HPV antigen epitopes and their applications

By mutating the first amino acid of the HPV antigen epitope, its binding activity and immunogenicity with HLA-A*02:01 are enhanced, solving the problem of insufficient HPV virus sequence targets and achieving a stronger immunotherapy effect.

CN116217675BActive Publication Date: 2025-09-19SHENZHEN GINO BIOTECHNOLOGY CO LTD +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211609622.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-14
Publication Date
2025-09-19
Estimated Expiration
2042-12-14

AI Technical Summary

Technical Problem

There are few effective targets on existing HPV virus sequences, and their immunogenicity is not strong enough, resulting in poor immunotherapy effects for HPV-related diseases.

Method used

By mutating the first amino acid of the HPV antigen epitope to change its binding activity with HLA-A*02:01, bioinformatics analysis and gene editing technologies such as CRISPR/Cas9 are used to mutate the amino acid or nucleic acid sequence to enhance its immunogenicity.

Benefits of technology

The obtained mutated HPV antigen epitopes can more strongly stimulate specific T cell responses, effectively target and kill HPV-infected cells, and have significant potential for treating and preventing HPV-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GDA0005495690240000161
    Figure GDA0005495690240000161
  • Figure GDA0005495690240000171
    Figure GDA0005495690240000171
  • Figure GDA0005495690240000181
    Figure GDA0005495690240000181
Patent Text Reader

Abstract

The present invention provides an HPV antigen epitope and its application, wherein the use of the first amino acid of the HPV antigen epitope in mediating the binding of the HPV antigen epitope to HLA-A*02:01 is disclosed, wherein the HPV antigen epitope has the amino acid sequence shown in SEQ ID NO:1. The inventors found that a mutation in the first amino acid of the amino acid sequence shown in SEQ ID NO:1 affects the binding activity and immunogenicity of the HPV antigen epitope to HLA-A*02:01. The HPV antigen epitope obtained by mutation of SEQ ID NO:1 has a stronger affinity and immunogenicity than SEQ ID NO:1, and the HPV antigen epitope-loaded T2 cells or tumor cells produce a stronger killing effect. Therefore, drugs and vaccines prepared from the HPV antigen epitope obtained after mutation can effectively treat various cancers, and are safer and have fewer side effects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, specifically, the present invention relates to HPV antigen epitopes and applications thereof, and more specifically, the present invention relates to the use of the first amino acid of an HPV antigen epitope, a method for changing the binding activity of an HPV antigen epitope with HLA-A*02:01, the use of a reagent in preparing a kit, the use of a device in preparing a system, an isolated polypeptide, a nucleic acid molecule, an expression vector, an antigen-presenting cell, an immune effector cell, the use of a reagent in preparing a kit, a kit, the use of the isolated peptide or expression vector or antigen-presenting cell or immune cell in preparing a drug, a drug, a vaccine and a diagnostic system. Background Art

[0002] Human papillomavirus (HPV), a spherical DNA virus belonging to the genus Papillomatovirus A in the family Papovaviridae, can cause proliferation of the squamous epithelium of the human skin and mucous membranes. Different types of HPV can cause different types of infection, including obvious genital warts and less obvious warts of the cervix, vagina, vulva, urethra, penis, and anus, as well as common skin warts. Persistent infection with certain types of HPV increases the risk of cervical, vaginal, vulvar, penile, anal, and laryngeal cancers. HPV 16 and HPV 18 are responsible for 70% of cervical cancers and cervical precancerous lesions. Cervical cancer is the fourth most common cancer among women worldwide, and infection is the cause of nearly all invasive cervical cancers, some anogenital malignancies, and oral cancers. Taking cervical cancer as an example, persistent infection with HPV is the primary risk factor for cervical cancer, which has now become the fourth most common female cancer in the world.

[0003] Cancer immunotherapy involves screening cancer-specific antigens and then injecting (peptide vaccines) or synthesizing antigens (nucleic acid vaccines) into the body to enable the body to produce specific immune cells to attack cancer cells, or producing immune cells that can target and recognize specific antigens in vitro and then injecting them into the body (cell preparations) to attack cancer cells.

[0004] Due to the high correlation between HPV infection and cervical cancer, peptides on HPV viral sequences have the potential to become specific antigenic targets. The key to measuring whether a peptide is an effective target is whether the peptide can be naturally presented on the surface of target cells and stimulate T cell activation, proliferation and killing of target cells. Previous studies have shown that there are few effective targets on HPV viral sequences, and the immunogenicity of these targets in experiments is not strong enough, and there are still challenges in clinical application. Therefore, amino acid point replacement of wild-type HPV viral peptides to make them have stronger immunological functions and thus more suitable for immunotherapy has become an effective solution. At present, further exploration of the effects of different mutation methods on different HPV antigen epitopes is still needed. Summary of the Invention

[0005] The present invention is completed based on the following discoveries of the inventors: HPV therapeutic vaccine is a research hotspot in the field of immunotherapy, among which obtaining effective HPV viral epitopes is extremely critical. The inventors obtained the mutated HPV antigen epitope by determining the anchor position of the HPV antigen epitope and analyzing the preferred amino acids of the anchor position. Among them, it was found that the first amino acid of SEQ ID NO: 1 plays a role in the binding process of the HPV antigen epitope with HLA-A*02: 01. Therefore, the mutated HPV antigen epitope was designed, and the mutated HPV antigen epitope was detected using a bioinformatics analysis process and a large number of experiments. The experimental results show that the mutated HPV antigen epitope has stronger immunogenicity, and the specific T cells induced by the epitope stimulation can more strongly target and kill target cells or tumor cells loaded with wild-type epitopes, and have protective value.

[0006] Therefore, in the first aspect of the present invention, the present invention proposes the use of the first amino acid of the HPV antigen epitope in mediating the binding of the HPV antigen epitope to HLA-A*02:01. According to an embodiment of the present invention, the HPV antigen epitope has an amino acid sequence shown in SEDID NO:1. After the inventors performed a preferential amino acid analysis and subsequent experimental determination on the HPV antigen epitope shown in SEQ ID NO:1 in a specific manner, they found that the first position of its amino acid sequence affects the binding of the HPV antigen epitope to HLA-A*02:01 and affects its immunogenicity. This site has a high application value in the preparation of drugs and vaccines for HPV-related diseases.

[0007] In the second aspect of the present invention, the present invention proposes a method for changing the binding activity of an HPV antigen epitope to HLA-A*02:01. According to an embodiment of the present invention, the method includes contacting an isolated HPV antigen epitope peptide or a nucleic acid encoding an HPV antigen epitope peptide with a reagent, and the reagent is used to mutate the first amino acid of the HPV antigen epitope. As mentioned above, after the inventors conducted a preferential amino acid analysis and subsequent experimental determination on the HPV antigen epitope shown in SEQ ID NO:1, they found that the first position of its amino acid sequence would affect the binding of the HPV antigen epitope to HLA-A*02:01 and affect its immunogenicity. This site has high value in the preparation of drugs and vaccines for HPV-related diseases. Therefore, a reagent is used to mutate the first amino acid of the HPV antigen epitope or the nucleic acid sequence encoding the first amino acid to obtain the target amino acid or nucleic acid. Among them, the reagent is not particularly limited, and any reagent that can mutate amino acids or nucleic acids can be used, such as a reagent based on at least one of the gene editing methods selected from single-base gene editing, zinc finger nuclease, transcription activator-like effector nuclease, CRISPR / Cas9 and CRISPR / Cas9 combined with iPSC and AAV vector technology.

[0008] In the third aspect of the present invention, the present invention proposes the use of a reagent in the preparation of a kit. According to an embodiment of the present invention, the kit is used to change the binding activity of the HPV antigen epitope to HLA-A*02:01, and the reagent is used to mutate the first amino acid of the HPV antigen epitope. As mentioned above, after the inventors conducted a preference amino acid analysis and subsequent experimental determination on the HPV antigen epitope shown in SEQ ID NO:1, they found that the first position of its amino acid sequence would affect the binding of the HPV antigen epitope to HLA-A*02:01 and affect its immunogenicity. This site has high value in the preparation of drugs and vaccines for HPV-related diseases. Therefore, a reagent is used to mutate the first amino acid of the HPV antigen epitope or the nucleic acid sequence encoding the first amino acid to obtain the target amino acid. The kit according to the embodiment of the present invention can effectively mutate amino acids or nucleic acids to obtain target amino acids or nucleic acids. Among them, the reagent is not particularly limited, and any reagent that can mutate amino acids or nucleic acids can be used, such as a reagent based on at least one of the gene editing methods selected from single-base gene editing, zinc finger nuclease, transcription activator-like effector nuclease, CRISPR / Cas9 and CRISPR / Cas9 combined with iPSC and AAV vector technology.

[0009] In a fourth aspect, the present invention provides a device for use in a manufacturing system. According to an embodiment of the present invention, the system is used to alter the binding activity of an HPV epitope to HLA-A*02:01, and the device is used to mutate the first amino acid of the HPV epitope. The system according to an embodiment of the present invention can effectively alter the binding activity of an HPV epitope by mutating the amino acid.

[0010] In the fifth aspect of the present invention, the present invention provides an isolated polypeptide. According to an embodiment of the present invention, compared with the amino acid sequence shown in SEQ ID NO: 1, the isolated polypeptide has a mutation at the first amino acid site. According to a specific embodiment of the present invention, the second and 10 amino acids of the obtained HPV antigen epitope are HLA anchor sites. Based on the study of the characteristics of the HLA-A*02:01 typing sequence, the inventors determined a new replacement anchor point, namely the first position in the HPV antigen epitope shown in SEQ ID NO: 1. After the inventors replaced the first amino acid of the amino acid sequence shown in SEQ ID NO: 1, the obtained polypeptide can still have the same or related immunogenicity and its potential therapeutic effect, that is, it can be presented by HLA-A*02:01 molecules and recognized by CTL cells or TIL cells, and then can be presented to CTL or TIL cells by presenting cells expressing HLA-A*02:01 molecules to activate specific T cell immunity, constituting a physiological target of the immune response of HPV-positive tumors, and performing high-sensitivity and specificity detection, which is of great value for the prevention and treatment of HPV-related diseases.

[0011] In its sixth aspect, the present invention provides a nucleic acid molecule. According to embodiments of the present invention, the nucleic acid molecule encodes the isolated polypeptide described above. The isolated polypeptide encoded by the nucleic acid molecule according to embodiments of the present invention can be presented by HLA-A*02:01 molecules and recognized by CTL or TIL cells. Specifically, it is presented to CTL or TIL cells by presenting cells expressing HLA-A*02:01 molecules, thereby activating specific T cell immunity. This constitutes a physiological target for the immune response to HPV-positive tumors, enabling highly sensitive and specific detection, and is of great value in the prevention and treatment of HPV-related diseases.

[0012] In the seventh aspect of the present invention, the present invention proposes an expression vector. According to an embodiment of the present invention, it carries a nucleic acid expressing the isolated polypeptide described above or a nucleic acid molecule described above. The expression vector may include an optional control sequence, and the control sequence is operably linked to the nucleic acid or nucleic acid molecule. Among them, the control sequence is one or more control sequences that can direct the expression of the polypeptide in the host. The expression vector proposed in the embodiment of the present invention can efficiently express the isolated polypeptide in a suitable host cell, and can be effectively used for the specific treatment or prevention of tumors, especially tumors that simultaneously express the HLA-A*02:01 molecule and the above-mentioned wild-type HPV antigen epitope or isolated polypeptide.

[0013] In its eighth aspect, the present invention provides a recombinant cell. According to embodiments of the present invention, the recombinant cell carries the aforementioned nucleic acid molecule, expression vector, or isolated polypeptide. The recombinant cell is obtained by transfecting or transforming the expression vector. According to embodiments of the present invention, the host cell can efficiently and massively express the isolated polypeptide under appropriate conditions, allowing for the production of large quantities of the isolated polypeptide. The recombinant cell can be effectively used for the specific treatment or prevention of tumors, particularly tumors that co-express the HLA-A*02:01 molecule and the aforementioned wild-type HPV antigen epitope or isolated polypeptide.

[0014] In the ninth aspect of the present invention, the present invention proposes an isolated antigen-presenting cell. According to an embodiment of the present invention, the cell can present the isolated polypeptide described above. According to an embodiment of the present invention, the antigen-presenting cell presenting the isolated polypeptide described above can effectively induce the patient's immune response against the tumor-specific antigen - the isolated polypeptide described above, thereby activating the CTL specific killing function. The antigen-presenting cell proposed in the embodiment of the present invention has the function of presenting the above-mentioned wild-type HPV antigen epitope or the isolated polypeptide, thereby treating the tumor expressing the above-mentioned isolated polypeptide, and its treatment effect is significant and safe.

[0015] In its tenth aspect, the present invention provides an isolated immune effector cell. According to embodiments of the present invention, the immune effector cell can recognize the isolated polypeptide described above or recognize antigen-presenting cells that present the isolated polypeptide described above on their cell surfaces. According to embodiments of the present invention, the immune effector cell can specifically kill tumor cells that co-express the HLA-A*02:01 molecule and the wild-type HPV antigen epitope or isolated polypeptide described above.

[0016] In the eleventh aspect of the present invention, the present invention proposes the use of a reagent for detecting the aforementioned isolated polypeptide in the preparation of a kit. According to an embodiment of the present invention, the kit is used to diagnose HPV or detect the therapeutic effect of HPV. The reagent can accurately detect the isolated polypeptide, such as detecting whether the biological sample contains the isolated polypeptide, and quantitatively detecting the isolated polypeptide in the biological sample. Since the isolated polypeptide is highly expressed in HPV-infected tissues, the kit containing the reagent can accurately diagnose whether the individual from which the biological sample is derived is infected with HPV, and further, whether the individual is at high risk of HPV. Similarly, during the treatment of an HPV-infected individual, the kit can be used to monitor changes in the HPV content during the treatment process, such as worsening, slowing down or curing. The type of the reagent is not particularly limited, and any protein or nucleic acid that can detect the isolated polypeptide or the nucleic acid sequence encoding the isolated polypeptide can be used, such as corresponding antibodies, nucleic acid molecules, primers, etc.

[0017] In the twelfth aspect of the present invention, the present invention proposes a kit. According to an embodiment of the present invention, a reagent suitable for detecting the isolated polypeptide described above is included. The reagent can accurately detect the isolated polypeptide, such as detecting whether the biological sample contains the isolated polypeptide. Since the isolated polypeptide is highly expressed in HPV-infected tissues, the kit containing the reagent can accurately diagnose whether the individual from which the biological sample is derived is infected with HPV, and further, whether the individual is an HPV high-risk individual. Similarly, during the treatment of an HPV-infected individual, the kit can be used for detection to monitor changes in HPV content during the treatment process, such as aggravation, alleviation or cure. The type of the reagent is not particularly limited, and any protein or nucleic acid that can detect the isolated polypeptide or the nucleic acid sequence encoding the isolated polypeptide can be used, such as corresponding antibodies, primers, etc., and can also include auxiliary detection substances such as coating fluids.

[0018] In the thirteenth aspect of the present invention, the present invention proposes the use of the aforementioned isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell, antigen-presenting cell or immune effector cell in the preparation of a medicament. According to an embodiment of the present invention, the medicament is used to treat or prevent HPV-related diseases. As mentioned above, the isolated polypeptide, the nucleic acid molecule encoding the isolated polypeptide, the expression vector, the recombinant cell, the antigen-presenting cell or the immune effector cell can all be effectively used for the specific treatment or prevention of tumors, especially tumors that express both the HLA-A*02:01 molecule and the above-mentioned isolated polypeptide. Therefore, a medicament containing some or all of the above substances also has a significant effect of treating or preventing tumors that express the HLA-A*02:01 molecule and the above-mentioned isolated polypeptide, and is safer and has fewer side effects.

[0019] In a fourteenth aspect, the present invention provides a drug. According to an embodiment of the present invention, the drug comprises the aforementioned isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell, antigen-presenting cell, or immune effector cell. As described above, the isolated polypeptide, nucleic acid molecule encoding the isolated polypeptide, expression vector, recombinant cell, antigen-presenting cell, or immune effector cell can be effectively used to specifically treat or prevent tumors, particularly tumors that express both the HLA-A*02:01 molecule and the aforementioned isolated polypeptide. Therefore, a drug comprising some or all of the aforementioned substances also has a significant effect in treating or preventing tumors that express the HLA-A*02:01 molecule and the aforementioned isolated polypeptide, and has higher safety and fewer side effects.

[0020] In the fifteenth aspect of the present invention, a vaccine is proposed. According to an embodiment of the present invention, it comprises the isolated polypeptide, nucleic acid molecule, expression vector or antigen-presenting cell described above. As described above, the nucleic acid molecule, expression vector or recombinant cell of the embodiment of the present invention expresses the isolated polypeptide described above under appropriate conditions, and the antigen-presenting cell can express the isolated polypeptide. When the polypeptide binds to the HLA-A*02:01 molecule, it is presented by the antigen-presenting cell, so that it is recognized by CTL or TIL cells, that is, it is presented to CTL or TIL cells by the antigen-presenting cell expressing the HLA-A*02:01 molecule, thereby activating specific T cell immunity. Therefore, the vaccine proposed in the embodiment of the present invention has a significant effect in treating or preventing tumors expressing HLA-A*02:01 molecules and the isolated polypeptide, and is safer and has fewer side effects.

[0021] In its sixteenth aspect, the present invention provides a method for preventing or treating HPV-related diseases. According to embodiments of the present invention, the aforementioned isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell, antigen-presenting cell, immune effector cell, drug, or vaccine is administered to a subject. As previously described, the preventive or therapeutic methods provided in the embodiments of the present invention, including administering an effective amount of any of the aforementioned isolated polypeptides and related substances, can effectively treat or prevent tumors expressing HLA-A*02:01 molecules and the isolated polypeptides.

[0022] In its seventeenth aspect, the present invention provides the use of the aforementioned isolated polypeptides, nucleic acid molecules, expression vectors, and recombinant cells in preparing a kit. According to embodiments of the present invention, the kit is used to detect HLA-A*02:01. The isolated polypeptides according to embodiments of the present invention, as well as substances that can indirectly obtain the isolated polypeptides, can bind to HLA. Therefore, the aforementioned substances can be used to prepare a kit for effectively detecting HLA-A*02:01. The kit can accurately qualitatively or quantitatively detect HLA-A*02:01 in a biological sample. Furthermore, the kit can also detect HLA-A*02:01 levels in an individual to determine the individual's status, such as whether the individual's HLA-A*02:01 level is significantly below or above normal.

[0023] In its eighteenth aspect, the present invention provides a kit for detecting HLA-A*02:01. According to an embodiment of the present invention, the kit comprises the isolated polypeptide, nucleic acid molecule, expression vector, and recombinant cell described above. As previously described, the isolated polypeptide and substances that can indirectly obtain the isolated polypeptide can bind to HLA-A*02:01. Therefore, the kit containing these substances can accurately qualitatively or quantitatively detect HLA-A*02:01 in biological samples. Furthermore, the kit can also detect HLA-A*02:01 levels in an individual to determine their status, such as whether their HLA-A*02:01 level is significantly below or above normal.

[0024] In its nineteenth aspect, the present invention provides a method for diagnosing the presence of HPV in a subject. According to an embodiment of the present invention, the method includes the step of detecting whether a biological sample derived from the subject carries the isolated polypeptide or nucleic acid molecule described above. As previously described, the isolated polypeptide and nucleic acid molecule are present in individuals infected with HPV. Therefore, by detecting whether the biological sample derived from the subject carries the substances, the presence of HPV in the subject can be effectively diagnosed. Of course, the method can also be used to quantitatively detect the HPV content in the subject.

[0025] In its twentieth aspect, the present invention provides a diagnostic system. According to an embodiment of the present invention, the system comprises: a polypeptide detection device for detecting whether a biological sample derived from a subject carries the aforementioned isolated polypeptide; and a result determination device connected to the polypeptide detection device for determining whether the patient suffers from a tumor based on whether the biological sample carries the isolated polypeptide. As previously mentioned, the isolated polypeptide is present in the body of a subject infected with HPV. The diagnostic system according to an embodiment of the present invention is capable of detecting whether the biological sample carries the isolated polypeptide. Therefore, the diagnostic system can accurately determine whether the subject from which the biological sample was derived is a tumor patient.

[0026] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 shows a structural diagram of a diagnostic system according to an embodiment of the present invention;

[0028] Figure 2 Shown is a characteristic diagram of amino acid preference of HLA-A02:01 typing binding epitopes according to an embodiment of the present invention;

[0029] Figure 3 The figure shows the results of ELISPOTs test of in vitro immunogenicity of the isolated polypeptides and other polypeptides according to the examples of the present invention;

[0030] Figure 4 A diagram showing the detection results of CTL specifically killing target cells presenting wild-type HPV antigen epitopes according to an embodiment of the present invention; and

[0031] Figure 5 The graph shows the detection results of the isolated polypeptide and wild-type HPV antigen epitope of the examples of the present invention inhibiting mouse tumor growth. DETAILED DESCRIPTION

[0032] The embodiments of the present invention are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to be used to explain the present invention, but should not be understood as limiting the present invention.

[0033] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of the technical features being referred to. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. In the description of the present invention, "plurality" means at least two, such as two, three, etc., unless otherwise specifically defined.

[0034] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0035] To facilitate understanding of the present invention, certain technical and scientific terms are defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which this invention belongs. The abbreviations for amino acid residues are the standard three-letter and / or one-letter codes used in the art to designate one of the 20 commonly used L-amino acids.

[0036] As used herein, "epitope," also known as an antigenic determinant, refers to a specific structural site on an antigen molecule that is recognized by specific effector molecules or T or B lymphocytes during an immune response, thereby inducing cellular and humoral immunity and producing an immune effect. For example, the HPV epitope in this application is present in HPV and can bind to the HLA-A*02:01 molecule.

[0037] Herein, "anchor site" refers to the structure of the HLA-A*02:01 molecule that receives the HPV epitope when it binds to the HPV epitope. This refers to the antigen-binding groove located at the distal end of the molecule. Analysis of the primary structure of native HPV epitopes reveals that they all contain two or more specific sites that bind to the antigen-binding groove of the HLA-A*02:01 molecule, termed anchor sites. The amino acid residue at this location is called the anchor residue.

[0038] In this article, "antigen-presenting cells" refer to immune cells that can take up and process antigens and present them to T cells. APCs primarily include monocytes, dendritic cells, B cells, Langerhans cells, and virally infected target cells of tumor cells.

[0039] Herein, "immune effector cells" refer to immune cells that participate in the clearance of foreign antigens and perform effector functions in immune responses.

[0040] In this article, "single-base gene editing" refers to gene editing technology that can cause single base changes in the genome. The basic principle is to fuse cytosine deaminase (APOBEC) or adenosine deaminase with existing Cas9n (D10A). It relies on the CRISPR principle to modify a single base at positions 4 to 7 away from the PAM end of the target.

[0041] Herein, "zinc finger nuclease (ZFN)" consists of a DNA recognition domain and a nonspecific nuclease. The DNA recognition domain is composed of a series of Cys2-his2 zinc finger proteins in series, each of which recognizes and binds to a specific triplet base. For example, the most classic zinc finger nuclease is a fusion of a nonspecific nuclease FokI with a domain containing zinc fingers, the purpose of which is naturally to cut specific sequences; the cut DNA can be repaired by the excision mechanism to delete the single-stranded portion at the cut and then reconnected. This method can be used to complete the deletion of specific fragments on the chromosome, thereby achieving the purpose of constructing mutants or completing treatment.

[0042] Here, "transcription activator-like (TAL) effector nucleases (TALENs)" are enzymes that can target and modify specific DNA sequences. They use TAL effectors, a natural protein secreted by plant bacteria, to recognize specific DNA base pairs. TAL effectors can be designed to recognize and bind to all target DNA sequences. Attaching a nuclease to the TAL effector generates TALENs. TAL effector nucleases can bind to DNA and cut the DNA chain at specific sites, thereby introducing new genetic material.

[0043] The CRISPR / Cas9 system is widely present in prokaryotic genes and is an acquired immune defense mechanism that evolved in bacteria and archaea in response to constant attacks from viruses and plasmids. In these organisms, foreign genetic material from bacteriophages acquires and integrates into CRISPR loci; these sequence-specific fragments are transcribed into short CRISPR-derived RNAs (crRNAs). The crRNAs then bind to tracrRNAs (trans-activating RNAs) through base pairing to form double-stranded RNAs. The tracrRNA / crRNA complex then guides the Cas9 protein to cleave the double-stranded DNA, enabling gene editing.

[0044] Human induced pluripotent stem cells (iPSCs) can be induced to become almost any type of cell. Combining iPSCs with CRISPR / Cas9 gene editing technology can not only repair pathogenic sites in patient-derived iPSCs, but also introduce disease-causing mutations into healthy WT iPSCs.

[0045] Adeno-associated virus (AAV) has low immunogenicity and is considered the most promising gene therapy vector due to its high safety and stable long-term expression. Using AAV to deliver the CRISPR / Cas9 system can achieve highly efficient gene editing.

[0046] On the one hand, the present invention proposes the use of the first amino acid of an HPV antigen epitope in mediating the binding of the HPV antigen epitope to HLA-A*02:01. According to some specific embodiments of the present invention, the HPV antigen epitope has the amino acid sequence shown in SEQ ID NO:1. The anchor positions proposed in the prior art are the second and last positions of the HPV antigen epitope. In the present application, the inventors discovered that a mutation of the first amino acid in SEQ ID NO:1 can alter the binding activity and immunogenicity of the HPV antigen epitope to HLA-A*02:01, and can effectively treat or prevent HPV-related diseases.

[0047] On the other hand, the present invention proposes a method for changing the binding activity of an HPV antigen epitope to HLA-A*02:01. According to some specific embodiments of the present invention, the method includes contacting an isolated HPV antigen epitope peptide or a peptide encoding an HPV antigen epitope with a reagent, and the reagent is used to mutate the first amino acid of the HPV antigen epitope. As mentioned above, after the inventors conducted a preferential amino acid analysis and subsequent experimental determination on the HPV antigen epitope shown in SEQ ID NO:1, they found that the first position of its amino acid sequence affects the binding of the HPV antigen epitope to HLA-A*02:01 and affects its immunogenicity. This site has high value in the preparation of drugs and vaccines for HPV-related diseases. Therefore, a reagent is used to mutate the first amino acid of the HPV antigen epitope or the nucleic acid sequence encoding the first amino acid to obtain the target amino acid or nucleic acid. Among them, the reagent is not particularly limited, and any reagent that can mutate amino acids or nucleic acids can be used, such as a reagent based on at least one of the gene editing methods selected from single-base gene editing, zinc finger nuclease, transcription activator-like effector nuclease, CRISPR / Cas9 and CRISPR / Cas9 combined with iPSC and AAV vector technology.

[0048] According to some specific embodiments of the present invention, the method for altering the binding activity of an HPV antigen epitope to HLA-A*02:01 may further include at least one of the following additional technical features:

[0049] According to some specific embodiments of the present invention, the reagent is further used to mutate the second amino acid of the HPV antigen epitope.

[0050] According to some specific embodiments of the present invention, the reagent is further used to mutate the 10th amino acid of the HPV antigen epitope.

[0051] According to some specific embodiments of the present invention, the reagent is used to mutate the first amino acid of the HPV antigen epitope from T to Y.

[0052] According to some specific embodiments of the present invention, the reagent is further used to mutate the second amino acid of the HPV antigen epitope from I to L.

[0053] According to some specific embodiments of the present invention, the HPV antigen epitope has an amino acid sequence shown in SED ID NO:1.

[0054] On the other hand, the present invention proposes the use of a reagent in the preparation of a kit. According to some specific embodiments of the present invention, the kit is used to change the binding activity of the HPV epitope to HLA-A*02:01, and the reagent is used to mutate the first amino acid of the HPV epitope. It will be understood by those skilled in the art that the amino acid of the mutated HPV epitope can be directly operated on the protein or on the nucleic acid sequence encoding the HPV epitope, wherein the reagent is not particularly limited, and any reagent that can mutate the protein or nucleic acid sequence to obtain the target protein is included in the scope of this application, such as a reagent based on at least one of the gene editing methods selected from single-base gene editing, zinc finger nuclease, transcription activator-like effector nuclease, CRISPR / Cas9 and CRISPR / Cas9 combined with iPSC and AAV vector technology.

[0055] In one aspect, the present invention provides a device for use in preparing a system for altering the binding activity of an HPV epitope to HLA-A*02:01, wherein the device is used to mutate the first amino acid of the HPV epitope. The system according to an embodiment of the present invention can effectively alter the binding activity of an HPV epitope by mutating the amino acid.

[0056] According to some specific embodiments of the present invention, the device is an ultraviolet device.

[0057] On the other hand, the present invention provides an isolated polypeptide having a mutation at amino acid position 1 compared to the amino acid sequence shown in SEQ ID NO: 1. According to a specific embodiment of the present invention, when the HPV antigen epitope obtained is a 10-peptide, the amino acids 2 and 10 of the HPV antigen epitope obtained are HLA anchor positions. The inventors found that position 1 in the amino acid sequence shown in SEQ ID NO: 1 also has an important influence on its immunogenicity. The immunogenicity and potential therapeutic effect of the isolated polypeptide obtained after mutating some or all sites in the anchor position and / or amino acid position 1 in SEQ ID NO: 1 are significantly enhanced, that is, the polypeptide can be presented by HLA-A*02:01 molecules and recognized by CTL cells or TIL cells. It can then be presented to CTL or TIL cells by presenting cells expressing HLA-A*02:01 molecules to activate specific T cell immunity, constituting a physiological target of the immune response of HPV-positive tumors, and performing high-sensitivity and specificity detection, which is of great value for the prevention and treatment of HPV-related diseases.

[0058] According to some specific embodiments of the present invention, the isolated polypeptide further comprises at least one of the following additional technical features:

[0059] According to some specific embodiments of the present invention, compared to the amino acid sequence set forth in SEQ ID NO: 1, the polypeptide further comprises a mutation at amino acid position 2. As previously described, position 2 of the amino acid sequence set forth in SEQ ID NO: 1 is an anchor position, and mutation of this position improves the immunogenicity and therapeutic efficacy of the isolated polypeptide obtained.

[0060] According to some specific embodiments of the present invention, compared with the amino acid sequence shown in SED ID NO: 1, the polypeptide further includes a mutation at the 10th amino acid position.

[0061] The wild-type HPV antigen epitope has the following amino acid sequence:

[0062] TIHDIILECV (SEQ ID NO: 1).

[0063] According to some specific embodiments of the present invention, compared to the amino acid sequence shown in SEQ ID NO: 1, the isolated polypeptide has the following mutation sites: position 1 and / or position 2. As mentioned above, after the inventors performed a preferred amino acid analysis on the amino acid sequence shown in SEQ ID NO: 1, it was found that the preferred amino acids at positions 1, 2, and 10 were Y, L, and V, respectively. Therefore, only the first two amino acids were mutated.

[0064] According to some specific embodiments of the present invention, compared to the amino acid sequence shown in SED ID NO: 1, the isolated polypeptide has at least one of the following mutations: 1) T at position 1 is mutated to Y; and 2) I at position 2 is mutated to L.

[0065] According to some specific embodiments of the present invention, the isolated polypeptide has the amino acid sequence shown in SEQ ID NO: 2.

[0066] YLHDIILECV (SEQ ID NO: 2).

[0067] Prophylactic or therapeutic compositions

[0068] In another aspect, the present invention provides a nucleic acid molecule encoding the isolated polypeptide described above. The isolated polypeptide encoded by the nucleic acid molecule according to certain embodiments of the present invention can be presented by HLA-A*02:01 molecules and recognized by CTLs or TILs. Furthermore, the isolated polypeptide can be presented to CTLs or TILs by presenting cells expressing HLA-A*02:01 molecules, thereby activating specific T cell immunity. This serves as a physiological target for the immune response to HPV-positive tumors, enabling highly sensitive and specific detection, and is of great value in the prevention and treatment of HPV-related diseases.

[0069] According to some specific embodiments of the present invention, the nucleic acid molecule has at least one of the nucleotide sequences shown in SEQ ID NO:4.

[0070] Nucleic acids encoding YLHDIILECV (SEQ ID NO: 2) include:

[0071] AAUCCAUAUGCUGUAUGUGAUAAA (SEQ ID NO: 4).

[0072] It should be noted that, for nucleic acids mentioned in the present specification and claims, those skilled in the art will understand that they actually include any one or both of the complementary double strands. For convenience, although only one strand is provided in most cases in this specification and claims, the other complementary strand is also disclosed. In addition, the gene sequences in this application include DNA or RNA forms, and disclosure of one form implies disclosure of the other.

[0073] In another aspect, the present invention provides an expression vector carrying a nucleic acid or nucleic acid molecule expressing the isolated polypeptide described above. The expression vector may include optional control sequences operably linked to the nucleic acid molecule. The control sequences are one or more control sequences that direct the expression of the polypeptide in a host. The expression vectors provided in certain embodiments of the present invention can efficiently express the isolated polypeptide in suitable host cells and can be effectively used for the specific treatment or prevention of tumors, particularly tumors that express both the HLA-A*02:01 molecule and the wild-type HPV antigen epitope or isolated polypeptide described above.

[0074] As used herein, "operably linked" refers to linking an exogenous gene to a vector so that the control elements within the vector, such as transcription control sequences and translation control sequences, can function as intended to regulate the transcription and translation of the exogenous gene. When linking the above-mentioned nucleic acid molecule to a vector, the nucleic acid molecule can be directly or indirectly linked to the control elements on the vector, as long as these control elements are able to control the translation and expression of the nucleic acid molecule. Of course, these control elements can come directly from the vector itself, or they can be exogenous, i.e., not from the vector itself. It will be understood by those skilled in the art that the nucleic acid molecules encoding antibodies or antigen-binding fragments can be independently inserted into different vectors, but are commonly inserted into the same vector.

[0075] The type of the expression vector is not particularly limited, as long as it can achieve efficient expression of the aforementioned nucleic acid in the recipient cell. The expression vector includes eukaryotic expression vectors, prokaryotic expression vectors, viral expression vectors, etc. The viral expression vector includes retroviral vectors, lentiviral vectors and / or adenovirus-associated viral vectors.

[0076] On the other hand, the present invention provides a recombinant cell carrying the aforementioned nucleic acid molecule or expression vector, or expressing the aforementioned isolated polypeptide. The recombinant cell is obtained by transfecting or transforming the expression vector. The transformation or transfection can be carried out by electroporation, viral transfection or competent cell transformation. The method of transfection or transformation is determined by the properties of the host cell and the properties of the nucleic acid construct or expression vector to be transfected, as long as the efficient expression of the aforementioned polypeptide can be achieved in the host cell and the good cell state of the host cell is not significantly affected. According to some specific embodiments of the present invention, the host cell can efficiently express the above-mentioned isolated polypeptide under appropriate conditions, and the recombinant cell can be effectively used for the specific treatment or prevention of tumors, especially tumors that simultaneously express the HLA-A*02:01 molecule and the above-mentioned wild-type HPV antigen epitope or isolated polypeptide.

[0077] According to some specific embodiments of the present invention, the recombinant cell may further include at least one of the following additional technical features:

[0078] It should be noted that the recombinant cells of the present invention are not particularly limited and may be prokaryotic cells, eukaryotic cells, or bacteriophages. The prokaryotic cells may be Escherichia coli, Bacillus subtilis, Streptomyces, or Proteus mirabilis, among others. The eukaryotic cells include fungi such as Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces pombe, and Trichoderma, insect cells such as fall armyworms, plant cells such as tobacco, and mammalian cells such as BHK cells, CHO cells, COS cells, and myeloma cells. In some embodiments, the recombinant cells of the present invention are preferably mammalian cells, including BHK cells, CHO cells, NSO cells, or COS cells, and do not include animal germ cells, fertilized eggs, or embryonic stem cells.

[0079] According to some specific embodiments of the present invention, the cell is a eukaryotic cell.

[0080] According to some specific embodiments of the present invention, the eukaryotic cell is a mammalian cell. According to some specific examples of the present invention, when the recombinant cell is used to efficiently express the isolated peptide, the expression efficiency of the recombinant antibody in the eukaryotic cell, such as a mammalian cell, is higher.

[0081] It should be noted that the "suitable conditions" described in this specification refer to conditions suitable for the expression of the isolated polypeptide described herein. Those skilled in the art will readily appreciate that conditions suitable for the expression of the isolated polypeptide include, but are not limited to, suitable transformation or transfection methods, suitable transformation or transfection conditions, healthy host cell status, suitable host cell density, suitable cell culture environment, and suitable cell culture time. "Suitable conditions" are not particularly limited, and those skilled in the art can optimize the optimal conditions for the expression of the polypeptide according to the specific laboratory environment.

[0082] In another aspect, the present invention provides an isolated antigen-presenting cell capable of presenting the aforementioned isolated polypeptide. According to embodiments of the present invention, the antigen-presenting cell presenting the aforementioned isolated polypeptide can effectively elicit an immune response in a patient against the tumor-specific antigen, the aforementioned isolated polypeptide, thereby activating the specific killing function of CTLs. The antigen-presenting cell provided in embodiments of the present invention has significant efficacy in treating tumors expressing the aforementioned isolated polypeptide, with a significant therapeutic effect and high safety.

[0083] According to some specific embodiments of the present invention, the antigen-presenting cells are obtained by at least one of the following: contacting cells with antigen-presenting ability with the polypeptide; or introducing the aforementioned nucleic acid or expression vector into the cells with antigen-presenting ability.

[0084] According to some specific embodiments of the present invention, the cells having antigen presenting ability are dendritic cells, B cells or mononuclear phagocytes.

[0085] In another aspect, the present invention provides an immune effector cell. According to embodiments of the present invention, the immune effector cell can recognize the aforementioned isolated polypeptide or an antigen-presenting cell that presents the aforementioned polypeptide, the HPV antigen epitope, or the isolated polypeptide on its cell surface. According to embodiments of the present invention, the immune effector cell can specifically kill tumor cells that co-express the HLA-A*02:01 molecule and the wild-type HPV antigen epitope or the isolated polypeptide.

[0086] According to some specific embodiments of the present invention, the immune effector cells are obtained by contacting the aforementioned antigen-presenting cells with cells having immune effector capacity.

[0087] According to some specific embodiments of the present invention, the cells with immune effector ability are T cells, preferably CD8 + T cells. The inventors discovered that by contacting antigen-presenting cells presenting the aforementioned isolated polypeptide with cells having immune effector capacity, the antigen-presenting cells can activate unactivated cells with immune effector capacity, present the antigen-the aforementioned polypeptide, and then activate cells with immune effector capacity, producing a large number of immune effector cells. These immune effector cells have the function of specifically killing target cells presenting the antigen-the isolated polypeptide. CD8 + T cells are more capable of accepting activation by antigen-presenting cells, and the acquired CD8 + The T cells have a stronger effect in specifically killing target cells presenting the antigen - the isolated peptide / HPV antigen epitope.

[0088] In another aspect, the present invention provides a drug. According to an embodiment of the present invention, it comprises the aforementioned isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell, antigen-presenting cell or immune effector cell. As mentioned above, the isolated polypeptide, nucleic acid molecule encoding the wild-type HPV antigen epitope or isolated polypeptide or isolated polypeptide, expression vector, recombinant cell, antigen-presenting cell or immune effector cell can be effectively used for the specific treatment or prevention of tumors, especially tumors that simultaneously express HLA-A*02:01 molecules and the above-mentioned isolated polypeptide. Therefore, drugs containing some or all of the above substances also have significant effects on treating or preventing tumors that express HLA-A*02:01 molecules and the above-mentioned isolated polypeptide, and are safer and have fewer side effects.

[0089] The medicine provided according to some specific embodiments of the present invention may further include a pharmaceutically acceptable carrier and an effective amount of the active ingredient of the above-mentioned substance.

[0090] As used herein, the term "effective amount" or "effective dose" refers to an amount that can produce a function or activity on humans and / or animals and can be accepted by humans and / or animals.

[0091] As used herein, a "pharmaceutically acceptable" ingredient is one that is suitable for use in humans and / or mammals without undue adverse side effects (e.g., toxicity, irritation, and allergic reactions), i.e., possesses a reasonable benefit / risk ratio. The term "pharmaceutically acceptable carrier" includes, but is not limited to, water, saline, liposomes, lipids, proteins, protein-antibody conjugates, peptides, cellulose, nanogels, or combinations thereof. The choice of carrier should be compatible with the mode of administration, as is well known to those skilled in the art.

[0092] The pharmaceutical composition of the present invention contains a safe and effective amount of the active ingredient of the present invention and a pharmaceutically acceptable carrier. Such carriers include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. Generally, the pharmaceutical preparation should be compatible with the mode of administration, wherein the mode of administration can be oral administration, nasal administration, intradermal administration, subcutaneous administration, intramuscular administration, intravenous administration, or intraperitoneal administration. The dosage form of the drug of the present invention is an injection, an oral preparation (tablet, capsule, oral solution), a transdermal agent, or a sustained-release agent. For example, it can be prepared by conventional methods using physiological saline or an aqueous solution containing glucose and other adjuvants. The drug is preferably manufactured under sterile conditions. The isolated polypeptide can be administered by intravenous infusion or injection or intramuscular or subcutaneous injection.

[0093] The effective amount of the active ingredient of the present invention may vary depending on the mode of administration and the severity of the disease to be treated. The preferred effective amount can be determined by one of ordinary skill in the art based on various factors (e.g., through clinical trials). Such factors include, but are not limited to, the pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, the route of administration, and the like. For example, depending on the exigencies of the treatment, several divided doses may be administered daily, or the dose may be reduced proportionally.

[0094] At the same time, the inventors found that cervical cancer, vulvar cancer, vaginal cancer, anal cancer, penile cancer, head and neck cancer, cervical intraepithelial neoplasia, vulvar intraepithelial neoplasia, vaginal intraepithelial neoplasia, anal intraepithelial neoplasia, penile intraepithelial neoplasia, oral cancer, laryngeal cancer, esophageal cancer, nasal cancer or tonsil cancer, especially cervical cancer tissue, specifically and highly expresses the above-mentioned isolated polypeptide or HPV antigen epitope, and thus when the tumor is the above-mentioned tumor, the effectiveness of the drug treatment is further improved.

[0095] On the other hand, the present invention proposes a vaccine. According to an embodiment of the present invention, it comprises the isolated polypeptide, nucleic acid molecule, expression vector or antigen-presenting cell described above. As described above, the nucleic acid molecule, expression vector or recombinant cell of the embodiment of the present invention expresses the isolated polypeptide described above under appropriate conditions, and the antigen-presenting cell can express the isolated polypeptide. When it binds to the HLA-A*02:01 molecule, it is presented by the antigen-presenting cell, so that it is recognized by CTL or TIL cells, that is, it is presented to CTL or TIL cells by the antigen-presenting cell expressing the HLA-A*02:01 molecule to activate specific T cell immunity. Therefore, the vaccine proposed in the embodiment of the present invention has a significant effect of treating or preventing tumors expressing HLA-A*02:01 molecules and the isolated polypeptide, and it is safer and has fewer side effects. At the same time, the inventors found that the vaccine can effectively treat or prevent cervical cancer, vulvar cancer, vaginal cancer, anal cancer, penile cancer, head and neck cancer, cervical intraepithelial neoplasia, vulvar intraepithelial neoplasia, vaginal intraepithelial neoplasia, anal intraepithelial neoplasia, penile intraepithelial neoplasia, oral cancer, laryngeal cancer, esophageal cancer, nasal cancer or tonsil cancer, especially cervical cancer tissue specifically and highly expresses the above-mentioned isolated polypeptide, HPV antigen epitope or isolated polypeptide, and thus when the tumor is the above-mentioned cervical cancer, the effectiveness of the drug treatment is further improved.

[0096] According to some embodiments of the present invention, the vaccine is in a form suitable for administration by inhalation or injection.

[0097] According to some specific embodiments of the present invention, the vaccine further comprises at least one adjuvant.

[0098] use

[0099] On the one hand, the present invention proposes the use of a reagent in the preparation of a kit, wherein the reagent is used to detect the aforementioned isolated polypeptide, and the kit is used to diagnose HPV or detect the therapeutic effect of HPV. The reagent can accurately detect the isolated polypeptide, such as detecting whether the biological sample contains the isolated polypeptide. Since the isolated polypeptide is highly expressed in HPV-infected tissues, the kit containing the reagent can accurately diagnose whether the individual from which the biological sample is derived is infected with HPV, and further, whether the individual is at high risk of HPV. Similarly, during the treatment of an HPV-infected individual, the kit can be used to detect changes in HPV during the treatment process, such as worsening, slowing down, or cure.

[0100] On the other hand, the present invention provides the use of the aforementioned isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell, antigen-presenting cell or immune effector cell in the preparation of a medicament. According to an embodiment of the present invention, the medicament is used to treat or prevent HPV-related diseases. As mentioned above, the isolated polypeptide, nucleic acid molecule encoding the isolated polypeptide, expression vector, recombinant cell, antigen-presenting cell or immune effector cell can be effectively used for the specific treatment or prevention of tumors, especially tumors that express both the HLA-A*02:01 molecule and the above-mentioned isolated polypeptide. Therefore, a medicament containing some or all of the above substances also has a significant effect of treating or preventing tumors that express the HLA-A*02:01 molecule and the above-mentioned isolated polypeptide, and is safer and has fewer side effects.

[0101] According to some specific embodiments of the present invention, the HPV-related diseases include at least one of the following: cervical cancer, vulvar cancer, vaginal cancer, anal cancer, penile cancer, head and neck cancer, cervical intraepithelial neoplasia, vulvar intraepithelial neoplasia, vaginal intraepithelial neoplasia, anal intraepithelial neoplasia, penile intraepithelial neoplasia, oral cancer, laryngeal cancer, esophageal cancer, nasal cancer, and tonsil cancer. The inventors have discovered that the drug can effectively treat or prevent the above-mentioned diseases, especially cervical cancer tissue specifically and highly expresses the above-mentioned isolated polypeptide, HPV antigen epitope, or isolated polypeptide. Therefore, when the disease is cervical cancer, the effectiveness of the drug treatment is further improved.

[0102] On the one hand, the present invention proposes the use of the aforementioned isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell, antigen-presenting cell, immune effector cell or drug in the preparation of a composition. According to an embodiment of the present invention, the composition is used to treat or prevent HPV-related diseases. As mentioned above, the isolated polypeptide, nucleic acid molecule encoding the wild-type HPV antigen epitope or isolated polypeptide or encoding the isolated polypeptide, expression vector, recombinant cell, antigen-presenting cell or immune effector cell can be effectively used for the specific treatment or prevention of tumors, especially tumors that simultaneously express HLA-A*02:01 molecules and the above-mentioned isolated polypeptide. Therefore, a pharmaceutical composition containing some or all of the above substances also has a significant effect of treating or preventing tumors that express HLA-A*02:01 molecules and the above-mentioned isolated polypeptide, and is safer and has fewer side effects. The composition is a food or a pharmaceutical composition.

[0103] In yet another aspect, the present invention provides use of the aforementioned isolated polypeptides, nucleic acid molecules, expression vectors, or recombinant cells in the preparation of a kit for detecting HLA-A*02:01. According to certain embodiments of the present invention, the isolated peptides, HPV antigen epitopes, isolated polypeptides, and their corresponding substances can bind to HLA-A*02:01 and, therefore, can be used to prepare a kit for effectively detecting HLA-A*02:01.

[0104] Reagent test kit

[0105] In one aspect, the present invention proposes a kit comprising a reagent suitable for detecting the aforementioned isolated polypeptide. The reagent can accurately detect the isolated polypeptide, such as detecting whether the biological sample contains the isolated polypeptide. Since the isolated polypeptide is highly expressed in tissues infected by HPV, the kit containing the reagent can accurately diagnose whether the individual from which the biological sample is derived is infected with HPV, and further, whether the individual is at high risk of HPV. Similarly, during the treatment of an HPV-infected individual, the kit can be used to detect changes in HPV during the treatment process, such as worsening, slowing down or curing. The reagent includes antagonists of the isolated polypeptide, receptor proteins, antibodies, and other proteins or nucleic acid molecules thereof that can specifically bind to the isolated polypeptide.

[0106] In yet another aspect, the present invention provides a kit for detecting HLA-A*02:01, comprising the isolated polypeptide, nucleic acid molecule, expression vector, or recombinant cell described above. As previously described, the isolated polypeptide and its corresponding substance can bind to HLA. Therefore, a kit containing such substances can be used for the effective qualitative or quantitative detection of HLA.

[0107] Prevention or treatment methods

[0108] In one aspect, the present invention provides a method for preventing or treating HPV-related diseases, comprising administering to a subject the isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell, antigen-presenting cell, immune effector cell, vaccine, or drug described above. As previously mentioned, certain embodiments of the present invention provide methods for preventing or treating tumors expressing HLA-A*02:01 molecules and the wild-type HPV antigen epitope or isolated polypeptide, including administering an effective amount of any of the aforementioned isolated polypeptides.

[0109] According to some specific embodiments of the present invention, the HPV-related diseases include at least one of the following: cervical cancer, vulvar cancer, vaginal cancer, anal cancer, penile cancer, head and neck cancer, cervical intraepithelial neoplasia, vulvar intraepithelial neoplasia, vaginal intraepithelial neoplasia, anal intraepithelial neoplasia, penile intraepithelial neoplasia, oral cancer, laryngeal cancer, esophageal cancer, nasal cancer and tonsil cancer.

[0110] Various modes of administration are contemplated, including peritoneal, intravenous, intramuscular, subcutaneous, intradermal, oral, topical, nasal, pulmonary, and rectal administration, but the present invention is not limited to these exemplified modes of administration. However, due to oral administration, the active ingredient of the orally administered drug or composition should be coated or formulated to prevent it from being degraded in the stomach. Preferably, the drug or composition of the present invention can be administered as an injectable formulation. In addition, the drug or composition of the present invention can be administered using a specific device that delivers the active ingredient to the target cell.

[0111] The frequency and dosage of administration of the isolated polypeptides, nucleic acids, expression vectors, recombinant cells, antigen-presenting cells, immune effector cells, drugs, and vaccines of the present invention can be determined by a number of relevant factors, including the type of disease to be treated, the route of administration, the patient's age, sex, weight, and severity of the disease, and the type of drug as the active ingredient. According to some embodiments of the present invention, the daily dose can be divided into one, two, or more doses in a suitable form, so that it can be administered once, twice, or more times over the entire time period, as long as the therapeutically effective amount is achieved.

[0112] The term "therapeutically effective amount" refers to an amount sufficient to significantly improve certain symptoms associated with a disease or condition, that is, an amount that provides a therapeutic effect for a given condition and dosage regimen. The term "treat" is used to refer to obtaining a desired pharmacological and / or physiological effect. As used herein, "treating" encompasses administering the isolated polypeptides, nucleic acids, expression vectors, recombinant cells, vaccines, antigen-presenting cells, immune effector cells, or drugs of the embodiments of the invention to an individual for treatment, including but not limited to administering a composition comprising the compositions described herein to an individual in need thereof.

[0113] Diagnostic methods

[0114] On the one hand, the present invention provides a method for diagnosing whether a subject contains HPV, comprising the step of detecting whether a biological sample derived from the subject carries the isolated polypeptide or nucleic acid molecule described above. As described above, the isolated polypeptide or nucleic acid molecule is present in individuals infected with HPV. Therefore, by detecting whether the biological sample derived from the subject carries the substance, it is possible to effectively diagnose whether the subject contains HPV. Furthermore, based on the HPV content detected in the subject, the HPV-related disease caused by the subject can be staged, or the prognosis of patients suffering from HPV-related diseases can be assessed before and after treatment. When the HPV content in the subject after treatment is lower than before treatment, it is an indication that the subject has a good prognosis.

[0115] The "subject" or "individual" referred to in the present invention generally refers to mammals, such as primates and / or rodents, in particular humans, monkeys or mice.

[0116] Diagnostic system

[0117] Finally, the present invention proposes a diagnostic system. According to an embodiment of the present invention, reference Figure 1 , the diagnostic system includes: a polypeptide detection device 100; a result determination device 200. The polypeptide detection device 100 is used to detect whether a biological sample derived from a subject carries the aforementioned isolated polypeptide, and the result determination device 200 is connected to the peptide detection device 100, and is used to determine whether the patient suffers from a tumor based on whether the biological sample carries the isolated polypeptide. For example, a mass spectrometer can be used to detect whether the subject's serum contains the isolated polypeptide, and then a mass spectrometry data analysis device can be used to determine whether the subject's serum contains the isolated polypeptide to determine whether the patient suffers from a tumor. The inventors have discovered that the isolated polypeptide is specifically and highly expressed in tumor tissues, and the diagnostic system proposed in the embodiment of the present invention can be used to effectively identify tumor patients who specifically and highly express the isolated polypeptide.

[0118] In addition, the inventors found that cervical cancer, vulvar cancer, vaginal cancer, anal cancer, penile cancer, head and neck cancer, cervical intraepithelial neoplasia, vulvar intraepithelial neoplasia, vaginal intraepithelial neoplasia, anal intraepithelial neoplasia, penile intraepithelial neoplasia, oral cancer, laryngeal cancer, esophageal cancer, nasal cancer or tonsil cancer specifically and highly express the polypeptide, and the diagnostic system proposed in the embodiment of the present invention further improves the diagnostic accuracy of the above tumors.

[0119] The inventors also discovered that HLA-A*02:01 molecules have a strong affinity for the isolated polypeptide, which, by binding to cell-surface HLA-A*02:01 molecules, triggers a series of immune responses. Therefore, the diagnostic system proposed in this embodiment of the present invention has a higher probability of diagnosing tumor patients who express both HLA-A*02:01 molecules and the isolated polypeptide.

[0120] It should be noted that the isolated polypeptides and their uses, nucleic acids encoding the isolated polypeptides, expression vectors, recombinant cells, drugs, antigen-presenting cells, immune effector cells, vaccines, kits, methods and systems for treating and diagnosing HPV according to the embodiments of the present invention were discovered and completed by the inventors of this application through arduous creative work and optimization work.

[0121] The present invention will be described below with reference to specific examples. It should be noted that these examples are merely illustrative and do not limit the present invention in any way. Where specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in this area (e.g., with reference to "Molecular Cloning Experiment Guide" by J. Sambrook et al., translated by Huang Peitang et al., 3rd edition, Science Press) or the product instructions are used. Reagents or instruments used without manufacturer's indication are all commercially available conventional products.

[0122] Example 1 Acquisition of polypeptide

[0123] In this example, the inventors synthesized the target peptide by using the HPV virus peptide target that has been reported in the literature for application in HPV-related cancers (Doran SL, S, Adhikary S, et al. T-cell receptor gene therapy for human papillomavirus–associated epithelial cancers: a first-in-human, phase I / II study [J]. Journal of Clinical Oncology, 2019, 37(30): 2759.), namely, the 29-38 amino acids TIHDIILECV (SEQ ID NO: 1, polypeptide 1, wild type peptide) of HPV 16E6 protein were mutated to try to optimize its immune function. The experimental process included:

[0124] HLA-A02:01 typing was selected as the target typing, and the antigenic epitopes of this typing were collected from the IEDB public database (http: / / www.iedb.org / ), thereby obtaining the amino acid sequence shown in SEQ ID NO:1. The sequence conservation characteristics were analyzed to confirm that the preferred amino acids at the first, second, and last (10th) positions were Y, L, and V, respectively. The amino acid preference characteristics of the HLA-A02:01 typing binding epitope are as follows: Figure 2 Although the amino acid position 4 also has a preferred amino acid, this site is close to the middle of the sequence and may be a potential TCR anchor point, so it was not modified. The inventors mutated position 1 of TIHDIILECV to Y and position 2 to L to obtain the polypeptide YLHDIILECV (SEQ ID NO: 2, polypeptide 2, replacement peptide).

[0125] Example 2 Peptide Presentation and Affinity Detection

[0126] In this example, the affinity and presentation predictions for HLA-A02:01 typing of polypeptides 1 and 2 obtained in Example 1 were performed. The specific experimental procedures are as follows:

[0127] Binding affinity prediction was performed using netMHCpan 4.1 (http: / / www.cbs.dtu.dk / services / NetMHCpan / ). The peptide sequence and corresponding HLA typing were entered into the software. The input HLA typing was reduced to retain only specific binding sites, forming a pseudosequence to reduce the negative impact of irrelevant site information on the model. The peptide sequence was then transformed into a 9-peptide (the primary length for HLA class I binding) by insertions and deletions to form a binding core. BLOSUM encoding was then used to preserve amino acid similarity. Additional information, such as insertions and deletions, was encoded into the peptides to improve learning and prediction by using different input neurons for different lengths. netMHCpan can perform BA (binding affinity) predictions, obtaining IC50 values ​​(nM) as measured in conventional experiments. Lower IC50 values ​​indicate higher affinity for the peptide.

[0128] Antigen presentation was predicted using EPIP (http: / / epip.genomics.cn / ). The peptide sequences and corresponding HLA typing to be predicted were entered into the software, with the default expression level for each peptide set to TPM = 4. EPIP used logistic regression (LR) to model the three calculated features (site-specific scoring matrix score, gene expression level, and sequence length) and calculate a standardized representation of the probability of antigen presentation, or presentation ability score. This score, ranging from 0 to 1, represents the probability of antigen presentation. The closer the EPIP score is to 1, the higher the probability that the antigen will be presented by the corresponding HLA typing.

[0129] The experimental results are shown in Table 1 , indicating that both peptides have high affinity and antigen presentation capabilities.

[0130] Table 1: Presentation ability and affinity prediction scores of peptide sequences and HLA alleles

[0131]

[0132] Example 3 Verification of the affinity of polypeptide T2

[0133] In this example, the polypeptides 1 and 2 used in Examples 1 and 2 were added to 2×10 5 T2 cells were added with human β2 microglobulin (final concentration, 3 μg / mL, purchased from biovision), cultured in 24-well plates, and cultured overnight in an incubator (37°C, 5% CO2). The experiment was set up with two replicate wells: T2 cells without peptide were used as background control, and CMV peptide (NLVPMVATV, SEQ ID NO: 4, purchased from GenScript) was added as a positive control. The cells were centrifuged at 200g for 5 minutes to collect the cells. After washing the cells twice with PBS, the cells were directly incubated with FITC-labeled monoclonal antibodies against HLA-A02:01 and maintained at 4°C for 30 minutes. The cells were then analyzed by flow cytometry (BD FACSJazz TM ) and its software to detect and analyze its average fluorescence intensity. The experimental results are shown in Table 2. The optimized peptide 2 has a higher affinity than peptide 1.

[0134] Table 2: Test results of affinity between peptide sequences and HLA alleles

[0135]

[0136]

[0137] Example 4 ELISPOTs verification of peptide CD8 + T cell immune response

[0138] 4.1 Antigen-specific CD8 + T cell preparation

[0139] PBMC cells from healthy volunteers with HLA-A02:01 typing were obtained and the concentration was adjusted to 2×10 6 PBMC cells were isolated by adherence method (attachment for 3 hours), and CD8 + T cells and cell isolation procedures are all routine experimental operations in this field. GM-CSF (1000U / mL) and IL-4 (1000U / mL) were used to induce adherent monocytes to become immature DCs. IFN-gamma (100U / mL), LPS (10ng / mL) and peptide 2 were then used to induce adherent cells to develop into mature DCs. Mature DCs loaded with peptide 2 were irradiated and compared with CD8 + T cells were co-cultured and IL-21 was added. After 3 days of culture, IL-2 and IL-7 were added. Then, IL-2 and IL-7 were added once on the 5th and 7th days. On the 10th day, the co-cultured cells were counted and peptide 2-specific CD8 + Peptide 1-specific CD8 T cells were prepared using the same protocol. + T cells.

[0140] Table 3: CD8 + T cell preparation results

[0141] SEQ ID category peptides Total number of cells before culture Total number of cells after culture NO:1 Peptide 1 TIHDIILECV 2.0×10^6 5.21×10^6 NO:2 Peptide 2 YLHDIILECV 2.0×10^6 8.98×10^6 NO:3 Positive control peptide NLVPMVATV 2.0×10^6 1.05×10^7

[0142] 4.2 Verifying CD8 + T cell immune response

[0143] will replace peptide-specific CD8 + T cells and T2 loaded with wild-type peptide or irrelevant peptide were added to ELISPOTs plates for culture, and ELISPOTs detection was performed after 20 hours (refer to the kit instructions). Wild-type peptide-specific CD8 + The positive control group was to add CMV antigen-specific T cells and T2 loaded with CMV antigen peptide or irrelevant peptide into ELISPOTs plate for culture. The detection method was the same as above. The experimental results are shown in Figure 3 and Table 5.

[0144] Table 5: Results of peptide-stimulated specific CD8+ T cells secreting IFN-gamma

[0145] SEQ ID category Peptide sequence Number of experimental peptide spots Number of irrelevant peptide spots Multiples (experimental / irrelevant) NO:1 Peptide 1 TIHDIILECV 77+56 15+16 4.3 NO:2 Peptide 2 YLHDIILECV 252+261 26+31 9.0 NO:3 Positive control peptide NLVPMVATV 227+224 27+31 7.8

[0146] Example 5 CFSE and 7-AAD dual labeling technique to detect the killing ability of CTL cells

[0147] Take T2 cells in the logarithmic growth phase and divide them into a peptide-loaded (peptide 1) group and a non-peptide-loaded group. Culture them in a 37°C, 5% CO2 incubator overnight. Wash the overnight cultured T2 cells, add 0.5μM CFSE solution, and treat them at 37°C for 20 minutes. Immediately after staining, remove the cells, stop staining, wash them with DPBS 2-3 times, count them, and resuspend the stained cells to 2×10 5 CTL cells were co-cultured with T2 cells loaded with or without antigen peptides at a specific effector-target ratio and incubated at 37°C in a 5% CO2 incubator. After 20-22 hours, the cell mixture was dispersed and resuspended, then removed and stained with 7-ADD for 5 minutes in the dark to mark dead cells. The killing rate was then measured by flow cytometry. CSFE + 7-AAD + Double-positive cells are target cells that are killed, CFSE + 7-ADD - The cells are target cells that have not been killed. The killing activity of target cells against T2 is calculated based on these ratios. The same protocol is used to detect peptide 2-specific CD8 + Killing activity of T cells. Killing rate (%) = (the proportion of dead cells in the target cells of the experimental group - the proportion of dead cells in the target cells of the negative control group) / (1 - the proportion of dead cells in the target cells of the negative control group). Specific experimental results are shown in Table 6 and Figure 4 .

[0148] Table 6: T cells specifically recognize and kill target cells presenting experimental peptides

[0149]

[0150] Example 6 Pharmacodynamic Study of Intravenous Injection of Specific T Cells in a Mouse Model Bearing Caski Cells of Human Cervical Cancer

[0151] Peptide 1-specific T cells and Peptide 2-specific T cells were prepared according to Example 4, and the efficacy evaluation in mice was carried out. A subcutaneous tumor model was constructed using 64 7-9 week old immunodeficient NOG mice and cervical cancer cell line Caski cells. Each mouse was subcutaneously inoculated with 2×10 6 After inoculation, the tumor growth of the mice was regularly observed and the tumor size was monitored. When the tumor grew to 50-100 mm 3 The mice were then randomly divided into groups according to tumor size and weight, and the drugs were administered through the tail vein.

[0152] According to the administration method, the cells were divided into 8 groups: 1) PBS adjuvant group, 2) low-dose polypeptide 1-specific T cell group, 3) high-dose polypeptide 1-specific T cell group, 4) high-dose polypeptide 1-specific T cell group, 5) low-dose polypeptide 2-specific T cell group, 6) high-dose polypeptide 2-specific T cell group, 7) high-dose polypeptide 2-specific T cell group, 8) high-dose mock-T cell group (i.e., the DC cells stimulated and activated by the polypeptide in Example 4 were replaced with CKT3 and CD28 stimulated and activated T cells, which is a conventional operation in the art), with 8 cells in each group. The high-dose group was injected with 2×10 7 / dose, the medium dose group was 7×10 6 / dose, low-dose group was 2×10 6 The drug was administered twice a day, with the second dose administered 7 days after the first dose. It was also combined with IL-2 (50,000 IU / dose, 3 doses per day).

[0153] The results are as follows Figure 5 As shown. After the tumor was confirmed to have formed (5-8 days after inoculation), the length and width of the tumor were measured every 2 days, the tumor volume was calculated, and the relative tumor inhibition rate was calculated to complete the efficacy evaluation. The results showed that the drug was administered on the 5th day after tumor formation. By the 31st day, the TGI of the low, medium and high dose groups of polypeptide 2 were 37%, 68% and 82%, respectively. Among them, the medium and high dose groups could significantly inhibit the growth of CaSki tumors in NOG mice, and showed a certain dose-effect relationship. The TGI of the low, medium and high dose groups of polypeptide 1 were 5%, 24% and 39%, respectively, and the TGI of the Mock-T group was less than 20%.

[0154] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of the technical features being referred to. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. In the description of the present invention, "plurality" means at least two, such as two, three, etc., unless otherwise specifically defined.

[0155] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0156] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. An isolated polypeptide, characterized in that The amino acid sequence of the polypeptide is shown in SEQ ID NO:

2.

2. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the polypeptide of claim 1.

3. An expression vector, characterized in that Carrying a nucleic acid expressing the polypeptide of claim 1.

4. An isolated antigen-presenting cell, characterized in that The cells present the polypeptide of claim 1.

5. The antigen-presenting cell according to claim 4, characterized in that The antigen-presenting cells are obtained by at least one of the following: contacting cells with antigen-presenting ability with the polypeptide; The expression vector according to claim 3 is introduced into the cells having antigen presenting ability.

6. The antigen-presenting cell according to claim 5, characterized in that The cells with antigen presenting ability are dendritic cells, B cells or mononuclear phagocytes.

7. Use of the polypeptide according to claim 1, the nucleic acid molecule according to claim 2, the expression vector according to claim 3, or the antigen-presenting cell according to any one of claims 4 to 6 in the preparation of a medicament for preventing or treating HPV-related diseases.

8. The use according to claim 7, characterized in that The HPV-related diseases include at least one of the following: cervical cancer, vulvar cancer, vaginal cancer, anal cancer, penile cancer, head and neck cancer, cervical intraepithelial neoplasia, vulvar intraepithelial neoplasia, vaginal intraepithelial neoplasia, anal intraepithelial neoplasia, penile intraepithelial neoplasia, oral cancer, laryngeal cancer, esophageal cancer, nasal cancer and tonsil cancer.

9. A drug, characterized in that Comprising the polypeptide according to claim 1, the nucleic acid molecule according to claim 2, the expression vector according to claim 3, or the antigen-presenting cell according to any one of claims 4 to 6.

10. A vaccine, characterized in that Comprising the polypeptide according to claim 1, the nucleic acid molecule according to claim 2, the expression vector according to claim 3, or the antigen-presenting cell according to any one of claims 4 to 6.

11. The vaccine according to claim 10, characterized in that Further comprising at least one adjuvant.

Citation Information

Patent Citations

  • Constructing method and application of recombinant vaccine having anti-cervical cancer cell activity

    CN105801704A