Weissella cibaria for controlling botrytis cinerea and application thereof
By using a microbial preparation made from Weissella cibaria BWL4, the problems of pesticide residues and resistance in the control of gray mold in fruits and vegetables by chemical pesticides have been solved, achieving a high-efficiency biological control effect for vegetable storage.
Patent Information
- Application Number
- CN202310032807.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-10
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2043-01-10
AI Technical Summary
In existing technologies, chemical pesticides are prone to pesticide residues and resistance when used to control gray mold in fruits and vegetables, and biological control methods are not very effective and are difficult to control gray mold in fruits during post-harvest storage.
A microbial preparation made from a strain of Weissella cibaria BWL4 was used to inhibit the growth of Botrytis cinerea by spraying or applying it to the surface of fruits and vegetables, including inhibiting spore germination, germ tube elongation and hyphal penetration.
It significantly reduces the incidence of gray mold, improves the storage quality of fruits and vegetables, extends the storage time of fruits and vegetables, and reduces the risk of using chemical pesticides.
Smart Images

Figure CN116200301B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural product storage technology, and in particular to a strain of *Westernella edodes* that controls gray mold in fruits and vegetables and its application. Background Technology
[0002] Botrytiscinerea, a fungus widely distributed and capable of surviving in water, air, and soil, is highly adaptable and one of the most destructive fungal plant pathogens affecting horticultural crops. It has a broad host range, infecting over 400 plant species and causing gray mold disease in multiple plant organs, including flowers, fruits, leaves, branches, and underground tubers. Leaves and fruits are most severely affected, leading to extensive leaf drop and fruit rot, significantly impacting the yield and quality of vegetables and fruits. In plant pathogenic fungal damage assessments, Botrytiscinerea ranks second only to rice blast fungus. Botrytiscinerea typically enters these tissues early in crop development and remains dormant for extended periods under unfavorable environmental conditions. Therefore, crops that appear healthy at harvest may rot during subsequent storage and transportation, causing significant economic losses. Furthermore, in products such as kiwifruit, grapes, apples, and pears, Botrytiscinerea can survive for extended periods at temperatures above freezing, posing a serious challenge to post-harvest storage and preservation of fruits and vegetables.
[0003] Grapes and kiwifruit are both popular fruits. However, during post-harvest storage, they can be infected by various pathogenic fungi. Among them, gray mold caused by Botrytis cinerea is one of the most important post-harvest diseases of grapes and kiwifruit. Once the fruit is infected by gray mold, the disease progresses rapidly and is difficult to control, causing the fruit to completely lose its commercial value.
[0004] For a long time, the control of gray mold has relied mainly on chemical control. However, the extensive use of pesticides may lead to high pesticide residues. In addition, gray mold easily develops resistance to chemical pesticides, and resistant strains of currently used pesticides have been found both domestically and internationally, resulting in a continuous decline in control effectiveness. Therefore, biological control is increasingly becoming an important approach to controlling gray mold. Summary of the Invention
[0005] The purpose of this invention is to provide a strain of *Weissella cibaria* for controlling gray mold in fruits and vegetables and its application, thereby solving the problems existing in the prior art. The *Weissella cibaria* strain, named *Weissella cibaria* BWL4, was deposited at the China Center for Type Culture Collection (CCTCC) on January 19, 2021, with accession number CCTCCNO: M2021109, and it can effectively inhibit gray mold in fruits and vegetables.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] This invention provides a strain of Weissellacibaria BWL4 for controlling gray mold in fruits and vegetables. The Weissellacibaria BWL4 strain was deposited at the China Center for Type Culture Collection on January 19, 2021, with accession number CCTCCNO: M2021109.
[0008] The present invention also provides a microbial preparation comprising the aforementioned Weissella esculenta BWL4.
[0009] The present invention also provides a method for preventing and controlling gray mold in fruits and vegetables, which involves spraying or applying the bacterial solution of *Westernella edodes* BWL4 or the microbial preparation to the surface of fruits and vegetables.
[0010] Furthermore, the bacterial concentration of the *Westernella esculenta* BWL4 is greater than or equal to 10. 8 CFU / mL.
[0011] Furthermore, the microbial preparation is used after being diluted at a mass-to-volume ratio of 1 kg of microbial preparation to 50-100 L of water.
[0012] Furthermore, the ratio of the amount of the microbial agent to the mass of the fruits and vegetables is 1:1000-10000.
[0013] The present invention also provides the application of the aforementioned Weissella esculenta BWL4 or the aforementioned microbial preparation in the prevention and control of gray mold in fruits and vegetables.
[0014] The present invention also provides the application of the aforementioned Weissella esculenta BWL4 or the aforementioned microbial preparation in the storage of harvested fruits and vegetables.
[0015] Furthermore, by inhibiting the growth of gray mold on the surface of harvested fruits and vegetables, the incidence of gray mold disease can be reduced, thereby improving the storage quality of fruits and vegetables.
[0016] Furthermore, the inhibition of the growth of gray mold on the surface of harvested fruits and vegetables includes inhibiting the spore germination, germ tube elongation, and hyphal penetration of the gray mold.
[0017] The present invention discloses the following technical effects:
[0018] This invention isolated and screened a strain of *Weissella cibaria* BWL4 from the surface of healthy grape fruits. This strain is a resident fungus in fruit cultivation. Using the plate confrontation and plate overlap methods, this strain was found to have an inhibitory effect on *Botrytis cinerea*. Experiments verified that this strain has a significant inhibitory effect on gray mold disease in grapes and kiwifruit. Microbial preparations made from this strain reduce the incidence of gray mold disease by inhibiting the growth of *Botrytis cinerea* on the surface of harvested fruits and vegetables, thereby improving the storage quality and extending the storage time of fruits and vegetables. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 The image shows the morphology of strain W. cibaria BWL4, where A represents the results of plate culture and B represents the results of microscopic observation. Scale bar = 50 μm.
[0021] Figure 2 The growth curve and pH changes of strain W. cibaria BWL4 are shown, where A represents the OD value during the growth of strain W. cibaria BWL4. 600 B represents the pH changes during the growth of strain W. cibaria BWL4;
[0022] Figure 3 The antibacterial effect of strain W. cibaria BWL4 on Botrytis cinerea is shown in Figure A, where W. cibaria BWL4 and Botrytis cinerea are plate-to-plate photographs and W. cibaria BWL4 and Botrytis cinerea are plate-to-plate photographs.
[0023] Figure 4 The inhibitory effect of strain W. cibaria BWL4 on spore germination and germ tube elongation of Botrytis cinerea is shown. Scale bar = 100 μm. A is a photograph of Botrytis cinerea spore germination; B is the data on spore germination rate and germ tube length of Botrytis cinerea.
[0024] Figure 5 The inhibitory effect of strain W. cibaria BWL4 on the penetrability of Botrytis cinerea spores;
[0025] Figure 6 The inhibitory effect of strain W. cibaria BWL4 on grape gray mold;
[0026] Figure 7 The inhibitory effect of strain W. cibaria BWL4 on gray mold in kiwifruit. Detailed Implementation
[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0028] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0029] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0030] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.
[0031] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0032] Example 1: Isolation, screening and identification of biocontrol bacterium W. cibaria BWL4
[0033] The biocontrol bacterium W. cibaria BWL4 was isolated from the surface of healthy grape berries and is a fruit-growing resident fungus. Using the plate confrontation method, it was found that the biocontrol bacterium W. cibaria BWL4 has an inhibitory effect on Botrytis cinerea.
[0034] 1. Isolation of strains
[0035] Take commercially available healthy grapes, cut them off the stem with scissors, place them in a sterilized 500mL beaker, add 200mL of sterile water, and shake at 150rpm for 1 hour. Dilute the suspension culture to 10... -1 10 -2 10 -3 Then, 100 μL of each sample was spread onto MRS agar plates and incubated statically at 25°C for 24 h. Single colonies were picked and streaked onto new MRS agar plates. The obtained monoclonal strains were then streaked a second time to obtain the purebred strain W. cibaria BWL4 (e.g., ...). Figure 1After growing for one day at 25°C on MRS medium, strain W. cibaria BWL4 formed milky-white, raised colonies with smooth edges. Microscopic observation revealed that the bacteria were short rods, 10-12 μm in length. The obtained strain was preserved in 30% glycerol at -80°C.
[0036] 2. Screening of strains
[0037] Preparation of spore suspension of *Botrytis cinerea*, a postharvest pathogen of fruits and vegetables: *Botrytis cinerea* was activated and cultured on V8 agar plates at 25°C for 7 days. Mycelia were scraped off and added to an Erlenmeyer flask containing 20 mL of sterile water. The mixture was shaken for 1 min, filtered through double-layered sterile gauze to remove mycelia, and spore concentration was measured using a hemocytometer. The spore concentration was then adjusted to 102. 5 The concentration of botrytis spores per mL yields a botrytis spore suspension.
[0038] V8 medium is the commonly used potato dextrose agar medium supplemented with 20% V8 vegetable juice (v / v) and 0.3% CaCO3 (w / v). The V8 vegetable juice is produced by Campbell's Soup Company (Australia).
[0039] The antibacterial effect of the strains was tested using two methods: plate confrontation and plate flipping.
[0040] Plate confrontation method: Inoculate the center of a PDA plate with a block of Botrytis cinerea mycelium and incubate at 25°C for 7 days. At this time, when the Botrytis cinerea has grown to 3 / 4 to full plate, take a 0.5 cm diameter Botrytis cinerea mycelium cake from near the edge of the mycelium with a punch and inoculate it into the center of a new PDA plate. Incubate at 25°C for 3-5 days. Inoculate purified W. cibaria BWL4 into liquid MRS medium and incubate overnight at 25°C. Use an inoculation loop to dip the bacterial solution into the PDA plate containing Botrytis cinerea and streak it. Observe the antibacterial effect after incubating at 25°C for 3 days.
[0041] Plate-to-plate method: Pour 15 mL of MRS medium and 15 mL of PDA medium into two 90 mm diameter plates respectively. Inoculate a 5 mm diameter Botrytis cinerea mycelium in the center of the PDA medium. Take the OD... 600 A 0.8 μg solution of *W. cibaria* BWL4 was streaked onto MRS medium. After inoculation, the PDA plates inoculated with *Botrytis cinerea* were inverted onto the MRS plates inoculated with *W. cibaria* BWL4, sealed with sealing film, and incubated at 25°C for 6 days. The results were then observed.
[0042] The MRS culture medium was purchased from Guangdong Huankai Biotechnology Co., Ltd.
[0043] The results are as follows Figure 3As shown, W. cibaria BWL4 can significantly inhibit the growth of Botrytis cinerea mycelium.
[0044] 3. Identification of strains
[0045] Strains with inhibitory effects were selected, and PCR amplification and sequencing were performed on the 16S rDNA, phenylalanyl-tRNA synthetase subunit alpha (Phes), chromosomal replication initiator protein (dnaA), and ATP synthetase subunit alpha (atpA) genes. The PCR amplification system used for amplifying the 16S rDNA, Phes, dnaA, and atpA gene sequences of the biocontrol bacterium W. cibaria BWL4 is shown in Table 1.
[0046] Table 1 PCR amplification system
[0047] Component Name Added amount <![CDATA[10×LATaqBufferII(Mg 2+ Plus)]]> 5μL dNTPs (2.5mM) 9μL Primer F (1 μM) 2μL Primer R (1 μM) 2μL DNA template 0.5μL High-fidelity Taq enzyme 0.5μL <![CDATA[ddH2O]]> 31μL
[0048] Table 2 shows the primers used to amplify the 16S rDNA, Phes, dnaA, and atpA gene sequences of the biocontrol bacterium W. cibaria BWL4, as well as the annealing temperature and extension time during PCR amplification. The specific PCR conditions were: pre-denaturation 95℃ × 4 min, [95℃ × 20 s, annealing temperature × 20 s, 72℃ × 1 extension time] × 35 cycles, and 72℃ × 10 min. After PCR, the fragment sizes were verified by gel electrophoresis, and the PCR products were sent to a sequencing company for sequencing.
[0049] Table 2 Primers and reaction conditions for PCR reactions of each gene
[0050]
[0051] The sequencing results of the PCR products are as follows:
[0052] Sequencing results of the 16S rDNA amplified fragment (SEQ ID NO.1):
[0053]
[0054] Sequencing results of the amplified fragment of the Phes gene (SEQ ID NO.2):
[0055] 5’-ATCTTGATGCGTACGCAAACGTCACCCGTTCAAGCCCGCACGTTGGAGTC ACACGACTTTAATGCTGGACCTTTGAAGATGGTATCACCTGGTCGTGTTTACCGTCGCGATACGGATGATGCAACGCACTCACACCAATTCCACCAAATGGAAGGACTTGTGATCGATAAGCACATCACGATGGGTGATTTGAAGGGAACGCTTTTGGCAGTTGCGCGCAACTTGTTTGGTGAAGACCATGATATTCGTTTGCGTCCATCGTACTTCCCATTCACGGAACCTTCTGTTGAAGTCGATGTGTCATGGAACGCGGTAACGCCTGACATGAACCCTGAAGATATCGAATGGATTGAAGTGCTT-3’.
[0056] Sequencing results of the amplified fragment of the dnaA gene (SEQ ID NO.3):
[0057] 5’-AACAATCCCAACGCCAAAGTTAAGTTCATTACGACTGAAGATTTCATTAAT GACTTCACGGAAGCTTTGCGTCGTGGTCAAAAAGAGACCGAAGCATTTAAGCGCGAATACCGCTCGACAGATCTCTTGCTAGTTGACGACGTCCAATTCTTGGCTGGTAAAGAAAAGATTCAAGAAGAATTCTTTAATACCTTCAATGCCATTACGCGAGAAAATCACCAAATCGTCCTGACATCAGATAAGTTACCAAAGGAAATTCCTGGCCTAGAAATGCGTTTGGTCACGCGTTTCGGGCAAGGTTATTCAGCAAACATTACGAAGCCTGACTTACCAACACGTGTCGCCATCCTACGTAACAAGTCAGATCAAGAAAACCTCAATATTCCAAATGATGTGATTGATGAAATCGCTGCGGCTGTTGATACGAACGTCCGTGATCTGGAAGGGGTCTTCAATCAAGTTGCTGGTAAGTTACGATTCGCATCACAGCCGGTCACGGTTGATACTGCTCGTGACATTCTCGAGACAATGAACTTCAAGCGGCAACGCGCCATCACGATTCCTATCATTCAAGATACGGTTGCAAAGTTCTTTGACGTGACCGTGCAAGACCTTAATGGTAAGAAGCGTAATAAGGAAATCGTGGTACCACGCCAAATCGCCATGTATTTGGCACGTGAGCTCACTCAAGAC-3’。
[0058] Sequencing result of the amplified fragment of atpA gene (SEQ ID NO.4):
[0059] 5’-TTGGTCGAGTTTGAGAACGGCGTATTTGGTATGGCACAAAACCTTGAGTC TAATGATGTTGGTATCATTATCCTAGGTAAGTACGACGAGATTCGCGAAGGCGATACTGTTAAGCGCACTGGTCGTATCATGGAAGTGCCTGTTGGTGAGGGATTGATCGGACGTGTTGTTAACGCATTGGGTCAACCAATCGACGGAATGGGACCAATTAACTCGACGAGCACTCGTCCAGTTGAAGTAAAGGCCCCAGGAGTTATGGAGCGTAAGTCTGTTTTCGAACCATTGCAAACTGGTTTGAAGGCCGTCGACGCCTTGGTTCCTATTGGTCGTGGACAACGTGAGTTGATCATCGGTGACCGTAAGACGGGTAAGACGTCTGTTGCCATCGACACGATCTTGAACCAAAAGGATCAAGACATGATCGTTATCTACGTGGCTATTGGACAAAAGGACTCAACTGTGCGTACGCAAGTTGAAACTTTGCGTCAAATGGGTGCTTTGGATTACACGATTGTTGTCTCAGCTGGTCCTTCAGAACCAGCCCCAATGTTGTACTTGGCACCTTATGCCGGAGCAGCAATGGGTGAAGAGTTCATGTACAACGGCAAGCACGTCTTGATTGTGTACGATGATTTGTCAAAGCAAGCTACGGCTTACCGTGAGCTGTCATTGATTCTTCGTCGTCCTCCTGGACGTGAAGCTTACCCTGGTGACGTCTTCTACTTGCACTCACGTTTGCTAGAACGTGCGGCTAAGTTGTCAGACGAATTGGGTGGCGGTTCTATGACTGCTTTGCCAGTTATCGAAACGCAAGCGGGTGACGTTTCTGCGTACATCCCAACGAACGTTATCTCAATCACCGACGGACAAATCTTCTTGGATGCCGACCAATTCTACGCCGGCGTACGTCCTGCCATCGAT-3’。
[0060] Sequencing results were compared with the NCBI (National Center for Biotechnology Information) database, identifying the strain as *Weissella cibaria*, and assigning it the strain number BWL4. Amplified fragments of the 16S rDNA, Phes, dnaA, and atpA genes have been submitted to the NCBI database, with sequence numbers MW133053, MW364859, MW364860, and MW364861, respectively. This strain was deposited at the China Center for Type Culture Collection (CCTCC) on January 19, 2021, with accession number CCTCCNO: M2021109.
[0061] 4. Growth curve of the strain
[0062] The strain W. cibaria BWL4 was inoculated into MRS liquid medium at a 1% inoculum and incubated statically at 25°C. OD values were measured at 2, 4, 6, 8, 12, 16, 24, 36, and 48 hours. 600 and pH value. Results are as follows: Figure 2 As shown, strain W. cibaria BWL4 entered the logarithmic growth phase after 2 hours of culture and reached the stationary phase after about 6 hours. The pH value decreased from 5.5 to about 4.0 within 12 hours and then remained stable.
[0063] Example 2: Effects of strain on spore germination and germ tube elongation of Botrytis cinerea
[0064] The strain W. cibaria BWL4 was inoculated into MRS liquid medium (purchased from Guangdong Huankai Biotechnology Co., Ltd.) and cultured overnight at 25°C. After centrifugation at 10000×g for 10 min, the supernatant, i.e., the W. cibaria BWL4 fermentation broth, was collected and added at 10% to PDA medium (purchased from Hangzhou Baishi Biotechnology Co., Ltd.). Plates were then poured (1-2 mm thick). A suspension of Botrytis cinerea spores was spread onto these plates and cultured at 25°C for 12 h. Spore germination rate and germ tube length were then measured. Each treatment contained 9 replicates, with each replicate containing 100 spores. A PDA control supplemented with 10% MRS medium was also included. Results are as follows: Figure 4 .
[0065] Depend on Figure 4 The results showed that the fermentation broth of *W. cibaria* BWL4 significantly inhibited the germination rate and germ tube length of *Botrytis cinerea* spores. The spore germination rate decreased by 10.6% (p<0.05) and the germ tube length decreased by 54.6% (p<0.05) in the treatment with added fermentation broth. These results indicate that treatment with *W. cibaria* BWL4 can significantly inhibit the germination of *Botrytis cinerea* spores.
[0066] Example 3: Inhibitory effect of strain on the penetrating power of Botrytis cinerea hyphae
[0067] Hyphae penetration indicates the pathogenicity of *Botrytis cinerea*; decreased penetration indicates decreased pathogenicity. *Botrytis cinerea* was inoculated onto V8 medium containing 10% *W. cibaria BWL4* supernatant (the *W. cibaria BWL4* fermentation broth from Example 2), and cultured at 25°C for 7 days. Spores were collected and prepared to a concentration of 10... 5 A suspension of *Botrytis cinerea* spores per mL was prepared. The inner epidermis of an onion was cut into 1 cm square pieces with a blade and then torn off. These pieces were then spread evenly in a petri dish and incubated at 68°C for 1 hour to kill the onion cells. 200 μL of the *Botrytis cinerea* spore suspension was dropped onto the onion epidermis, the petri dish was covered, and incubated at 25°C for 12 hours. The epidermis was stained with 0.25% trypan blue for 5 minutes, and then gently washed three times with phosphate buffer (50 mM, pH 7.0) to remove excess trypan blue stain. The mycelium was observed under an optical microscope to see if it could penetrate the onion cells. Mycelium that could penetrate the onion cells were difficult to stain with trypan blue because they were inside the cells; the mycelium was colorless or light blue. Mycelium that could not penetrate the cells grew on the surface of the onion epidermis and stained dark blue with trypan blue. *Botrytis cinerea* spores collected from normal V8 medium were used as a control. The experiment was repeated three times. The results are as follows: Figure 5 As shown, most hyphae in the control group were colorless, meaning they could penetrate onion cells, while most hyphae in the W. cibaria BWL4 supernatant treatment group were stained dark blue.
[0068] Example 4: Inhibitory effect of strain on gray mold in grapes and kiwifruit
[0069] 1. Inhibitory effect of the strain on grape gray mold
[0070] The strain W. cibaria BWL4 was inoculated into LB medium and cultured overnight at 25°C. After centrifugation at 6000×g for 10 min, the supernatant was discarded, and the culture was resuspended in 50 mM phosphate buffer (pH 7.0) to achieve a bacterial concentration of approximately 10⁻⁶. 8 CFU / mL, select undamaged and disease-free grapes, cut the fruit off the stem with scissors, wash with clean water, disinfect the surface with 1% sodium hypochlorite for 3 minutes, rinse thoroughly with sterile water, and air dry in a laminar flow hood. Make a hole in the center of the fruit, add 10 μL of *W. cibaria* BWL4 bacterial suspension to the hole, and use 10 μL of phosphate buffer instead of BWL4 bacterial suspension in the control group. After the liquid is completely absorbed, inoculate the hole with 10 μL of pathogen spore suspension (10 CFU / mL). 5 After the liquid was completely absorbed, the fruit was placed in a plastic basket, and a petri dish containing water was placed inside to maintain humidity. The basket was then covered with a plastic bag and placed at 21°C for 7 days. After peeling the fruit, the incidence rate was recorded, and the diameter of the lesions was measured. Each treatment contained 6 replicates, each replicate contained 3 parallels, and each parallel contained 30 grape fruits.
[0071] The results are as follows Figure 6 ,Depend on Figure 6 The results showed that, compared with the control group (inoculated only with Botrytis cinerea spores), the treatment group (inoculated with both Botrytis cinerea spores and W. cibaria BWL4 inoculum) exhibited milder disease severity in grapes, with a 38.4% reduction in disease incidence (p<0.05) and a 57.6% reduction in disease index (p<0.05). These results indicate that W. cibaria BWL4 treatment can significantly inhibit postharvest gray mold in grapes.
[0072] 2. Inhibitory effect of the strain on gray mold in kiwifruit
[0073] To simulate the effect of strain W. cibaria BWL4 on natural disease development in kiwifruit after storage, we used a spray inoculation method. Strain W. cibaria BWL4 was inoculated into MRS medium, incubated overnight at 25°C, centrifuged at 6000×g for 10 min, the supernatant was discarded, and the culture was resuspended in 50 mM phosphate buffer (pH 7.0) to achieve a bacterial concentration of approximately 10⁻⁶. 8 For kiwifruit with CFU / mL, select undamaged and disease-free kiwifruit, wash with clean water, disinfect the surface with 1% sodium hypochlorite for 3 minutes, rinse thoroughly with sterile water, and air dry in a laminar flow hood. Evenly spray with a suspension of *W. cibaria* BWL4 bacteria; in the control group, use 10 μL of phosphate buffer instead of the *W. cibaria* BWL4 suspension. After the kiwifruit surface is completely dry, evenly spray with a suspension of *Botrytis cinerea* spores. After the kiwifruit surface is completely dry, place them in a plastic basket, place a petri dish containing clean water inside to maintain humidity, cover the basket with a plastic bag, and incubate at 21℃ for 15 days. Pathogen incidence is then recorded. Each treatment contains 3 replicates, each replicate contains 2 parallels, and each parallel contains 20 kiwifruit fruits.
[0074] The results are as follows Figure 7 As shown, by Figure 7 The results showed that, compared with the control group (sprayed only with botrytis spores), the treatment group (sprayed with both botrytis spores and W. cibaria BWL4 bacterial solution) exhibited milder disease severity in kiwifruit, with a 64.1% reduction in disease incidence (p<0.05) and a 56.4% reduction in disease index (p<0.05). These results indicate that W. cibaria BWL4 treatment can significantly inhibit postharvest gray mold in kiwifruit.
[0075] Example 5: Application of strain W. cibaria BWL4 in fruit and vegetable storage
[0076] Microbial preparations were prepared using strain W. cibaria BWL4:
[0077] Step 1: Prepare the preservative: 12% skim milk, 1% trehalose, 1% monosodium glutamate, and 3% glycerol, sterilize and set aside for later use;
[0078] Step 2: Inoculate the biocontrol bacterium W. cibaria BWL4 into 50 ml LMRS medium and incubate in a shaker at 25°C for 18 h;
[0079] Step 3: Inoculate the bacterial culture obtained in Step 2 into a new MRS medium at a volume percentage of 5% for expansion culture, under the same culture conditions as in Step 2;
[0080] Step 4: Centrifuge the culture from Step 3 at 5000×g for 4 min, discard the supernatant, then wash twice with phosphate buffer (50mM, pH 7.0), centrifuge at 5000×g for 4 min each time, discard the supernatant, obtain fresh bacterial cells, and weigh them;
[0081] Step 5: Add the protective agent prepared in Step 1 to the fresh bacterial cells at a ratio of 1g:1mL, stir evenly, freeze dry under vacuum, pulverize and pass through a 300-mesh sieve to obtain the microbial preparation of biocontrol bacterium W. cibaria BWL4.
[0082] The microbial preparation obtained above was diluted with 100 times its mass of water, dissolved, and then sprayed on the harvested kiwifruit, grapes, apples, and pears. The mass ratio of the microbial preparation of W. cibaria BWL4 to the kiwifruit, grapes, apples, and pears was 1:10000.
[0083] After 3 weeks of storage, no obvious disease symptoms were observed in the fruits and vegetables.
[0084] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A strain of *Weissella cibaria* BWL4 for controlling gray mold in fruits and vegetables, characterized in that, The *Westernella esculenta* BWL4 strain was deposited at the China Center for Type Culture Collection on January 19, 2021, with accession number CCTCCNO: M2021109.
2. A microbial preparation, characterized in that, Includes Weissella esculenta BWL4 as described in claim 1.
3. A method for preventing and controlling gray mold in fruits and vegetables, characterized in that, Spray or apply the bacterial solution of Weissella esculenta BWL4 as described in claim 1 or the microbial preparation as described in claim 2 onto the surface of fruits and vegetables.
4. The method according to claim 3, characterized in that, The bacterial concentration of *Westernella esculenta* BWL4 is greater than or equal to 10. 8 CFU / mL.
5. The method according to claim 3, characterized in that, The microbial preparation is used after being diluted at a mass-to-volume ratio of 1 kg of microbial preparation to 50-100 L of water.
6. The method according to claim 3, characterized in that, The ratio of the amount of the microbial agent to the mass of the fruits and vegetables is 1:1000-10000.
7. The application of *Westernella esculenta* BWL4 as described in claim 1 or the microbial preparation as described in claim 2 in the prevention and control of gray mold in fruits and vegetables.
8. The application of *Westernella esculenta* BWL4 as described in claim 1 or the microbial preparation as described in claim 2 in the storage of harvested fruits and vegetables.
9. The application according to claim 8, characterized in that, By inhibiting the growth of gray mold on the surface of harvested fruits and vegetables, the incidence of gray mold disease can be reduced, thereby improving the storage quality of fruits and vegetables.
10. The application according to claim 9, characterized in that, The inhibition of the growth of gray mold on the surface of harvested fruits and vegetables includes inhibiting the spore germination, germ tube elongation, and hyphal penetration of the gray mold.
Citation Information
Patent Citations
Weissella fusion MP4 strain with antibacterial effect and application thereof
CN110862936A
Weissella sinus with broad-spectrum antibacterial activity
CN114703084A