A library construction sequencing method for determining methylation differences between positive and negative strands of DNA molecules

By performing molecular tagging and bisulfite conversion on double-stranded DNA molecules, combined with PCR amplification and sequencing, the problem of accurately identifying the differences in methylation modifications between the positive and negative strands of DNA molecules was solved, enabling more precise detection of methylation differences.

CN116200458BActive Publication Date: 2026-03-03MGI TECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-11-30
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

Existing whole-genome sequencing methods cannot accurately determine the differences in methylation modifications between the positive and negative strands of the same DNA molecule, making it impossible to distinguish whether the differences between the positive and negative strands originate from the same DNA molecule or from differences in homologous chromosomes.

Method used

The molecular tag UMI is used to label the positive and negative strands of DNA double-stranded molecules. After bisulfite conversion, combined with PCR amplification and sequencing, the molecular tag is used to determine the difference in methylation modification between the positive and negative strands of the same DNA molecule.

Benefits of technology

It enables precise detection of differences in methylation between the positive and negative strands of the same DNA molecule across the entire genome, improving the accuracy of detecting dynamic changes in methylation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003383292140000071
    Figure BDA0003383292140000071
  • Figure BDA0003383292140000081
    Figure BDA0003383292140000081
  • Figure BDA0003383292140000131
    Figure BDA0003383292140000131
Patent Text Reader

Abstract

The application discloses a library sequencing method for determining methylation difference of positive and negative strands of DNA molecules. The application provides a library sequencing method for determining methylation difference of positive and negative strands of DNA molecules, comprising the following steps: 1) using molecular tags UMI to label positive and negative strands of a plurality of DNA double-stranded molecules to obtain a DNA molecule library labeled with molecular tags; 2) performing bisulfite conversion on DNA molecules in the DNA molecule library, converting unmethylated modified C bases in the DNA molecules into U bases to obtain converted DNA molecules; 3) sequentially performing PCR amplification, constructing a sequencing library and sequencing on the converted DNA molecules; and determining the difference in methylation modification of positive and negative strands of the same DNA molecule. Compared with traditional whole genome methylation sequencing, the application can more accurately detect the methylation difference of DNA molecules, and more accurately detect the dynamic change of methylation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a library construction and sequencing method for determining the differences in methylation between the positive and negative strands of DNA molecules. Background Technology

[0002] DNA methylation is an important manifestation of epigenetics, reflecting both changes in traits caused by environmental differences and heritable characteristics that can be passed on to offspring during DNA replication. DNA methylation regulates gene expression and plays a crucial role in maintaining normal cellular function and genetic imprinting, as well as in embryonic development and human tumorigenesis. Broadly speaking, DNA methylation refers to the chemical modification process in which a base on the DNA strand, under the catalysis of DNA methyltransferases, acquires a methyl group through covalent bonding using S-adenosyl methionine (SAM) as the methyl donor. Methylation can occur at the C5 position of cytosine, the N6 position of adenine, and the N7 position of guanine. Current research on DNA methylation mainly focuses on the methylation of the C5 position of cytosine, which accounts for approximately 1% of the methylated cytosine in the human genome, making it the most abundant DNA modification discovered to date. However, DNA methylation modification is not completely stable but rather changes dynamically over a certain period of time. For example, during embryonic development, DNA undergoes multiple demethylation and remethylation processes. DNA methylation relies on DNA methyltransferases, while DNA demethylation can occur in two ways: First, there is active DNA demethylation, which is periodic, starting with 5mC and ending with unmodified C. 5mC can be oxidized to 5-hydroxymethylcytosine (5hmC), a process carried out by a family of proteins called TET (ten-eleven translocation). 5hmC can be further oxidized to 5-aldehyde cytosine and 5-carboxycytosine, namely 5fC and 5caC. 5fC and 5caC are recognized and cleaved by thymine DNA glycosyltransferase (TDG), removing 5fC and 5caC from the DNA, resulting in an unmodified C after repair. Second, there is passive DNA demethylation. Due to the lack of methylation maintenance enzymes, methylated cytosine is diluted in the genome. During passive DNA demethylation, the absence of methylation-maintaining enzymes can lead to a transmutation where the template strand is methylated while the replicating strand remains unmethylated. This results in methylation differences between the two strands of DNA, which can potentially cause abnormal gene expression. Currently, there are no sequencing methods capable of accurately determining these differences in methylation modifications across the double strands of the same DNA molecule.

[0003] Among the numerous methods for detecting DNA methylation modifications, next-generation sequencing (NGS)-based DNA methylation detection methods are the most widely used. Among these NGS-based methylation detection methods, whole-genome sequencing (WGBS) based on bisulfite (BS) treatment is currently the most commonly used method. WGBS uses bisulfite treatment (commonly known as BS conversion) to "convert" unmethylated C atoms to uracil (U), which is then "converted" to thymine (T) by PCR amplification. The methylated 5mC and 5hmC atoms remain unconverted. By analyzing the C / T ratio of the bases at their original positions in the sequencing data, the methylation level of the DNA can be determined. Relying on this base conversion, the bisulfite conversion method can detect the methylation status of each cytosine, providing information on the methylation status of individual sites. However, whole-genome sequencing based on bisulfite (BS) treatment alters the C bases on the positive and negative strands of double-stranded DNA molecules after bisulfite transformation, resulting in different sequences for the positive and negative strands. Sequencing analysis can reveal different methylation patterns, but it cannot determine whether the differences between the positive and negative strands originate from the same DNA molecule or from differences between homologous chromosomes. Summary of the Invention

[0004] One object of the present invention is to provide a library preparation and sequencing method for determining the differences in methylation between the positive and negative strands of a DNA molecule.

[0005] The method provided by this invention includes the following steps:

[0006] 1) The positive and negative strands of multiple DNA double-stranded molecules are labeled using molecular tags UMI to obtain a DNA molecule library labeled with molecular tags; in the DNA molecule library, the positive and negative strands of the same DNA double-stranded molecule are labeled with the same molecular tag UMI.

[0007] In the above, different DNA double-stranded molecules carry different molecular tags, while the positive and negative strands of the same DNA double-stranded molecule carry the same molecular tags.

[0008] In each DNA molecule, the positive strand has different molecular tags at the 5' and 3' ends, the negative strand has the same tag at the 3' end and the positive strand has the same tag at the 5' end.

[0009] 2) The DNA molecules in the DNA library are converted by bisulfite, so that the unmethylated C bases in the DNA molecules are converted into U bases, and the converted DNA molecules are obtained.

[0010] 3) The transformed DNA molecules were sequentially subjected to PCR amplification, sequencing library construction, and sequencing; based on the positive and negative strand data of DNA molecules with the same molecular tag in the sequencing results, the differences in methylation modification of the positive and negative strands of the same DNA molecule were determined.

[0011] The method described above, which involves using molecular tags (UMI) to label the positive and negative strands of multiple DNA double-stranded molecules, is as follows:

[0012] 1) Connect the 3-end adapter set with multiple molecular tags to multiple DNA double-stranded molecules to obtain DNA molecules with 3-end adapters;

[0013] The three-terminal connector group with multiple molecular tags consists of multiple three-terminal connectors with different molecular tags, and each three-terminal connector has a different molecular tag.

[0014] Each of the three-terminal connectors consists of a top chain and a bottom chain, and the C base in the three-terminal connector is a methylated C.

[0015] The Top chain from the 5' end to the 3' end comprises the following four parts:

[0016] 1) The first fixed sequence consists of nucleotides ranging from 8bp to 16bp in size; in the embodiments of this invention, it is AGTCGGAGGCCAA.

[0017] 2) The second sequence is a UMI molecular tag, which consists of a random sequence of 6-25 Ns, where N is any one of A, T, C, and G, and C is a methylated C.

[0018] 3) The third fixed sequence consists of nucleotides ranging from 6bp to 24bp in size; in the embodiments of this invention, it is GCGGTCTTAGGAAGAC, which serves as the 5-terminal linker binding site;

[0019] 4) The fourth fixed sequence consists of nucleotides of 15bp-20bp in size, which is used to bind sequencing primers; depending on the sequencing platform, it is AACAACTCCTTGGCTCACA in the embodiments of this invention.

[0020] The Tm value of the first fixed sequence in the Top chain needs to be at least 10°C lower than the Tm value of the third fixed sequence, and the 5' end needs to be chemically modified.

[0021] The bottom chain is a sequence that is anticomplementary to the first fixed sequence in the top chain (specifically, an anticomplementary sequence starting from the 3' end of the first fixed sequence in the top chain for 8-12 bp), and the 3' end of the bottom chain is chemically modified; in the embodiment of the present invention, the bottom chain is TTCAGCCTCC, and the 3' end of the bottom chain is phosphorylated.

[0022] The chemical modification can be of many types, such as phosphorylation modification and dideoxy modification.

[0023] 2) Extend the 5-end adapter to the DNA molecule that is connected to the 3-end adapter to obtain DNA molecules that are connected to the 5-end and 3-end adapters, which are DNA molecules with the same molecular tag on the positive and negative strands. These DNA molecules form a DNA molecule library.

[0024] The 5-end connector consists of the following two sequences:

[0025] The first sequence is a sequence that is completely inversely complementary to the fixed sequence of the third segment of the Top chain of the 3-end connector.

[0026] The second sequence is a 25-30 bp fragment that is not complementary to the TOP chain of the 3-terminal connector, and in the embodiment of the present invention it is GAACGACATGGCTACGATCCGACTT;

[0027] The C base in the 5-terminal connector is a methylated C, and the dCTP in the extended connection is a methylated dCTP.

[0028] In the above method, in step 1), the size of the DNA double-stranded molecule is 100bp to 2000bp;

[0029] Alternatively, in step 1), if the DNA double-stranded molecule is greater than 2000 bp, then the following step is included before step 1): fragmenting the DNA molecule to 100 bp to 2000 bp.

[0030] The present invention also provides a kit for library preparation and sequencing to determine differences in methylation between the positive and negative strands of a DNA molecule.

[0031] The kit provided by this invention includes the aforementioned 3-end connector, the aforementioned 5-end connector, and the reagents required for bisulfite conversion.

[0032] In the embodiments of the present invention, the reagent required for bisulfite conversion is EZ DNA Methylation-Gold Kit.

[0033] The kit also includes primers for PCR amplification and reagents required for sequencing library construction.

[0034] The primers used in the above PCR amplification bind to the fourth universal sequence of the 3-end adapter and the first universal sequence of the 5-end adapter. In the embodiments of the present invention, they are specifically derived from the PCR Primer Mix of MGIEasy DNA Library Preparation Kit 1000005254.

[0035] The reagents required for the above sequencing library construction are detailed in the reagents used in Example 2, Section 4.

[0036] Another objective of this invention is to provide a method for library construction that determines the differences in methylation between the positive and negative strands of a DNA molecule.

[0037] The method provided by the present invention includes PCR amplification and construction of sequencing libraries in steps 1)-2) and 3) of claims 1-3, to obtain sequencing libraries that determine the differences in methylation of the positive and negative strands of DNA molecules.

[0038] The application of the above method or the sequencing library prepared by the above method in determining the difference in methylation of the positive and negative strands of DNA molecules is also within the scope of protection of this invention.

[0039] The application of the above method or the sequencing library prepared by the above method in determining the differences in methylation of the positive and negative strands of DNA molecules from the same source is also within the scope of protection of this invention.

[0040] This invention uses unique molecular tags to label the positive and negative strands of DNA double-stranded molecules, ensuring that the positive and negative strands from the same DNA molecule are tagged with the same molecular tag. During bisulfite transformation of DNA molecules, the same molecular tag is attached to the positive and negative strands of the DNA molecule for labeling, so that the newly generated DNA double strands after bisulfite transformation are also labeled. After sequencing, the molecular tags are used to map the sequencing information back to the positive and negative strands of the DNA. The unique molecular tags are used to identify reads from the positive and negative strands of the same DNA molecule, determine whether the cytosine on the positive and negative strands of the same DNA molecule is in the same methylation modification state, and determine the differences in methylation modification between the positive and negative strands of the same DNA molecule.

[0041] The most significant advantage of this invention is its ability to detect methylation differences between the positive and negative strands of the same DNA molecule across the entire genome. By attaching the same molecular tag to both the positive and negative strands of the DNA molecule, and then using the molecular tag to locate data from the same DNA molecule after sequencing, it can determine whether both strands of the DNA molecule simultaneously exhibit methylation modification. Compared to traditional whole-genome methylation sequencing, this invention can more accurately detect differences in DNA methylation and provides more precise detection of dynamic changes in methylation. Attached Figure Description

[0042] Figure 1A schematic diagram of a sequencing method for differentiating positive and negative strand methylation in DNA molecules.

[0043] Figure 2 Flowchart of a sequencing method for differentiating positive and negative strand methylation in DNA molecules.

[0044] Figure 3 This refers to differences in methylation between homologous chromosome DNA fragments and differences in methylation between the two strands of DNA molecules. Detailed Implementation

[0045] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0046] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0047] Example 1: Establishment of a library construction and sequencing method for determining differences in methylation between the positive and negative strands of the same DNA molecule.

[0048] The principle of differential sequencing to distinguish methylation on the positive and negative strands of DNA molecules is as follows: 1) This invention uses a unique molecular tag to label the positive and negative strands of a DNA double-stranded molecule, so that the positive and negative strands from the same DNA molecule are labeled with the same molecular tag. The specific labeling method is as follows: first, the 3-end adapter with the unique molecular tag UMI is ligated to the DNA molecule, and then the 5-end adapter primer is used for annealing extension and re-ligation to add the 5-end adapter to the DNA molecule; 2) then bisulfite conversion is performed; 3) PCR amplification is performed to obtain two groups of different DNA molecules with the same molecular tag; 4) library construction and sequencing are performed to detect the molecular tag and DNA molecule sequences. The reads with the same molecular tag are linked and analyzed to detect the methylation modification status on the positive and negative strands of the same DNA molecule. Figure 1 , Figure 2 ).

[0049] The specific steps of the above method are as follows:

[0050] I. Using unique molecular tags to label the positive and negative strands of DNA double-stranded molecules.

[0051] 1. Obtaining fragmented DNA molecules

[0052] Fragmenting complete genomic DNA involves breaking long DNA molecules into fragments of 100bp to 2000bp using either physical or enzymatic methods, resulting in fragmented DNA.

[0053] If the DNA sample is fragmented into 100bp to 2000bp segments, it does not need to be broken down (including extracellular free DNA, degraded DNA, etc.).

[0054] 2. End repair and 3' end A addition

[0055] The fragmented DNA obtained in step 1 was subjected to end repair and 3' end A addition reaction to obtain DNA molecules with added A.

[0056] 3. Connect the 3-terminal connector with a unique molecular tag.

[0057] The 3-end adapter is connected to the DNA molecule with added A obtained in step 2 to obtain a DNA molecule with 3-end adapter, wherein the 3' end of the positive strand of the DNA molecule is connected to the top strand of the 3-end adapter, and the 5' end of the negative strand of the DNA molecule is adjacent to the bottom strand of the 3-end adapter and is not connected.

[0058] The aforementioned three-terminal linker consists of a top chain and a bottom chain, and all C bases used in the three-terminal linker are methylated C bases; the specific structure is as follows:

[0059] The top chain comprises the following four parts from the 5' end to the 3' end, and the 5' end is modified. In this invention, phosphorylation modification is taken as an example:

[0060] 1) The first fixed sequence: 8bp-16bp, which is AGTCGGAGGCCAA (sequence 1) in the embodiment of the present invention, wherein part of the sequence is inversely complementary to the bottom chain;

[0061] 2) The second sequence: is the UMI molecular tag, which is a random sequence consisting of 6-25 N (the cytosine in N needs to be methylated cytosine), and its function is to tag the same DNA molecule;

[0062] 3) The third fixed sequence: 6bp-24bp, which is GCGGTCTTAGGAAGAC (sequence 2) in the embodiment of the present invention, and serves as the 5-end connector binding site;

[0063] 4) The fourth fixed sequence: 15bp-20bp in size, a universal fixed sequence, whose function is to bind sequencing primers. The size varies depending on the sequencing platform. In the embodiment of this invention, it is AACAACTCCTTGGCTCACA (sequence 3).

[0064] In particular, the Tm value of the first fixed sequence in the Top chain needs to be at least 10°C lower than the Tm value of the third fixed sequence.

[0065] Bottom strand: A sequence that is reverse complementary to the first fixed sequence in the Top strand (specifically, a sequence 8-12 bp reverse complementary to the 3' end of the first fixed sequence in the Top strand), and the 3' end of the Bottom strand is chemically modified (such as phosphorylation or dideoxy modification) to prevent it from being linked to the 5' end of the DNA molecule. In the embodiments of this invention, it is TTCAGCCTCC.

[0066] 4. Extension connection 5-end connector

[0067] The 5' end adapter is extended and connected to the DNA molecule that connects to the 3' end adapter, resulting in a DNA molecule that connects the 5' end adapter and the 3' end adapter. The 5' end of the positive strand of the DNA molecule is connected to the 5' end adapter and the 3' end is connected to the top strand of the 3' end adapter. The reverse strand is the top strand that connects to the end adapter at the 5' end and the 3' end is connected to the 5' end adapter. The bottom strand falls off during the extension process.

[0068] The aforementioned 5'-terminal adapter is a single-stranded DNA molecule composed of two sequences. All C bases in the 5'-terminal adapter are methylated C bases. The 5'-terminal adapter consists of the second sequence and the first sequence, respectively, from the 5' end to the 3' end.

[0069] The first sequence is the complete inverse complementary sequence to the third fixed sequence of the 3-end connector Top chain.

[0070] The second sequence is a 25-30 bp fragment that is not complementary to the TOP chain at the 3-end, specifically GAACGACATGGCTACGATCCGACTT (sequence 4).

[0071] The specific extension ligation method is as follows: The 5' adapter is added to the extension ligation reaction system for annealing. The 5' adapter can be complementary to the fixed sequence of the third segment of the top strand of the 3' adapter. Then, extension is performed, the bottom falls off, and after extending to the 5' end of the DNA molecule, the ligation reaction is performed to connect the 5' adapter to the DNA molecule.

[0072] After the reaction is complete, the positive and negative strands of the DNA molecule have been given the same two molecular tags, which are located at the two ends of the DNA molecule respectively.

[0073] II. Bisulfite treatment converts unmethylated C bases into U bases.

[0074] The DNA molecules with 5-end and 3-end adapters obtained in step 4 of the above process were treated with bisulfite to obtain DNA molecules after the bisulfite conversion reaction.

[0075] The above reaction converts all unmethylated C bases in the DNA molecule into U bases, and the DNA double helix becomes two single-stranded DNA molecules, one positive and one negative. However, single-stranded DNA molecules from the same DNA double helix all carry the same molecular tag.

[0076] III. PCR Amplification

[0077] The DNA molecules obtained from the bisulfite conversion reaction were subjected to PCR to obtain the PCR product.

[0078] The primers used in PCR bind to the fourth universal sequence of the 3-end adapter and the first universal sequence of the 5-end adapter, respectively.

[0079] After PCR amplification, the U on the DNA molecule is converted to T, and one DNA double-stranded molecule produces a set of DNA double-stranded products with adapters.

[0080] IV. Sequencing

[0081] 1) Illumina sequencing

[0082] The PCR products obtained from the above three steps were sequenced using the Illumina sequencing platform. Paired-end sequencing was used, where the sequencing primers bound to the fourth fixed sequence in the top strand of the 3-end adapter, with each end sequenced at least 100 bp. The positive strand reads1 and negative strand reads2 of the DNA molecule will have the same molecular tag, and the positive strand reads2 and negative strand reads1 will also have the same molecular tag.

[0083] 2) DNBSEQ sequencing

[0084] If using the DNBSEQ sequencing platform, the PCR products obtained from the above three steps will be further subjected to single-strand circularization and digestion to obtain a single-stranded circular sequencing library.

[0085] Single-stranded circular sequencing libraries were sequenced using the DNBSEQ sequencing platform, employing paired-end sequencing. Sequencing primers were bound to the fourth fixed sequence in the top strand of the 3-end adapter, with each end sequenced at least 100 bp. Reads1 on the positive strand of the DNA molecule and reads2 on the negative strand will carry the same molecular tag, and vice versa.

[0086] V. Analysis to determine the differences in methylation between the positive and negative strands of the same DNA molecule

[0087] The sequencing data obtained above are analyzed, and the data after sequencing are quality controlled to remove low-quality reads. The data are then compared with the genome, and statistical analysis is performed. The detected molecular tags are counted, and the reads are grouped using the molecular tags. Reads with the same molecular tag are grouped together, and reads from both ends of the same DNA molecule are grouped together. Methylation analysis is then performed, and the methylation level of the positive and negative strands of the same DNA molecule is determined based on the ratio of C bases to T bases. This determines whether the positive and negative strands have methylation modification at the corresponding sites.

[0088] Example 2: Library construction and sequencing of human blood DNA samples to determine differences in positive and negative strand methylation of DNA molecules.

[0089] Experimental materials: DNA samples extracted from whole blood of normal individuals. The experiment was repeated twice, once named T1 and once named T2.

[0090] I. Using molecular tags to label the positive and negative strands of DNA double-stranded molecules

[0091] 1. Obtaining fragmented DNA molecules

[0092] 1) Prepare 500 ng DNA sample into a 0.2 mL PCR tube, add NF Water to make up the volume to 45 μL, and place the PCR tube on an ice box.

[0093] 2) Take out Frag Enzyme and Frag Buffer (MGIEasy whole genome methylation library preparation kit, 1000005251), gently invert and mix 10 times, centrifuge briefly and place on ice for later use.

[0094] 3) Prepare the reaction interruption solution on ice according to Table 1 below.

[0095] Table 1 shows the interrupted reaction solution.

[0096] Components Single reaction volume Frag Buffer 10μL Frag Enzyme 5μL Total volume 15μL

[0097] 4) Use a pipette to add 15 μL of the prepared interrupted reaction solution to the PCR tube, vortex 3 times for 3 seconds each time, and then centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0098] 5) When the temperature of the PCR instrument drops to 4℃, place the PCR tube on the PCR instrument and perform the fragmentation reaction according to the conditions in Table 2 below.

[0099] Table 2 shows the conditions for the fragmentation reaction.

[0100]

[0101]

[0102] 6) Centrifuge briefly to collect the reaction solution to the bottom of the tube, transfer all the liquid to a new 1.5 mL centrifuge tube, and add TE to 100 μL.

[0103] 7) Take out the DNA Clean Beads (MGIEasy Whole Genome Methylation Library Preparation Kit, 1000005251) in advance, place them at room temperature for at least 30 minutes to equilibrate, and shake them thoroughly before use.

[0104] 8) Use a pipette to transfer 70 μL of DNA Clean Beads into a new 1.5 mL centrifuge tube and gently pipette at least 10 times until completely mixed. On the last transfer, make sure all liquid and magnetic beads in the pipette tip are transferred into the centrifuge tube.

[0105] 9) Incubate at room temperature for 10 min, then briefly centrifuge. Place the centrifuge tube on a magnetic rack and let it stand for 5 min until the liquid is clear. Carefully aspirate the supernatant into a new 1.5 mL centrifuge tube using a pipette.

[0106] 10) Use a pipette to transfer 20 μL of DNA Clean Beads into a new 1.5 mL centrifuge tube and gently pipette at least 10 times until completely mixed. On the last transfer, make sure all liquid in the pipette tip and the magnetic beads are transferred into the centrifuge tube.

[0107] 11) Keep the centrifuge tubes on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, rinse the magnetic beads and tube walls, let stand for 30 seconds, carefully aspirate and discard the supernatant.

[0108] 12) Repeat the previous step to remove as much liquid as possible from the tube. If a small amount of liquid remains on the tube wall, centrifuge the tube briefly. After separating the tubes on a magnetic rack, use a small-capacity pipette to remove the liquid from the bottom of the tube.

[0109] 13) Keep the centrifuge tubes fixed on the magnetic rack, open the centrifuge tube caps, and allow them to dry at room temperature until the surface of the magnetic beads is no longer reflective.

[0110] 14) Remove the centrifuge tube from the magnetic rack, add 32 μL of TE Buffer (MGIEasy whole genome methylation library preparation kit, 1000005251) to elute the DNA, and gently pipette at least 10 times until completely mixed.

[0111] 15) Incubate at room temperature for 5 min, then centrifuge briefly. Place the centrifuge tube on a magnetic rack and let it stand for 5 min until the liquid is clear. Transfer 30 μL of supernatant to a new 0.2 mL PCR tube to obtain fragmented DNA.

[0112] 2. End repair and 3' end A addition

[0113] 1) Use The fragmented DNA obtained in step 1 was quantified using the ssDNA Assay Kit according to the kit's instructions. 20 ng of the fragmented DNA was transferred to a new 0.2 mL PCR tube. The PCR tube was placed on an ice box, and 1 / 20 of the previously fragmented Unmodified CpG-methylated λ-DNA (used to assess sulfite conversion efficiency, from the MGIEsay Whole Genome Methylation Library Preparation Kit, MGI, 1000005251) was added.

[0114] 2) Prepare the end repair reaction solution on ice according to the formula in Table 3 below, based on the required number of reactions (the reagents are from the MGIEAsy whole genome methylation library preparation kit, 1000005251).

[0115] Table 3 shows the end-repair reaction solution.

[0116] Components Single reaction volume ER Buffer Mix 7.3μL ER Enzyme Mix 2.7μL Total volume 10μL

[0117] 3) Use a pipette to add 10 μL of the prepared end-repair reaction solution shown in Table 3 into the PCR tube, vortex 3 times for 3 seconds each time, and then centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0118] 4) Place the PCR tube on the PCR instrument and perform the reaction according to the conditions in Table 4 below.

[0119] Table 4 shows the end-repair reaction conditions (reaction system 40 μL).

[0120] temperature time 65℃ hot cap On 25℃ 30min 4℃ Hold

[0121] 5) After the reaction is complete, centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0122] 6) Use a pipette to add 6 μL of ER Stop Buffer to a 0.2 mL PCR tube, vortex 3 times for 3 seconds each time, and then centrifuge briefly to collect the reaction solution to the bottom of the tube. Let it stand for 2 minutes.

[0123] 7) Place the above 0.2 mL PCR tubes on a PCR instrument that has been preheated to 75°C and react for 20 min to terminate the reaction.

[0124] 8) After the reaction is complete, the reaction solution is collected to the bottom of the tube by instantaneous centrifugation.

[0125] 9) Prepare the AT end repair reaction solution shown in Table 5 on ice (the reagents are from the MGIEAsy whole genome methylation library preparation kit, 1000005251).

[0126] Table 5 shows the AT reaction solution for end-repair.

[0127] Components Single reaction volume AT Buffer Mix 3.8μL AT Enzyme Mix 0.2μL Total volume 4μL

[0128] 10) Use a pipette to add 4 μL of the prepared end-repair AT reaction solution shown in Table 5 into the PCR tube, vortex 3 times for 3 seconds each time, and then centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0129] 11) Place the PCR tube on the PCR instrument and perform the A addition reaction according to the conditions in Table 6 below.

[0130] Table 6 shows the AT reaction conditions (reaction system 50 μL).

[0131] temperature time 65℃ hot cap On 25℃ 30min 4℃ Hold

[0132] 12) After the reaction is complete, the reaction solution is collected to the bottom of the tube by instantaneous centrifugation to obtain DNA molecules with added A.

[0133] 3. Connect the 3-terminal connector

[0134] The specific sequence of the 3-terminal linker is as follows, and the C bases in the 3-terminal linker are all dmC:

[0135] Top chain: / 5Phos / AGTCGGAGGCCAA (first fixed sequence) NNNNNNNNNNN (second sequence) GCGGTCTTAGGAAGAC (third fixed sequence) AACAACTCCTTGGCTCACA (fourth fixed sequence);

[0136] Bottom chain: TTCAGCCTCC, and the 3' end of the Bottom chain is phosphorylated.

[0137] 1) Add 5 μL of the corresponding 3-end adapter to the PCR tube, vortex 3 times for 3 seconds each time, and then centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0138] 2) Prepare the adapter ligation reaction solution on ice according to the formula in Table 7 below, based on the required number of reactions (the reagents are from the MGIEAsy whole genome methylation library preparation kit, 1000005251).

[0139] Table 7 lists the connectors for connecting the reaction solution.

[0140] Components Single reaction volume Ligation Buffer 23.4μL DNA Ligase 1.6μL Total volume 25μL

[0141] 3) Slowly pipette 25 μL of the prepared adapter connection reaction solution shown in Table 7 (the concentration of the 3-end adapter in the reaction solution is 5 μM) into the PCR tube, vortex 6 times for 3 seconds each time, and then centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0142] 4) Place the above PCR tubes on a PCR instrument and react at 23°C for 30 minutes.

[0143] 5) After the reaction is complete, briefly centrifuge to collect the reaction solution to the bottom of the tube. Transfer all of it to a new 1.5 mL centrifuge tube.

[0144] 6) Remove the DNA Clean Beads in advance and allow them to equilibrate at room temperature for at least 30 minutes. Shake well before use. Transfer 40 μL of DNA Clean Beads to a new 1.5 mL centrifuge tube from the previous step. Gently pipette at least 10 times until all magnetic beads are suspended. On the last transfer, ensure that all liquid and magnetic beads in the pipette tip are transferred into the centrifuge tube.

[0145] 7) Incubate at room temperature for 10 minutes.

[0146] 8) Centrifuge the centrifuge tube briefly, place it on a magnetic rack, let it stand for 2 minutes until the liquid is clear, carefully aspirate the supernatant with a pipette and discard it.

[0147] 9) Keep the centrifuge tubes on the magnetic rack, add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads and tube walls, let stand for 30 seconds, then carefully aspirate and discard the supernatant.

[0148] 10) Repeat the previous step to remove as much liquid as possible from the tube. If a small amount of liquid remains on the tube wall, the centrifuge tube can be centrifuged briefly. After separation on a magnetic rack, use a small-capacity pipette to remove the liquid from the bottom of the tube.

[0149] 11) Keep the centrifuge tubes on the magnetic rack, open the centrifuge tube caps, and allow them to dry at room temperature until the surface of the magnetic beads is no longer reflective.

[0150] 12) Remove the centrifuge tube from the magnetic rack, add 22 μL of TE Buffer to elute the DNA, and gently pipette at least 10 times until all magnetic beads are suspended.

[0151] 13) Incubate at room temperature for 10 minutes.

[0152] 14) Centrifuge the centrifuge tube briefly, place it on a magnetic rack, and let it stand for 2 minutes until the liquid is clear. Use a pipette to transfer 20 μL of the supernatant to a new 200 μL PCR tube to obtain DNA molecules with 3-end adapters.

[0153] 4. Extension connection 5-end connector

[0154] The specific sequence of the 5-terminal adapter is: GAACGACATGGCTACGATCCGACTT (second sequence) GTCTTCCTAAGACCGC (first sequence). The C bases in the 5-terminal adapter are all dmC.

[0155] 1) Add 5 μL of 5-end adapter (20 μM) to the DNA molecule PCR tube containing the 3-end adapter obtained in step 3 above, mix briefly, centrifuge, and place on ice.

[0156] 2) Place the PCR tube on the PCR machine, incubate at 58°C for 5 minutes to anneal, and then immediately place it on ice.

[0157] Add 25 μL of 2X KAPA HiFi HotStartReadyMix (for extension, Roche, KK2602) to the PCR tube, mix briefly, centrifuge, and place on ice.

[0158] 1) Place the above PCR tubes on the PCR instrument and incubate at 72°C for 5 min for extension reaction. After a short centrifugation, place them on ice.

[0159] 2) Prepare the adapter ligation reaction solution on ice according to the formula in Table 8 below, based on the required number of reactions (the reagents are from the MGIEAsy whole genome methylation library preparation kit, 1000005251).

[0160] Table 8 shows the connection solution for the connector.

[0161] Components Single reaction volume Ligation Buffer 23.4μL DNA Ligase 1.6μL Total volume 25μL

[0162] 3) Slowly pipette 25 μL of the prepared adapter connection reaction solution shown in Table 8 and add it to the PCR tube obtained in 4). Vortex 6 times for 3 seconds each time, and then centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0163] 4) Place the PCR tube on the PCR instrument and incubate at 23°C for 30 minutes.

[0164] 5) After the reaction is complete, centrifuge briefly to collect the reaction solution to the bottom of the tube and transfer it all to a new 1.5mL centrifuge tube.

[0165] 6) Remove the DNA Clean Beads in advance and allow them to equilibrate at room temperature for at least 30 minutes. Shake well before use. Transfer 35.25 μL of DNA Clean Beads to a new 1.5 mL centrifuge tube from the previous step. Gently pipette at least 10 times until all magnetic beads are suspended. On the last transfer, ensure that all liquid and magnetic beads in the pipette tip are transferred into the centrifuge tube.

[0166] 7) Incubate at room temperature for 10 minutes.

[0167] 8) Centrifuge the centrifuge tube briefly, place it on a magnetic rack, let it stand for 2 minutes until the liquid is clear, carefully aspirate the supernatant with a pipette and discard it.

[0168] 9) Keep the centrifuge tubes on the magnetic rack, add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads and tube walls, let stand for 30 seconds, then carefully aspirate and discard the supernatant.

[0169] 10) Repeat the previous step to remove as much liquid as possible from the tube. If a small amount of liquid remains on the tube wall, the centrifuge tube can be centrifuged briefly. After separation on a magnetic rack, use a small-capacity pipette to remove the liquid from the bottom of the tube.

[0170] 11) Keep the centrifuge tubes on the magnetic rack, open the centrifuge tube caps, and allow them to dry at room temperature until the surface of the magnetic beads is no longer reflective.

[0171] 12) Remove the centrifuge tube from the magnetic rack, add 22 μL of TE Buffer to elute the DNA, and gently pipette at least 10 times until all magnetic beads are suspended.

[0172] 13) Incubate at room temperature for 10 minutes.

[0173] 14) Centrifuge the centrifuge tube briefly, place it on a magnetic rack, and let it stand for 2 minutes until the liquid is clear. Use a pipette to transfer 19 μL of the supernatant to a new 0.2 mL PCR tube to obtain DNA molecules with 5-end and 3-end adapters.

[0174] II. Bisulfite treatment converts all unmethylated C bases in DNA molecules into U bases.

[0175] The DNA molecules with 5- and 3-terminal adapters obtained in step 4 above were treated and purified with bisulfite using the EZ DNA Methylation-Gold Kit (Zymo Research, Cat. No. D5005 / D5006), as detailed below:

[0176] 1) Solution preparation

[0177] Take 900 μL of NF water (Water, nuclease-free, Thermo Scientific, R0582), 300 μL of M-Dilution Buffer, and 50 μL of M-Dissolving Buffer into a tube of CT Conversion Reagent powder (centrifuge briefly before opening), and vortex frequently for 10 minutes at room temperature to complete the preparation of CT Conversion Reagent.

[0178] CT Conversion Reagent should be used with minimal exposure and ideally prepared immediately. CT Conversion Reagent can be stored for up to 1 day at room temperature, up to 1 week at 4°C, and up to 1 month at -20°C. Non-prepared CT Conversion Reagent should be preheated to 37°C and vortexed frequently at room temperature for 10 minutes before use.

[0179] Before using M-Wash Buffer for the first time, add the correct volume of anhydrous ethanol as indicated on the bottle label and mix well before use.

[0180] 2) At room temperature, add the components shown in Table 9 below to a new 0.2 mL PCR tube, where the Lambda DNA does not need to be fragmented and the concentration is 200 ng / μL.

[0181] Table 9 shows the reaction system for bisulfite treatment.

[0182]

[0183] Place the 0.2 mL PCR tubes above on a PCR instrument and react according to the Bisulfite treatment conditions shown in Table 10 to obtain the reaction product.

[0184] Table 10 shows the bisulfite treatment conditions.

[0185] temperature time Hot cap On 98℃ 10min 64℃ 2.5h 4℃ Hold

[0186] 3) Transfer the reaction product to a new 1.5 mL centrifuge tube, add 600 μL of M-Binding Buffer, vortex 6 times for 3 seconds each time, and then centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0187] 4) Place the Zymo-Spin IC Column into a 2mL Collection Tube, transfer the mixture to the Zymo-Spin IC Column, centrifuge at 13000rpm for 30s, discard the waste liquid, and put the Zymo-Spin IC Column back into the Collection Tube.

[0188] Add 100 μL of M-Wash Buffer to the Zymo-Spin IC Column and centrifuge at 13000 rpm for 30 seconds.

[0189] Add 200 μL of M-Desulphonation Buffer to the Zymo-Spin IC Column, quickly tighten the cap, incubate at room temperature for 15-20 min, centrifuge at 13000 rpm for 30 s, discard the waste liquid, and put the Zymo-Spin IC Column back into the Collection Tube.

[0190] Add 200 μL of M-Wash Buffer to the Zymo-Spin IC Column, centrifuge at 13000 rpm for 30 seconds, discard the waste liquid, and put the Zymo-Spin IC Column back into the Collection Tube.

[0191] Add 200 μL of M-Wash Buffer to the Zymo-Spin IC Column, centrifuge at 13000 rpm for 30 seconds, discard the waste liquid, and place the Zymo-Spin IC Column back into the Collection Tube. Centrifuge at 13000 rpm for 30 seconds, discard the Collection Tube, and use a pipette to aspirate as much liquid as possible from the outer wall of the Zymo-Spin IC Column, then transfer it to a new 1.5 mL centrifuge tube.

[0192] Open the cap of the Zymo-Spin IC Column tube and allow it to dry at room temperature for 2 minutes. Then place the Zymo-Spin IC Column into another new 1.5 mL centrifuge tube.

[0193] Slowly add 10 μL of M-Elution Buffer to the center of the Zymo-Spin IC Column filter membrane, let stand for 1 min, centrifuge at 13000 rpm for 30 s, and the purified product after Bisulfite treatment is collected in a 1.5 mL centrifuge tube.

[0194] Take all the purified product after Bisulfite treatment into a new 0.2 mL PCR tube, add molecular-grade water to make up the total volume to 20 μL, and obtain DNA molecules after bisulfite conversion reaction. In this DNA molecule, all unmethylated C bases are converted into U bases.

[0195] III. PCR Amplification

[0196] 1) Prepare the PCR reaction solutions shown in Table 11 on ice (WGBS PCR Enzyme Mix from MGIEAsy Whole Genome Methylation Library Preparation Kit, 1000005251; PCR Primer Mix from MGIEAsy Enzyme Digestion DNA Library Preparation Kit, 1000005254). The primers used bind to the fourth universal sequence of the 3-end adapter and the first universal sequence of the 5-end adapter.

[0197] Table 11 shows the PCR reaction solutions.

[0198] Components Single reaction volume WGBS PCR Enzyme Mix 25μL PCR Primer Mix 5μL Total 30μL

[0199] 2) Use a pipette to add 30 μL of the prepared PCR reaction solution to the 0.2 mL PCR tube containing DNA molecules after the bisulfite conversion reaction in step 2 above. Vortex 3 times for 3 seconds each time, and then centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0200] 3) Use a pipette to add 30 μL of the prepared PCR reaction solution shown in Table 11 into the PCR tube, vortex 3 times for 3 seconds each time, and then centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0201] 4) Place the PCR tube on the PCR instrument and perform the PCR reaction according to the conditions in Table 12 below.

[0202] Table 12 shows the PCR reactions.

[0203]

[0204]

[0205] 5) After the reaction is complete, briefly centrifuge to collect the reaction solution to the bottom of the tube, add 50 μL TE Buffer to the total system of 100 μL, and transfer the entire solution to a new 1.5 mL centrifuge tube.

[0206] 6) Pipette 60 μL of DNA Clean Beads into a 1.5 mL centrifuge tube and gently pipette at least 10 times until all magnetic beads are suspended. On the last pipette, make sure that all liquid and magnetic beads in the pipette tip are transferred into the centrifuge tube.

[0207] Incubate at room temperature for 5 minutes, then briefly centrifuge. Place the centrifuge tube on a magnetic rack and let it stand for 2–5 minutes until the liquid is clear. Carefully aspirate and discard the supernatant using a pipette.

[0208] 7) Keep the centrifuge tubes on the magnetic rack, add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads and tube walls, let stand for 30 seconds, then carefully aspirate and discard the supernatant.

[0209] Repeat the previous step to remove as much liquid as possible from the tube. If a small amount remains on the tube wall, centrifuge the tube briefly. After separating the tubes on a magnetic rack, use a small-capacity pipette to remove the liquid from the bottom of the tube.

[0210] Keep the centrifuge tubes on the magnetic rack, open the centrifuge tube caps, and allow them to dry at room temperature until the surface of the magnetic beads is no longer reflective.

[0211] Remove the centrifuge tube from the magnetic rack, add 32 μL of TE Buffer to elute the DNA, and gently pipette at least 10 times until completely mixed.

[0212] Incubate at room temperature for 5 minutes.

[0213] Centrifuge the centrifuge tube briefly, place it on a magnetic rack, and let it stand for 5 minutes until the liquid is clear. Use a pipette to transfer 30 μL of the supernatant to a new 1.5 mL centrifuge tube to obtain the amplification product.

[0214] IV. Construction of sequencing libraries and sequencing

[0215] 1. Construction of sequencing libraries

[0216] 1) Annealing forms single chains

[0217] use The dsDNA HS Assay Kit was used to quantify the amplification products obtained in step 7) above.

[0218] Take another 360 ng of the amplification product obtained in step 7) above and transfer it to a new 0.2 mL PCR tube. Add TE Buffer to bring the total volume to 48 μL.

[0219] Place the PCR tube on the PCR instrument and react according to the conditions in Table 13 below to obtain the reaction product.

[0220] Table 13 shows the conditions for single-chain reactions.

[0221] temperature time 105℃ hot cap On 95℃ 3min

[0222] 2) Single-chain cyclization

[0223] After the reaction in step 1) above is complete, immediately place the PCR tube on ice and let it stand for 2 minutes. Then, add the single-strand cyclization reaction solution to carry out the reaction, as follows:

[0224] Based on the reaction number, prepare the single-chain cyclization reaction solution (MGIEasy cyclization module, MGI, 1000005260) on ice according to the formula in Table 14 below.

[0225] Table 14 lists the single-chain cyclization reaction solutions.

[0226] Components Single reaction volume Splint Buffer 11.6μL DNA Rapid Ligase 0.5μL Total volume 12.1μL

[0227] Use a pipette to add 12.1 μL of the prepared single-chain cyclization reaction solution shown in Table 14 to the PCR tube containing the reaction product obtained in 1) above. Vortex 3 times for 3 seconds each time, and then centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0228] Place the PCR tubes on the PCR instrument and perform the reaction according to the conditions in Table 15 below.

[0229] Table 15 shows the conditions for the single-chain cyclization reaction.

[0230] temperature time 75℃ Hot Cover On 37℃ 30min 4℃ Hold

[0231] After the reaction is complete, the PCR tube is briefly centrifuged and placed on ice before proceeding to the next step of the reaction.

[0232] 3) Enzymatic digestion

[0233] Prepare the enzyme digestion reaction solution (MGIEasy cyclization module, 1000005260) on ice in advance according to the formula in Table 16 below.

[0234] Table 16 shows the enzyme digestion reaction solution.

[0235] Components Single reaction volume Digestion Buffer 1.4μL Digestion Enzyme 2.6μL Total volume 4μL

[0236] Use a pipette to add 4 μL of the enzyme digestion reaction solution prepared in Table 16 to the PCR tube after the above reaction 2). Vortex 3 times for 3 seconds each time, and then centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0237] Place the PCR tubes on the PCR instrument and perform the reaction according to the conditions in Table 17 below.

[0238] Table 17 lists the conditions for enzyme digestion reactions.

[0239] temperature time 75℃ Hot Cover On 37℃ 30min 4℃ Hold

[0240] After the reaction is complete, the reaction solution is collected to the bottom of the tube by instantaneous centrifugation.

[0241] Immediately add 7.5 μL of Digestion Stop Buffer to the PCR tube, vortex 3 times for 3 seconds each time, and then briefly centrifuge to collect the reaction solution to the bottom of the tube. Transfer all the reaction solution to a new 1.5 mL centrifuge tube to obtain the enzyme digestion product.

[0242] 4) Purification

[0243] Remove the DNA Clean Beads (from the MGI Easy circularization module, MGI, 1000005260) beforehand and allow them to equilibrate at room temperature for at least 30 minutes. Shake well before use. Add 170 μL of DNA Clean Beads to the enzyme digestion product obtained in step 3) above, and gently pipette at least 10 times until all magnetic beads are suspended. On the last pipette, ensure that all liquid and magnetic beads in the pipette tip are transferred into the centrifuge tube.

[0244] Incubate at room temperature for 10 minutes.

[0245] Centrifuge the centrifuge tube briefly, place it on a magnetic rack, and let it stand for 5 minutes until the liquid is clear. Carefully aspirate the supernatant with a pipette and discard it.

[0246] Keep the centrifuge tubes on the magnetic rack, add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads and tube walls, let stand for 30 seconds, then carefully aspirate and discard the supernatant.

[0247] Repeat the previous step to remove as much liquid as possible from the tube. If a small amount remains on the tube wall, centrifuge the tube briefly. After separating the tubes on a magnetic rack, use a small-capacity pipette to remove the liquid from the bottom of the tube.

[0248] Keep the centrifuge tubes on the magnetic rack, open the centrifuge tube caps, and allow them to dry at room temperature until the surface of the magnetic beads is no longer reflective.

[0249] Remove the centrifuge tube from the magnetic rack, add 22 μL of TE Buffer to elute the DNA, and gently pipette at least 10 times until all magnetic beads are suspended.

[0250] Incubate at room temperature for 10 minutes.

[0251] Centrifuge the centrifuge tube briefly, place it on a magnetic rack, and let it stand for 5 minutes until the liquid is clear. Use a pipette to transfer 20 μL of the supernatant to a new 1.5 mL centrifuge tube to obtain the sequencing library.

[0252] 2. Sequencing

[0253] use The ssDNA Assay Kit was used to quantify the sequencing library obtained in step 1 according to the instructions of the kit.

[0254] Sequencing primer sequences used:

[0255] Sequencing primer 1GCTCACAGAACGACATGGCTACGATCCGACTT reads 1

[0256] Sequencing primer 2TTGTCTTCCTAAGACCGCTTGGCCTCCGACTT reads 2

[0257] Sequencing was performed using the MGISEQ-2000 sequencer. DNB preparation and sequencing were carried out using the MGISEQ-2000 high-throughput sequencing reagent kit (PE100) (MGI, catalog number 1000012536) following the instructions.

[0258] V. Data Analysis

[0259] The sequencing data was quality controlled using the commonly used methylation analysis software Bismark to remove low-quality reads. The data was then aligned with the genome sequence. After alignment, the detected molecular tags were identified and statistically analyzed. Reads were grouped based on these tags; reads with the same tag were considered to originate from the same molecule. Reads from the paired ends of the same DNA molecule were grouped together. Methylation analysis was then performed to calculate methylation levels, determine the methylation levels of the positive and negative strands of the same DNA molecule, and identify whether the positive and negative strands of the same DNA molecule were simultaneously methylated at corresponding sites.

[0260] Calculate methylation level:

[0261] When the sequencing results are compared with the reference genome (GRCh37(GCA_000001405.1), 2009 / 02 / 27), the ratio of the depth of the C base at a position that was originally a C base to the depth of the position that is now a T base is the methylation level of that site; the methylation level of a region is the average of the methylation levels of all sites in that region.

[0262] The results are as follows:

[0263] 1) Database construction results

[0264] Table 18 shows the database construction results.

[0265]

[0266] 2) Data Analysis Results

[0267] (1) After the sequencing data was processed, the data were analyzed and basic statistics were performed as shown in Table 19 below:

[0268] Table 19 shows the basic sequencing data.

[0269] Sample name T1 T2 Sequence length (bp) 100 100 Filtered sequence 909,165,304 866,820,596 Comparison rate (%) 92.54 94.14 Uniqueness rate (%) 87.18 89.22 Repeat rate (%) 19.26 26.34 Paired-end alignment rate (%) 83.56 86.81 Sulfite conversion efficiency (%) 99.62 99.55

[0270] (2) Analyze the average methylation level of C on different elements in the T1 sample.

[0271] The results are as follows Figure 3As shown in the figure, Figure a shows the average methylation level of C bases in different elements of the genome. The different colored bars in the same element represent the methylation level of C on different strands. It can be seen that in this sample, except for the tandem repeats region, there is no very obvious difference in the methylation level of the positive and negative strands of DNA at different element locations. Figure b is a schematic diagram of the reads with different methylation of the positive and negative strands. There is no very obvious difference in the level of the positive and negative strands. SEQUENCE LISTING <110> Shenzhen BGI Genomics Co., Ltd. <120> A library construction and sequencing method for determining differences in methylation between the positive and negative strands of DNA molecules. <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 13 <212> DNA <213> Artificial sequence <400> 1 agtcggaggc caa 13 <210> 2 <211> 16 <212> DNA <213> Artificial sequence <400> 2 gcggtcttag gaagac 16 <210> 3 <211> 19 <212> DNA <213> Artificial sequence <400> 3 aacaactcct tggctcaca 19 <210> 4 <211> 25 <212> DNA <213> Artificial sequence <400> 4 gaacgacatg gctacgatcc gactt 25

Claims

1. A library preparation and sequencing method for determining differences in methylation between the positive and negative strands of a DNA molecule, comprising the following steps: A1) The positive and negative strands of multiple DNA double-stranded molecules are labeled using molecular tags UMI to obtain a DNA molecule library labeled with molecular tags; in the DNA molecule library, the positive and negative strands of the same DNA double-stranded molecule are labeled with the same molecular tag UMI. The method for labeling the positive and negative strands of multiple DNA double-stranded molecules using the molecular tag UMI is as follows: a1) Connect the three-end adapter group with multiple molecular tags to multiple DNA double-stranded molecules to obtain DNA molecules with three-end adapters; The three-terminal connector assembly with multiple molecular tags consists of multiple three-terminal connectors with different molecular tags; Each of the three-terminal connectors consists of a top chain and a bottom chain, and the C base in the three-terminal connector is a methylated C. The Top chain from the 5' end to the 3' end comprises the following four parts: b1) The first fixed sequence; b2) The second sequence is a UMI molecular tag, which serves to mark the same DNA molecule; b3) The third fixed sequence , Its function is as a 5-end connector joint; b4) The fourth fixed sequence, which is used to bind sequencing primers; The Tm value of the first fixed sequence in the Top chain needs to be lower than the Tm value of the third fixed sequence, and the 5' end needs to be chemically modified; The bottom chain is a sequence that is inversely complementary to the first fixed sequence in the top chain, and the 3' end of the bottom chain is chemically modified. a2) Extend the 5-end adapter to the DNA molecule that is connected to the 3-end adapter to obtain DNA molecules that are connected to the 5-end and 3-end adapters, that is, DNA molecules with the same molecular tag on the positive and negative strands. These DNA molecules constitute a DNA molecule library. The 5-end connector consists of the following two sequences: The first sequence is a sequence that is completely inversely complementary to the fixed sequence of the third segment of the Top chain of the 3-end connector. The second sequence segment is a fragment that is not complementary to the TOP chain at the three ends; The C base in the 5-terminal connector is a methylated C, and the dCTP in the extended connection is a methylated dCTP; A2) Bisulfite conversion of DNA molecules in the DNA molecule library to convert unmethylated C bases in the DNA molecules into U bases, thereby obtaining converted DNA molecules; A3) The transformed DNA molecules were sequentially subjected to PCR amplification, sequencing library construction, and sequencing; based on the positive and negative strand data of DNA molecules with the same molecular tag in the sequencing results, the differences in methylation modification of the positive and negative strands of the same DNA molecule were determined; The method is used for non-disease diagnostic purposes.

2. The method according to claim 1, characterized in that: In b1), the first fixed sequence consists of nucleotides ranging from 8bp to 16bp in size; In b2), the second sequence consists of a random sequence of 6-25 Ns, where N is any one of A, T, C, and G, and C is a methylated C. In b3), the third fixed sequence consists of nucleotides ranging from 6bp to 24bp in size; In b4), the fourth fixed sequence consists of nucleotides with a size of 15bp-20bp; The Tm value of the first fixed sequence in the Top chain needs to be at least 10°C lower than the Tm value of the third fixed sequence; The second sequence in a2) is a 25-30bp fragment.

3. The method according to claim 1 or 2, characterized in that: In step A1), the size of the DNA double-stranded molecule is 100bp to 2000bp; Alternatively, in step A1), if the DNA double-stranded molecule is greater than 2000 bp, then the following step is included before step A1): fragmenting the DNA molecule to 100 bp to 2000 bp.

4. A method for constructing a library to determine the difference in methylation of the positive and negative strands of a DNA molecule, comprising PCR amplification in steps A1)-A2) and A3) of any one of claims 1-3 and constructing a sequencing library to obtain a sequencing library that determines the difference in methylation of the positive and negative strands of a DNA molecule.

5. A kit for library construction and sequencing to determine differences in methylation between the positive and negative strands of a DNA molecule, comprising the 3-terminal adapter, the 5-terminal adapter, and the reagents required for bisulfite conversion as described in claims 1-3.

6. The use of the method of claims 1-3 or the sequencing library prepared by the method of claim 4 or the kit of claim 5 in determining the difference in methylation of the positive and negative strands of DNA molecules; said use is for non-disease diagnostic purposes.

7. The use of the method of claims 1-3 or the sequencing library prepared by the method of claim 4 or the kit of claim 5 in determining the difference in methylation of the positive and negative strands of DNA molecules from the same source; said use is for non-disease diagnostic purposes.

Citation Information

Patent Citations

  • Detecting probe, method and kit for multi-target-point gene mutation, methylation modification and / or hydroxymethylation modification

    CN109517819A

  • Method for screening prognostic markers of DNA methylation in acute myeloid leukemia

    CN109852672A