Protein interacting with cucumber green mottle mosaic virus MP protein, its encoding gene and application

Abstract

The present invention belongs to the field of plant genetic engineering and relates to proteins that interact with the MP protein of cucumber green mottle mosaic virus, in particular to proteins that interact with the MP protein of cucumber green mottle mosaic virus, their encoding genes, and applications. Disclosed are the nucleotide sequence of the Nicotiana benthamiana BRG2 protein that interacts with the mobile protein of cucumber green mottle mosaic virus and its application. The full length of the open reading frame cDNA is 1014 bases, and the encoded protein consists of 377 amino acids, named NbBRG2. This protein is localized in the cell nucleus and interacts with the MP protein of cucumber GMMV in vivo. After transient silencing of NbBRG2, the accumulation level of CGMMV virus is significantly reduced.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering and relates to a protein interacting with the MP protein of cucumber green mottle mosaic virus, in particular to a protein interacting with the MP protein of cucumber green mottle mosaic virus, a coding gene thereof and an application thereof. Background Art

[0002] Cucumber green mottle mosaic virus (CGMMV) is an important quarantine virus for both imported and domestic crops in my country. It spreads through seeds and harms a variety of cucurbit crops, including watermelon ( Citrullus lanatus ),melon( Cucumis melo ),squash( Cucurbita pepo ),cucumber( Cucumis sativus ) and pumpkin ( Cucurbita moschata Since its outbreak in 2006 in Gaizhou, Liaoning, where it nearly wiped out watermelon production, CGMMV has now spread to 11 provinces and regions, including Liaoning, Shanghai, Jiangsu, Zhejiang, Anhui, Henan, Hunan, Guangxi, Hainan, Guangdong, and Shandong, making its prevention and control difficult.

[0003] Ubiquitin (Ub) consists of 76 amino acids and is highly conserved across eukaryotes. The ubiquitin-proteasome system (UPS) is the primary signaling pathway for protein degradation in eukaryotic cells. It primarily consists of ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2), ubiquitin ligase (E3), and the 26S proteasome. E3 proteins are a large family of proteins, with numerous discovered types, primarily classified into two categories: single-subunit and multi-subunit. Single-subunit proteins can be divided into three major families: the HECT domain family, the U-box protein family, and the RING domain family.

[0004] With the in-depth study of the ubiquitin pathway, the regulatory role of the ubiquitin proteasome in the interaction between plants and pathogens, especially plant viruses, has gradually become clear. The currently identified plant viruses involved in the ubiquitination pathway have the following modes of action: (1) Inducing the expression of host UPS-related proteins. Beet severe curly top virusThe expression of the pathogenic factor C4 protein of BSCTV can promote the expression of E3 ligase RKP (Lai et al., 2009). RKP regulates the cell cycle by degrading the cell cycle inhibitor ICK / KRPs (interactors / inhibitors of Cdc2 kinases / Kip-related proteins), affecting the infection of BSCTV; (2) inhibiting the host's ubiquitin-binding enzyme E2. Cotton leaf curl Multan virus , CLCuMV) encodes the pathogenicity factor Βc1 protein, which can interact with the host ubiquitin-conjugating enzyme S1UBC3, thereby inhibiting the accumulation of ubiquitinated proteins, affecting the development and signaling pathways regulated by the UPS, and causing the aggravation of plant symptoms. Arabidopsis thaliana ) AtUbc2 protein can bind to tomato bushy stunt virus ( Tomato bushy stunting virus , TBSV) replication protein P33, affecting the ubiquitination level of P33, thereby promoting viral replication; (3) interfering with the host's ubiquitin ligase E3. Faba bean necrotic yellows virus , FBNYV) encodes a CLINK (cell cycle link) protein containing an F-box motif that can interact with the SKP1 protein in vivo and in vitro, thereby participating in the formation of the SCF complex; Rice dwarf virus , RDV) can interact with the E3 ubiquitin ligase RING-finger protein H2-10, thereby causing the degradation of the P2 protein and playing an antiviral role in the early stages of viral infection.

[0005] BRG2 is a RING-type E3 ligase. Studies have shown that Arabidopsis BRG proteins are involved in stress and plant pathogen resistance. However, the role of BRG2 in plant virus infection has not been reported. To further investigate the function of this protein, our research group conducted a long-term exploratory study. Summary of the Invention

[0006] The present invention proposes a protein that interacts with the MP protein of cucumber green mottle mosaic virus, its encoding gene and application, and provides feasibility for biological control of crops infected with cucumber green mottle mosaic virus using BRG protein.

[0007] The technical solution of the present invention is achieved as follows:

[0008] A protein that interacts with the MP protein of Cucumber Green Mottle Mosaic Virus.

[0009] The above protein is BRG2 protein, and its amino acid sequence is shown in SEQ ID No.1.

[0010] The nucleotide sequence of the gene encoding the above protein is shown in SEQ ID No.2.

[0011] Application of the above protein in antiviral activities.

[0012] Application of BRG2 protein that interacts with cucumber green mottle mosaic virus in antiviral applications.

[0013] Application of BRG2 protein that interacts with the movement protein of cucumber green mottle mosaic virus in antiviral activities.

[0014] The amino acid sequence of the above-mentioned BRG2 protein is shown in SEQ ID No.2.

[0015] The above virus is cucumber green mottle mosaic virus.

[0016] The above application comprises the following steps: using the cDNA of the plant to be controlled as a template, PCR amplifying the BRG2 fragment, cloning the PCR product into the TRV vector by homologous recombination to obtain the TRV-BRG2 recombinant plasmid, and then transferring it into the plant to be controlled to transiently silence the BRG2 gene, thereby obtaining a superior plant resistant to cucumber green mottle mosaic virus.

[0017] The forward primer sequence for amplifying the BRG2 fragment is shown in SEQ ID No. 3, and the reverse primer sequence is shown in SEQ ID No. 4.

[0018] The present invention has the following beneficial effects:

[0019] 1. The protein related to cucumber green mottle mosaic virus infection provided by the present invention is BRG2. The full length of the open reading frame cDNA is 1014 bases, and the encoded protein consists of 377 amino acids, named NbBRG2. This protein is localized in the cell nucleus and interacts with the MP protein of CGMMV in vivo. After transient silencing of NbBRG2, the accumulation level of CGMMV virus is significantly reduced.

[0020] 2. The BRG2 gene of the present invention verified the interaction between BRG2 protein and CGMMV MP through bimolecular fluorescence complementation technology, and verified the use of BRG2 in CGMMV infection through virus-mediated gene silencing technology. After BRG2 was silenced, the accumulation of CGMMV at the RNA level and protein level was significantly downregulated, indicating that BRG can play a role as a recessive disease resistance factor. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 This is the amplification map of the full-length reading frame of the Nicotiana benthamiana BRG2 gene.

[0023] Figure 2 This is the subcellular localization map of BRG2.

[0024] Figure 3 The interaction map between BRG2 and CGMMV MP was verified by bimolecular fluorescence complementation technology.

[0025] Figure 4 This figure shows the effect of BRG2 transient silencing on CGMMV infection. DETAILED DESCRIPTION

[0026] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] Example 1: Cloning of the Nicotiana benthamiana BRG2 (BOI-related gene 2) gene

[0028] Extraction of Total RNA from Nicotiana benthamiana

[0029] Take 0.1g of fresh Nicotiana benthamiana leaves, grind them into powder in liquid nitrogen, transfer them into a 1.5ml centrifuge tube, add 1ml of trizol into the centrifuge tube, shake to mix, and let it stand at room temperature for 5 minutes.

[0030] Centrifuge at 12000g for 10 min at 4°C and transfer the supernatant to a new 1.5ml centrifuge tube.

[0031] Add 200 μl of chloroform, shake to mix, and let stand at room temperature for 5 min.

[0032] Centrifuge at 12000g for 15 min at 4°C, transfer the supernatant to a new 1.5ml centrifuge tube, add 500µl of isopropanol, and let stand at room temperature for 10 min.

[0033] Centrifuge at 12000g, 4℃ for 10 min, discard the supernatant, and wash the precipitate with 75% ethanol.

[0034] Centrifuge at 7500g, 4°C for 5 min and discard the supernatant.

[0035] Repeat steps (5) and (6).

[0036] Dry at room temperature for 5 minutes, add 30ul of DEPC-treated water to dissolve RNA, and store in a -80℃ refrigerator.

[0037] RT-PCR amplification of BRG2 gene

[0038] Synthesis of the first-strand cDNA of the BRG2 gene

[0039] Take a 1.5ml centrifuge tube and add the following components in sequence:

[0040]

[0041] 42℃ water bath for 1h

[0042] PCR amplification of the full-length reading frame of the BRG2 gene

[0043] The BRG2 gene was amplified by PCR using the first-strand cDNA as a template. The PCR reaction system consisted of 1 μl of cDNA, 0.5 μl of forward primer, 0.5 μl of reverse primer, and 25 μl of DNA polymerase. The PCR amplification procedure was as follows: initial denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 1 min, and finally 72°C for 10 min. The resulting PCR product was analyzed by 1% agarose gel electrophoresis, yielding a single band of the expected size (1014 bp). Purification and recovery using an Axygen PCR cleanup kit yielded a single band.

[0044] The primer sequences are:

[0045] Forward primer ATGGCTCTTCCTCATCACCA,

[0046] Reverse primer: CTATATGTAAACTTCCATG.

[0047] The electrophoresis results are as follows Figure 1 shown.

[0048] Example 2: Subcellular localization of BRG2

[0049] Using YC-BRG2 in Example 2 as a template, PCR was performed to amplify the BRG2 gene. The PCR product was cloned into the GFP vector by homologous recombination and sequenced to verify its correctness, thereby obtaining the BRG2-GFP recombinant plasmid.

[0050] The primer sequences for amplifying the BRG2 gene are:

[0051] Forward primer:

[0052] GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCTCTTCCTCATCACC,

[0053] Reverse primer:

[0054] GGGGACCACTTTGTACAAGAAAGCTGGGTCTATGTAAACTTCCATGCCTATATACTTAGT.

[0055] The recombinant plasmid BRG2-GFP was transformed into Agrobacterium GV3101, and the correct Agrobacterium was shaken to an OD600 of 0.8. The cells were collected by centrifugation and resuspended in MMA buffer and allowed to stand at room temperature for 2-4 hours. The leaves of H2B transgenic Nicotiana benthamiana were infiltrated. The leaf tissue was observed under a laser confocal microscope after 2 days. The results are shown in Figure 2. Figure 2 As shown, the green fluorescence of BRG2 colocalizes with the red fluorescence of the cell nucleus marker, indicating that BRG2 is localized in the cell nucleus.

[0056] Example 3: In vivo verification of the interaction between Nicotiana benthamiana BRG2 protein and CGMMV MP protein using bimolecular fluorescence complementation (BIFC)

[0057] Construction of vector for BRG2 and MP bimolecular fluorescence complementation

[0058] (1) Using the cDNA in Example 1 as a template, PCR amplified the BRG2 gene. The PCR product was cloned into the YC vector by homologous recombination and sequenced to verify the correctness, thereby obtaining the YC-BRG2 recombinant plasmid.

[0059] The primer sequences are:

[0060] Forward primer:

[0061] GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCTCTTCCTCATCACC;

[0062] Reverse primer:

[0063] GGGGACCACTTTGTACAAGAAAGCTGGGTCTATGTAAACTTCCATGCCTATATACTTAGT.

[0064] (2) Using the laboratory-stored PGBKT7-MP plasmid (a recombinant plasmid prepared by connecting the viral MP gene as the target fragment to the PGBKT7 vector) as a template, PCR amplify the viral MP gene. The MP PCR product is cloned into the YN vector by homologous recombination and sequenced to verify the correctness, thus obtaining the YN-MP recombinant plasmid.

[0065] The primer sequences for amplifying the viral MP gene are:

[0066] Forward primer:

[0067] GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGTCTCTAAGTAAGGTGTCAGTC;

[0068] Reverse primer:

[0069] GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGGTGTGATCGGATTGTAAGC.

[0070] Agrobacterium co-infiltration of Nicotiana benthamiana to verify the interaction between BRG2 and MP

[0071] The above-mentioned recombinant plasmids YC-BRG2 and YN-MP were transformed into Agrobacterium GV3101 respectively, and the verified correct Agrobacterium was shaken to OD600 of 1.0, the bacteria were collected by centrifugation, and resuspended with MMA buffer (10 mmol / L MgCl2, 10 mmol / LMES, 100 μmol / L Acetosyringone) and allowed to stand at room temperature for 2-4 hours. The bacterial solutions of YC-BRG2 and YN-MP were mixed in equal volumes, and YC-BRG2 and YN-empty, and YN-MP and YC-empty were used as controls to infiltrate Nicotiana benthamiana leaves. The leaf tissue was observed under a laser confocal microscope after 2 days. The results are shown in Figure 2. Figure 3 As shown, punctate fluorescence in the cytoplasm can be observed in N. benthamiana leaves co-infiltrated with YC-BRG2 and YN-MP, indicating that BRG2 and MP interact in the cytoplasm.

[0072] Example 4: Effect of transient silencing of BRG2 on CGMMV infection

[0073] Using YC-BRG2 in Example 2 as a template, PCR amplified the BRG2 fragment, and the PCR product was cloned into the TRV vector by homologous recombination. The correctness was verified by sequencing to obtain the TRV-BRG2 recombinant plasmid.

[0074] The primer sequences for amplifying the BRG2 fragment are:

[0075] Forward primer:

[0076] GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGTGATCGTTTGAGGCAAGC,

[0077] Reverse primer:

[0078] GGGGACCACTTTGTACAAGAAAGCTGGGTCCATCTACCTCACTGTCACCAC.

[0079] The qPCR primer sequences are:

[0080] BRG2 forward primer TAGCTCCAGGTCCAGCTGAT,

[0081] BRG2 reverse primer ACCCAAACGTCCATTATCCA;

[0082] Internal reference forward primer TTTCGGTCCTGATGATACTCCC,

[0083] Internal control reverse primer: CACAGAGCAAAGACTGGATTGA;

[0084] CGMMV forward primer ACAAGGTACCGCTTTCCAGA,

[0085] CGMMV reverse primer: TACGACAGACGAGGGTAACG.

[0086] The recombinant vector was transformed into Agrobacterium GV3101 by electroporation, and the cells were shaken to OD600 of 1.2. The cells were collected by centrifugation and resuspended in MMA buffer and allowed to stand at room temperature for 2-4 hours. After being mixed with equal amounts of TRVRNA1, the leaves of Nicotiana benthamiana were infiltrated. After 10 days, the leaves were collected and RNA was extracted using the same method as in Example 1. The extracted RNA was quantitatively reverse transcribed into cDNA, and the silencing efficiency was detected using real-time fluorescence quantitative PCR. The virus CGMMV was inoculated on Nicotiana benthamiana, and after 7 days, photos were taken and systemic leaves were sampled to extract total plant RNA using the same method as in Example 1. The extracted RNA was quantitatively reverse transcribed into cDNA, and the amount of virus accumulation was detected using real-time fluorescence quantitative PCR. The total protein of the systemic leaves was extracted, and the amount of virus accumulation was detected by western blot. The results are as follows: Figure 4 shown.

[0087] Depend on Figure 4 It can be seen that after BRG2 silencing, the accumulation of CGMMV at both RNA and protein levels was significantly downregulated, indicating that BRG may act as a recessive disease resistance factor.

[0088] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. The application of BRG2 gene in resistance to cucumber green mottle mosaic virus is characterized by: The nucleotide sequence of the BRG2 gene is shown in SEQ ID No. 1; the application is achieved by silencing the BRG2 gene in Nicotiana benthamiana; and the object of the application is Nicotiana benthamiana.

2. The use according to claim 1, characterized in that The steps are: using the cDNA of the plant to be controlled as a template, PCR amplifying the BRG2 fragment, cloning the PCR product into the TRV vector by homologous recombination to obtain the TRV-BRG2 recombinant plasmid, and then transferring it into the plant to be controlled to transiently silence the BRG2 gene, thereby obtaining a superior plant resistant to cucumber green mottle mosaic virus.

3. The use according to claim 2, characterized in that: The forward primer sequence for amplifying the BRG2 fragment is shown in SEQ ID No. 3, and the reverse primer sequence is shown in SEQ ID No. 4.

Images