 2 a).

[0076] (IV) Genome resequencing and BSA analysis

[0077] Two parents and 12 DH strains showing extreme phenotypes of the number of grains per silique were selected to form extreme phenotype mixed pools, namely the More-SNPP mixed pool (the average number of grains per silique was 32.97 grains) and the Less-SNPP mixed pool (the average number of grains per silique was 9.18 grains). The leaves were sent to Beijing Biomarker for resequencing. The sequencing results generated a total of 84.65Gbp of Clean Data, with an average coverage depth of 15X and a genome coverage of 98.92%.

[0078] According to the alignment results of Clean Reads on the reference genome "Bra_napus_v2.0" (https: / / www.ncbi.nlm.nih.gov / assembly / GCF_000686985.2 / ), GATK software was used to detect SNPs and Small InDels on the whole genome. SNP / InDel sites with heterozygous, no polymorphism and read sequencing depth less than 10 in the parental pool were filtered out, and finally 5,288 high-quality reliable SNP sites and 2,602 InDel sites on C09 were obtained. The obtained SNP and InDel sites were analyzed by BSA using the SNP / InDel-index method to further narrow the main effect QTL interval. The sliding window method was used to fit the Δ(SNP / InDel-index) marked on the same chromosome, and then the region above the threshold was selected as the region associated with the trait based on the association threshold. The initial QTL interval was narrowed down to the 44.87-45.77Mb interval of chromosome C09 of the “Bra_napus_v2.0” reference genome (https: / / www.ncbi.nlm.nih.gov / assembly / GCF_000686985.2 / ) by BSA analysis. Figure 2 b).

[0079] (V) Transcriptome analysis and prediction of candidate genes

[0080] The ovaries (0 days after flowering), siliques (7 days after flowering) and seeds (14 and 21 days after flowering) of the high-grain and low-grain lines in the DH population and F2 population were collected and sent to Beijing Biomarker for transcriptome sequencing. The two extreme pools of the DH population were consistent with the resequencing materials. The high-grain pool and low-grain pool of the F2 population were composed of 8 and 6 materials, respectively, with the mean phenotype of the number of grains per silique being 31.03 and 12.18, respectively. The Clean Reads of each sample were sequenced with the "Bra_napus_v2.0" reference genome (https: / / www.ncbi.nlm.nih.gov / assembly / GCF_000686985.2 / ) using HISAT2 software, and the aligned reads were assembled using StringTie software. Fold Change ≥ 2 and FDR < 0.001 were used as screening criteria, and the EBseq software package was used to analyze the differentially expressed genes in the QTL interval at 0, 7, 14, and 21 days after flowering. Two differentially expressed genes, BnaC09g44500D and BnaC09.APT5 (BnaC09g45400D), were obtained, which only existed at 14 and 21 days after flowering.

[0081] Sequence analysis of the differentially expressed genes BnaC09g44500D and BnaC09.APT5 showed that there was no difference in the full length and promoter sequence of the BnaC09g44500D gene between the two parents, and there was a 48 bp insertion-deletion mutation in the promoter region of the BnaC09.APT5 gene ( Figure 3 ).

[0082] (VI) Functional marker development and testing

[0083] Based on the 48 bp sequence difference in the promoter region of the BnaC09.APT5 gene, the 45400 Indel marker was designed, which divided the parents into two genotypes. After the PCR products were separated by 2% agarose gel electrophoresis, 6Q006 only had a 165 bp band (such as SEQ ID No. 1), that is, 6Q006 was genotype A; 6W26 only had a 213 bp band, that is, 6W26 was genotype B (such as SEQ ID No. 2) ( Figure 4 ). Then there are only two genotypes, A and B, in the DH population obtained from the two, and materials with different phenotypes can be distinguished using only this one primer.

[0084] Genotype A of SEQ ID No.1 molecular marker:

[0085] ggttcataaattctgtgtgcctactcagttcgtgcgtgggatacacacactccaatctctttctgctctctataaaaaaaaaatttaatgctctctcacatatagagagatatgatctgatctcatttcatttcattttccttcttttgcgagggaaatttaatacccttctccactttgaattatc; Genotype B of molecular marker of SEQ ID No.2:

[0086] ggttcataaattctgtgtgcctactcagttcgtgcgtgggatacaacacactccaatctctttctgctctctctataaaaaaaaatttaatgctctctcacaactactttcttctacaag tggcggtgaacagaaaaagacagtcacatatagagagatatgatctgatctcatttcatttcattttccttcttttgcgagggaaatttaatacccttctccactttgaattatc.

[0087] The DH segregation population was constructed with 6Q006 (many grains) and 6W26 (few grains) as parents. The 45400 Indel markers were used for detection in the DH population. The results showed that the number of strains in the DH population whose allele (A) came from the parent '6Q006' was basically equal to the number of strains in the DH population whose allele (B) came from the parent '6W26'; the average number of grains per horn of all strains containing A-banding type was 29.09±4.61, which was significantly higher than the average number of grains of all strains containing B-banding type (9.69±3.15) ( Figure 4 ); there was a significant difference in the number of seeds per horn between the two (P≤0.001). By selecting individual plants containing genotype A, high-yield rapeseed varieties can be further rapidly cultivated.

[0088] Example 2 Application of molecular markers in high-yield rapeseed breeding

[0089] 157 natural populations (Table 1, provided by Chongqing Rapeseed Engineering Technology Research Center) were used as research materials, and 45400 Indel markers were used to further expand the detection range. The detection method is as follows:

[0090] (1) Extract DNA from natural populations using the same method as in Example 1.

[0091] (2) First, the haplotype type of the natural population was detected, and the PCR process was performed using the following primers:

[0092] The forward primer sequence of 45400Indel is 5'-ggttcataaattctgtgtgcct-3' (SEQ ID No. 2), and the reverse primer sequence is 5'-gataattcaaagtggagaagggt-3' (SEQ ID No. 3).

[0093] (3) The total volume of the PCR reaction system was 25 μL, including the following: 10× PCR buffer 5 μL, 25 mM MgCl2 1.5 μL, 10 mM dNTP 2 μL, F-Primer 0.5 μL, R-Primer 0.5 μL, Promega Hot START polymerase 0.2 μL, Template 2 μL, ddH2O 13.3 μL

[0094] (4) PCR amplification program: 94°C for 5 min, [94°C for 30 s, 56°C for 30 s, 72°C for 20 s] × 35 cycles, 72°C for 10 min. Store at 4°C after the run.

[0095] (5) After the PCR products were separated by 2% agarose gel electrophoresis, the marker could form two different haplotypes in different materials of natural populations ( Figure 5 The number of grains per horn in the material containing allele A in the two haplotypes (23.67±3.03 grains) was higher than that in the material containing allele B (15.74±3.27 grains) ( Figure 5 ). Through the selection of this pair of InDel markers, the optimal haplotype for the number of grains per horn can be selected.

[0096] The above results fully demonstrate that this InDel marker can indeed be used for the prediction, identification and screening of the number of grains per horn in rapeseed.

[0097] Table 1 Information table of 157 natural population materials

[0098]

[0099]

[0100]

[0101]

[0102] Sequence Listing <110> Southwest University <120> Molecular marker 45400Indel associated with the number of seeds per silique in Brassica napus and its application <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 187 <212> DNA <213> artificial <400> 1 ggttcataaa ttctgtgtgc ctactcagtt cgtgcgtggg atacacacac tccaatctct 60 ttctgctctc tataaaaaaa aaatttaatg ctctctcaca tatagagaga tatgatctga 120 tctcatttca tttcattttc cttcttttgc gagggaaatt taataccctt ctccactttg 180 aattatc 187 <210> 2 <211> 235 <212> DNA <213> artificial <400> 2 ggttcataaa ttctgtgtgc ctactcagtt cgtgcgtggg atacacacac tccaatctct 60 ttctgctctc tataaaaaaa aaatttaatg ctctctcaca actactttct tctacaagtg 120 gcggtgaaca gaaaaagaca gagtcacata tagagagata tgatctgatc tcatttcatt 180 tcattttcct tcttttgcga gggaaattta atacccttct ccactttgaa ttatc 235 <210> 3 <211> twenty two <212> DNA <213> artificial <400> 3 ggttcataaa ttctgtgtgc ct <210> 4 <211> 23 <212> DNA <213> artificial <400> 4 gataattcaa agtggagaag ggt

Claims

1. A molecular marker 45400Indel related to the number of seeds per silique of Brassica napus, the nucleotide sequence of which is shown in SEQ ID No.1 or SEQ ID No.

2.

2. A primer pair for amplifying the molecular marker according to claim 1, characterized in that: The nucleotide sequences thereof are shown in SEQ ID No.3 and SEQ ID No.

4.

3. Use of the molecular marker according to claim 1 or the primer pair according to claim 2 in breeding for the number of pods per silique of Brassica napus.

4. The use according to claim 3, characterized in that The use is for predicting or screening Brassica napus with different numbers of seeds per silique.

5. The use according to claim 3, characterized in that: The use is for improving the number of seeds per silique of Brassica napus.

6. A method for predicting or screening Brassica napus with different numbers of seeds per silique using the molecular markers of claim 1, characterized in that: The method comprises the following steps: using DNA of Brassica napus as a template and performing amplification with the primer pair shown in SEQ ID No.3 and SEQ ID No.4; separating the amplified product; a plant with the sequences shown in SEQ ID No.1 and SEQ ID No.2 is a heterozygous genotype plant with many grains, a plant with only the sequence shown in SEQ ID No.1 is a homozygous genotype plant with many grains, and a plant with only the sequence shown in SEQ ID No.2 is a homozygous genotype plant with few grains.

Images