A primer combination and method for detecting Robertsonian translocation of human embryo chromosomes

Abstract

The present invention discloses a primer combination and method for detecting Robert's translocation of chromosomes in human embryos, and the primer combination for detecting Robert's translocation of chromosomes in human embryos includes one or more of a primer combination for a SNP site of chromosome 13, a primer combination for a SNP site of chromosome 14, a primer combination for a SNP site of chromosome 15, a primer combination for a SNP site of chromosome 21, and a primer combination for a SNP site of chromosome 22. The method of the present invention is practical, simple, and highly versatile, and is combined with high-throughput sequencing technology, and has the advantages of low cost, high sensitivity, strong specificity, and high accuracy.

Description

Technical Field

[0001] The present invention relates to the field of gene detection, and in particular to a primer combination and a method for detecting Robertsonian translocation of human embryo chromosomes. Background Art

[0002] Robertsonian translocation (ROB) is a common chromosomal structural abnormality in humans. When two acrocentric chromosomes (chromosomes 13, 14, 15, 21, and 22) break at or near the centromere and fuse into one chromosome, the number of chromosomes decreases, the number of long arms remains unchanged, and the number of short arms decreases by two. This translocation is called Robertsonian translocation. In the general population, the incidence of Robertsonian translocation is 1 / 1000 (Therman E, Susman B, Denniston C. The nonrandom participation of human acrocentric chromosomes in Robertsonian translocations [J]. Annals of Human Genetics, 2012, 53 (1): 49-65). Carriers of Robertsonian translocation have only 45 chromosomes. They not only have a high incidence of miscarriage and infertility, but are also prone to giving birth to children with Down syndrome and unbalanced chromosomal translocation. In addition to recurrent miscarriage and embryonic arrest, clinical manifestations of Robertsonian translocation carriers include primary or secondary amenorrhea, infertility, poor development of secondary sexual characteristics, mental retardation, azoospermia, etc. (Zhao Xiao, Sun Xiaogang, Shen Guomin, et al. Analysis of karyotype distribution and fertility status of Robertsonian translocation carriers in the Chinese population [J]. Chinese Journal of Maternal and Child Health, 2011, 026 (011): 1672-1676). Theoretically, non-homologous Roberta translocation carriers have only a 1 / 3 chance of producing offspring with normal chromosomes (or) balanced translocations. Currently, 15 types of Roberta translocations have been discovered, including 10 non-homologous Roberta translocations and 5 homologous Roberta translocations. Homologous Roberta translocations cannot produce normal offspring (the embryos formed are monosomic or trisomic); and among non-homologous Roberta translocations, chromosomes 13 and 14 are the most common, accounting for more than 75%, followed by chromosomes 14 and 21. In the first meiotic division, the normal bivalent structure of the reproductive cells of Roberta translocation carriers will be replaced by trivalents (non-homologous Roberta translocations) or univalents (homologous Roberta translocations), thereby producing gametes of various types of different chromosome compositions. In theory, non-homologous Roberta translocations can produce 6 types of gametes, 1 normal gamete, 1 balanced translocation gamete, and the rest are unbalanced gametes; while homologous Roberta translocation carriers have almost no normal gamete formation.

[0003] Since no important genes are lost, the carriers of Roberta's translocation will not have a serious impact on individual development and have a normal phenotype. However, due to the loss of the short arm of the chromosome, the translocated chromosome in the germ cells of the Roberta's translocation carriers will pair with the corresponding two normal chromosomes to form a trivalent chromosome during the first meiotic division. This structure will lead to the appearance of three division modes: alternation, adjacent, and the uncommon 3:0. Only alternation can produce normal or balanced gametes, while the other two modes produce unbalanced gametes. Once the Roberta's translocation carriers marry healthy people, these unbalanced gametes, which account for the majority, may cause the translocation carriers to have difficulty in pregnancy or repeated miscarriages during pregnancy, and may even lead to the birth of children with congenital defects such as trisomy 21 and trisomy 13. There is currently no radical cure for Roberta's translocation, and more and more Roberta's translocation carriers are seeking IVF technology for preimplantation diagnosis of embryos.

[0004] The reported detection technologies for embryos of Robertsonian translocation carriers mainly include fluorescence in situ hybridization (FISH), array comparative genomic hybridization (aCGH) and NGS (Zhang Wenke, Xu Xiaofei, Li Min, et al. Advances in preimplantation genetic diagnosis of chromosome translocation carriers [J]. International Journal of Reproductive Health / Family Planning, 2015, 34(4):4). FISH technology was once one of the main genetic methods for PGD, used to screen for chromosome interarm inversion and translocation, and to determine whether there is mosaicism and chromosome abnormalities. Its limitation is mainly due to the limitation of the number of probes or the type of dyes. FISH technology cannot fully detect the structural abnormalities of 23 pairs of chromosomes. Polish scholar Dr. LUKASZUK used FISH technology and NGS to perform PGD on a couple whose male partner carried Robertsonian translocation-derived chromosomes. In January 2012, the embryos selected by FISH test and transplanted were aborted at the 10th gestational week. Summary of the invention

[0005] The purpose of the present invention is to provide a primer combination for detecting Robert's translocation of human embryo chromosomes, which has high specificity for Robert's translocation of human embryo chromosomes and can be effectively identified.

[0006] The technical solution of the present invention is: a primer combination for detecting Robertsonian translocation of human embryo chromosomes, including one or more of a chromosome 13 primer combination, a chromosome 14 primer combination, a chromosome 15 primer combination, a chromosome 21 primer combination and a chromosome 22 primer combination.

[0007] The primer combination for chromosome 13 includes at least one primer set in Table 1. The primer combination for chromosome 14 includes at least one primer set in Table 2. The primer combination for chromosome 15 includes at least one primer set in Table 3. The primer combination for chromosome 21 includes at least one primer set in Table 4. The primer combination for chromosome 22 includes at least one primer set in Table 5.

[0008] Table 1: Primers for chromosome 13

[0009]

[0010]

[0011]

[0012]

[0013]

[0014]

[0015]

[0016]

[0017]

[0018]

[0019] Table 2: Primers for chromosome 14

[0020]

[0021]

[0022]

[0023]

[0024]

[0025]

[0026]

[0027]

[0028]

[0029]

[0030] Table 3: Primer list for chromosome 15

[0031]

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040] Table 4: Chromosome 21 primer list

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050] Table 5: Primer list for chromosome 22

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059] The second object of the present invention is to provide the use of the primer combination for detecting Robert's translocation of chromosomes in human embryos as a diagnostic reagent for detecting Robert's translocation of chromosomes.

[0060] The third object of the present invention is to provide the use of the primer combination for detecting Robert's translocation of chromosomes in human embryos in the preparation of a kit for detecting Robert's translocation of chromosomes.

[0061] A fourth object of the present invention is to provide a method for detecting Robertsonian translocation of chromosomes in human embryos.

[0062] Specifically, the method for detecting Robertsonian translocation of human embryo chromosomes comprises the following steps:

[0063] (1) Obtain DNA samples from both parents and embryos;

[0064] (2) Screening high-frequency mutation SNP sites as markers based on the proximal centromere region of chromosomes;

[0065] (3) Detecting chromosome copy number in embryonic DNA samples;

[0066] (4) Determine the genotypes of the target sites of both parents and embryos based on the screened SNP sites;

[0067] (5) Analyze the haplotypes of both parents and embryos based on their genotypes and family relationships;

[0068] (6) Analyze the Robertsonian translocation of the embryo based on the chromosome copy number test results of the offspring, the karyotypes of the parents carrying the Robertsonian translocation, and the haplotypes of the parents and the embryo;

[0069] Wherein, in the step (4), the primer combination described in Tables 1-5 of any two chromosomes among chromosome 13, chromosome 14, chromosome 15, chromosome 21 and chromosome 22 is used to amplify the DNA of both parents and the embryo, and then a library is constructed and sequenced, and then the SNP sites where the chromosomes of both parents and the embryo are translocated are analyzed based on the sequencing results to determine the genotypes of the target sites of both parents and the embryo.

[0070] The SNP sites include the following sites or any combination thereof:

[0071] <h2 style=";text-align:left;direction:ltr">Chr13: rs9581127, rs4441121, rs9581196, rs7327770, rs9319224, rs4770840, rs4770842, rs11616593, rs1022917, rs7993967, rs504544, rs638773 ,rs912872, rs2774494, rs491873, rs1475325, rs577178, rs2611308, rs2611310, rs9512327, rs9319331, rs661471, rs1888312, rs1806658, rs798525 7,rs1330731,rs7325950,rs9509098,rs877098,rs9315400,rs945370,rs1537787,rs1537791,rs945372,rs9509107,rs9509109,rs6490533,rs732 1990, rs7324573, rs12322993, rs2313854, rs1335872, rs4335644, rs9509194, rs9509195, rs9509209, rs7323298, rs9315569, rs953957, rs2183207 rs4578496,rs9552175,rs4770027,rs9509211,rs3936015,rs79475914,r s12428869,rs115135024,rs9509247,rs9509441,rs572640,rs9316060,r s2585890,rs9509488,rs9509497,rs57961085,rs9552361,rs144534964,rs17278868,rs1327178,rs3783152,rs11616379,rs78730531,rs1199938, rs2761909, rs1886861, rs9550757, rs9316506, rs9509833, rs9506722, rs4770189, rs9580189, rs749170, rs7999069, rs9506746, rs9509921, rs733 3403,rs4769179,rs1570733,rs942231,rs9506758,rs12865369,rs95099 48,rs3129596,rs9316741,rs9552601,rs2320809,rs7994054,rs9510058,<h2 style=";text-align:left;direction:ltr">rs6490715, rs9317008, rs9550843, rs9510308, rs4770302, rs9510340, rs2114224, rs9552733, rs9506980, rs4770371, rs872271, rs9510597, rs3794371, rs9552867, rs518727, r s4770437, rs9578586, rs9552937, rs7489602, rs4143617, rs2274928, rs9510750, rs9580642, rs9510770, rs3794350, rs9553022, rs7993131, rs3794334, rs9318086, rs9580769<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0072] Chr14:rs28609794,rs28671467,rs2251143,rs2489770,rs1686549,rs1892239,rs937025,rs1630546,rs1686594,rs11621796,rs2792146,rs8021956,rs10142989,rs3850313,rs10141228,rs8010858,rs10873109,rs12587697,rs2775236,rs1959641,rs2775233,rs962479,rs2775234,rs979798,rs1959636,rs1958715,rs1959629,rs944399,rs1958718,rs1952820,rs12588910,rs4981728,rs12433363,rs4144240,rs2210191,rs17277088,rs8005245,rs9323534,rs2039235,rs17097307,rs10147184,rs1958698,rs10141836,rs8021846,rs4981088,rs1953555,rs11624675,rs8014956,rs8003958,rs1953552,rs1760904,rs1760903,rs1713423,rs6575809,rs7154662,rs4982086,rs7150924,rs938881,rs2275007,rs1760944,rs1130409,rs12147458,rs7149433,rs4981223,rs1009310,rs28460579,rs4981259,rs12372906,rs891299,rs12587456,rs1010461,rs8004382,rs1888562,rs8003578,rs6571363,rs8010867,rs75545359,rs6571394,rs11156743,rs11156753,rs10138807,rs1243459,rs12432962,rs943991,rs1952151,rs1958395,rs7149011,rs11629332,rs12432043,rs7154575,rs3736824,rs11157019,rs926027,rs12590415,rs8017132,rs1569287,rs7160973,<h2 style=";text-align:left;direction:ltr">rs2075477,rs2075478,rs4982495,rs12879132,rs12432727,rs28583314,rs8007442,rs7157624, rs8022682,rs3827932,rs7147975,rs12431534,rs4982588,rs10047934,rs8007403,rs2293732,rs 227866, rs226998, rs1263639, rs1263640, rs5742803, rs8005354, rs970348, rs4982648, rs7151103, rs12433985, rs8019656, rs2073345, rs743257, rs3811182, rs4982727, rs77828441, rs8003631<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0073] Chr15:rs71464574,rs7179358,rs4932079,rs4038410,rs60615788,rs3817032,rs1818080,rs28657025,rs11857633,rs6422230,rs6600022,rs7496540,rs6600034,rs6600041,rs75255127,rs12442259,rs12441699,rs7496888,rs12437683,rs11248795,rs12916204,rs1814945,rs6600085,rs9635445,rs1908936,rs56401292,rs4778566,rs12592629,rs3812924,rs7181789,rs34324428,rs7170784,rs17137384,rs6606817,rs11263678,rs999842,rs1545060,rs67278742,rs11638659,rs7182936,rs7167687,rs57848577,rs4778298,rs59413773,rs45464395,rs1109036,rs2346695,rs17137226,rs76194208,rs61388954,rs2044372,rs11853131,rs12439364,rs8042352,rs1562203,rs12900257,rs3890107,rs4257175,rs11857798,rs4778536,rs12903906,rs4778558,rs12439354,rs12373002,rs28544508,rs11639077,rs6576483,rs4480754,rs850817,rs850813,rs850812,rs699329,rs699330,rs12914458,rs878247,rs67664694,rs1722802,rs61999926,rs1524845,rs12440861,rs1903251,rs11636636,rs8037816,rs12902723,rs35174852,rs7172367,rs2017497,rs11635083,rs2061505,rs12908063,rs67663858,rs12916148,rs2085738,rs2169118,rs898368,rs1380547,<h2 style=";text-align:left;direction:ltr">rs11633562, rs17759506, rs17117862, rs4778358, rs12437807, rs12914082, rs17760092, rs8033044, rs7164093, rs980634, rs17760249, rs1903247, rs4778266, rs12905098<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0074] Chr21:rs1295228677,rs2775054,rs13050604,rs7278737,rs13048561,rs926880,rs447420,rs454215,rs2822526,rs4816274,rs2822529,rs2822537,rs2254297,rs980268,rs2822582,rs2822587,rs2142242,rs2822618,rs2822625,rs13050350,rs2822647,rs2142239,rs1882884,rs2822657,rs2822659,rs11088040,rs6516781,rs3761320,rs2822716,rs760345,rs9636587,rs466541,rs461853,rs1000728,rs2822809,rs439328,rs1037807,rs28431355,rs461309,rs466557,rs9983503,rs2822858,rs2822860,rs2822861,rs8127644,rs8134250,rs62218098,rs2822908,rs2822909,rs4817370,rs964035,rs2822975,rs2256417,rs2039239,rs975336,rs2823054,rs2403877,rs1556286,rs2823056,rs2823061,rs9978683,rs7282412,rs2823066,rs2256038,rs9974193,rs7279893,rs1014526,rs965098,rs2823141,rs2823158,rs2823165,rs2823177,rs2823245,rs2205532,rs2205533,rs2823252,rs427761,rs1786007,rs9305765,rs11088585,rs11911959,rs8126683,rs9979472,rs2823795,rs1375625,rs9636653,rs7275493,rs7276173,rs2823981,rs2150381,rs62221673,rs2823989,rs2823990,rs1475860,rs2178914,rs2824157,rs1014604,rs11088604,rs1319427,rs56260038,rs969905,rs11700487,rs4818324,rs4143391,rs6517737,rs2824246,rs8133027,rs182174,rs202873,rs1999288,rs208898,rs11702664,rs2824292,rs2251967,rs764657,rs2846881,rs2249100,rs2249449,rs2250305,rs2824376,rs2824397;,

[0075] <h2 style=";text-align:left;direction:ltr">Chr22:rs1981533,rs174289,rs7284169,rs174345,rs174348,rs174371, rs5992838,rs5992841,rs369081,rs436590,rs448184,rs390745,rs43763 3,rs399757,rs2111546,rs1003361,rs2016042,rs5992884,rs1867353,r s5746489,rs3747031,rs3213927,rs431071,rs439712,rs1077543,rs4486 80,rs5747948,rs11089247,rs9618453,rs2073775,rs6518515,rs2074003,rs2238739,rs2238743,rs2238745,rs5993488,rs1557844,rs2238752,r s2238755,rs2800958,rs2800970,rs2189491,rs2800981,rs807759,rs22 40110,rs5747997,rs712959,rs5746671,rs698422,rs11704250,rs756652 ,rs2283652, rs5748219, rs5993647, rs2073758, rs5748232, rs5993650, rs2073759, rs2073761, rs885985, rs5993709, rs1476445, rs5748391, rs747 226, rs6518580, rs4819519, rs737869, rs713675, rs2073762, rs3087869, rs5746849, rs740603, rs165849, rs1990249, rs5761392, rs1005640, rs103 5239,rs8137132,rs62219029,rs165630,rs2269830,rs2269831,rs16584 6,rs2329483,rs2329583,rs165764,rs165730,rs165680,rs165862,rs467 5,rs2236643,rs6928,rs13943,rs743409,rs5999550,rs9607287,rs4821 402,rs4821629,rs2213141,rs762471,rs5756751,rs1894250,rs5750601,rs2073454, rs1543779, rs5757568, rs5757569. ,

[0076] The SNP sites include at least one SNP site on each chromosome, and most preferably, all of the above SNP sites.

[0077] In the steps (3) and (4), high-throughput sequencing methods are selected independently. The high-throughput sequencing platform is Ion Torrent.

[0078] Compared with the prior art, the present invention has the following beneficial effects:

[0079] 1. In the case of a proband with a deletion, the results of the embryo are directly analyzed as the proband (the analysis of the deletion-specific interval can directly determine the phenotype of the embryo); the direct determination results of the embryo can be used as a verification of the linkage analysis results.

[0080] 2. Practicality: The present invention can solve the problem that current conventional methods cannot distinguish between embryos, fetuses or aborted tissues for Robertson translocation carrier detection.

[0081] 3. Simplicity: The present invention analyzes the chromosome translocation of different cells based on the results of cell chromosome copy number analysis and haplotype analysis. It does not require observation of the cells and can quickly distinguish between normal and translocation-carrying embryos.

[0082] 4. Universality: The present invention uses multiple SNPs for analysis and can be used for pre-embryo implantation diagnosis, fetal diagnosis or abortion tissue diagnosis of different spouses.

[0083] 5. High throughput: Based on high-throughput sequencing technology, the present invention can analyze chromosomal translocations. By adding different label sequences to each sample, a large number of samples can be analyzed at one time.

[0084] 6. Low cost: With the continuous development of sequencing technology and the continuous reduction of sequencing costs, the cost of chromosome translocation detection by the present invention is also decreasing.

[0085] 7. High sensitivity: It can be used to analyze 3 to 5 cells. Therefore, in addition to abortion tissue and trophoblast cells from the cervix, it is particularly suitable for testing before embryo transfer in IVF technology.

[0086] 8. The primer set is flexible to use: The present invention selects sites in the 2M region upstream and downstream of the Robertson translocation chromosome, and selects high-frequency mutation sites with an allele frequency greater than 0.20 to design primers. The obtained primers have high specificity, and the sequences are unique on the target chromosomes, and can specifically amplify the tightly linked single nucleotide polymorphism (SNP) sites of Robertson translocation chromosomes 13, 14, 15, 21, and 22. Different chromosome primer pools can be combined in pairs at will, and the combined primer pools do not affect the PCR reaction system. These primers have the same annealing temperature in position-specific oligonucleotides and can perform multiple reactions; and after amplification, high-throughput sequencing analysis can be used to determine whether the embryo carries a Robertson translocation-derived chromosome through SNP linkage analysis.

[0087] 9. Accuracy: Based on the changes in the copy number of the translocated chromosome and the samples carrying the corresponding chromosomes, the derived chromosome haplotypes of each of the translocated chromosomes can be inferred and then mutually verified, which is more accurate. BRIEF DESCRIPTION OF THE DRAWINGS

[0088] Figure 1 It is the result of chromosome 13 monosomy.

[0089] Figure 2 It is the result of chromosome 13 monosomy.

[0090] Figure 3 It is the result of chromosome 14 monosomy.

[0091] Figure 4 It is the result of chromosome 14 monosomy.

[0092] Figure 5 is a flow chart of the method of the present invention.

[0093] Figure 6 This is a diagram of chromosome analysis of embryo translocation according to the method of the present invention. DETAILED DESCRIPTION

[0094] The specific embodiments of the present application are described in more detail below. These embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0095] 1. Whole genome amplification to obtain embryonic DNA samples: 12 embryo biopsy samples of the family in this example were obtained, and the blastocyst stage trophoblast cells cultured in vitro for 3-6 days were used. The embryonic cell samples were subjected to whole genome amplification of 12 embryo samples according to the standard operating procedures of the Fapon single Cell geneme-Ampli Kit (manufacturer: Fapon; item number: NK023) to obtain embryonic sample DNA. The genome after cell lysis is randomly combined and extended with special random primers. These primers have a special universal sequence at the end, which can make the tail end of the amplicon complementary and self-circular, preventing excessive DNA copying. The amplified product cannot be used as a new template, thereby preventing the exponential amplification after DNA replication to a large extent, and increasing the uniformity of whole genome amplification. The pre-amplified product is exponentially amplified with a pair of primers to increase the yield of the amplified product.

[0096] The DNA of the obtained embryo samples was measured by Qubit 4.0 concentration using the dsDNA HS Assay Kit (manufacturer: Yisheng Biological; catalog number: 12642ES76), and the detection was performed according to the operating steps in the kit manual.

[0097] 2. Detection of chromosome copy number variation (CNV) in embryonic DNA samples by high-throughput sequencing

[0098] The library construction kit used in this step is Fapon Two-Step Library Prep Kit for IonTorrent (manufacturer: Fapon; catalog number: NK012).

[0099] 1) End-blunting: Add primers that can bind to sticky ends to the DNA fragments of the embryo sample obtained, mix with end-blunting reagent and incubate to obtain a sample with blunt ends.

[0100] The end-filling reaction system is a 50 μL system, and the components of the reaction system are as follows:

[0101]

[0102] The PCR reaction conditions were as follows: 20°C for 30 min; 70°C for 10 min, and maintained at 4°C.

[0103] 2) Adapter ligation: The DNA fragment obtained in step 1) is mixed with the P1 adapter, the specific adapter (A), and the adapter ligation reaction reagent to carry out a ligation reaction to obtain a DNA fragment with a recognizable adapter.

[0104] The P1 connector used in this step is:

[0105] CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT

[0106] ATCACCGACTGCCCATAGAGAGGAAAGCGGAGCGTAGTGG-sTsT.

[0107] The specific linker (A) used in this step is 96 Barcode x consisting of the following forward and reverse sequences. The specific sequence represented by Barcode x is as follows:

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116] The linker connection reaction system is a 100 μL system, and the components of the reaction system are specifically:

[0117]

[0118] The reaction conditions of the adapter ligation PCR were as follows: 20°C for 15 min; maintained at 4°C.

[0119] 3) Magnetic bead purification: The DNA fragments obtained in step 2) are purified by magnetic beads to remove excess small fragments, adapter dimers, excess primers, etc., to obtain purified DNA fragments.

[0120] This step uses DNAClean Beads Kit (manufacturer: Yisheng Bio; catalog number: 12601ES56), sample: magnetic beads = 1:0.9; obtain 25 μL of adapter-connected library fragments.

[0121] 4) Exponential amplification: Add the DNA fragment obtained in step 3) to the library amplification primer and library amplification reaction reagent for PCR amplification to obtain DNA fragments after amplifying the target fragment. These DNA fragments are purified using magnetic beads to obtain a DNA library of the target fragment.

[0122] PCR amplification of library fragments

[0123] The primer sequences for amplifying this Chinese library are as follows:

[0124] Primer-1: CCACTACGCCTCCGCTTTCCTCTCTATG;

[0125] Primer-2: CCATCTCATCCCTGCGTGTC.

[0126] The amplification reaction system is a 50 μL system, and the components of the reaction system are specifically:

[0127]

[0128] The PCR amplification reaction conditions were as follows: 72°C for 10 min; 98°C for 45 s, (98°C for 20 s, 65°C for 30 s, 72°C for 30 s) for 6 cycles; 72°C for 5 min; and hold at 4°C.

[0129] b Purification of amplified products

[0130] DNAClean Beads Kit (manufacturer: Yisheng Biotechnology; catalog number: 12601ES56) was used, with sample: magnetic beads = 1:1; 25 μL of library fragments that were exponentially amplified after adapter ligation were obtained.

[0131] The obtained DNA library was measured for concentration using a 1×dsDNA HS Assay Kit (manufacturer: Yisheng Biotechnology; catalog number: 12642ES76), and the detection was performed according to the operating procedures in the kit manual.

[0132] 5) Library quality control: The DNA library obtained in step 4) was tested for library concentration using the Qubit 4.0 quantitative instrument.

[0133] The library products were homogenized and mixed to 100 pM.

[0134] a) Convert ng / ul concentration to nM concentration, as shown in the figure

[0135]

[0136] b) Sampling is performed according to the following formula

[0137] Volume ofsamples=V(f)*C(f) / #*C(i)

[0138] Note: Among them,

[0139] V(f): final volume of sample after mixing;

[0140] C(f): final concentration of all samples after mixing;

[0141] #: The number of all samples in Mix;

[0142] C(i): initial concentration of each sample (nM);

[0143] Finally, the final volume was made up with EB.

[0144] Template preparation and template enrichment were performed according to the standard operating instructions of the Ion P1 Hi-Q OT2200 kit (manufacturer: Life Technologies; catalog number A26434).

[0145] 6) CNV-seq: The DNA library obtained in step 5) is used to perform low-depth whole-genome sequencing on the sample DNA based on the Ion Torrent sequencing platform. A benchmark database is constructed using known normal samples, and the sequencing results are compared with the human reference genome base sequence. Bioinformatics analysis is performed to discover CNVs in the tested samples.

[0146] This step was performed according to the standard operating instructions of the Ion P1 Hi-Q Sequencing 200 Kit (manufacturer: Life Technologies; catalog number A26772).

[0147] 7) Data analysis: Use known normal samples to build a benchmark database, compare the sequencing results with the human reference genome base sequence, and use bioinformatics analysis to discover CNVs present in the tested samples.

[0148] 8) The CNV analysis results of the family in this example are shown in Table 7.

[0149] Bioinformatics methods include the following:

[0150] ① Off-machine data analysis method: The prepared sequencing library system was subjected to high-throughput sequencing in the Ion Torrent Proton platform. After sequencing, the Torrent_Server_5.0_VM software was used to pre-process the generated raw sequencing off-machine data to remove the adapter sequence in the off-machine data. The processed sequencing data was aligned to the GRCh37 (hg19) human reference genome using the Tmap alignment tool.

[0151] ② Bioinformatics analysis method: The pre-processed sequencing data were genotyped using the "CoverageAnalysis" and "Variant Caller" plug-ins in the Torrent Suite (v5.4.0) analysis kit to analyze the coverage depth and genotype of the single nucleotide polymorphism (SNP) of each gene locus in the target regions chr13, chr14, chr15, chr21, and chr22. The haplotype was constructed using the position and genotype of the parents and priors and the closely linked SNP chromosomes. The constructed haplotype was used to determine whether the embryo carried abnormal chromosomes.

[0152] ③IonAmpliSeq targeted region copy number analysis method: Use known normal samples to build a benchmark database, calculate the relative sequence value (RC) of chromosomes chr13, chr14, chr15, chr21 and chr22 of each sample, and use the average value of different samples to determine the range of reference values ​​through statistical analysis. Next, use the reference value to determine the deletion of each sample.

[0153] ④ Based on the SNP loci, determine the genotypes of the target loci of both parents and offspring: select SNP loci that are different from those of the parents, and then determine whether their offspring carry Robertsonian translocation-derived chromosomes.

[0154] 5. Based on the SNP sites in step 4, determine the genotypes of the target sites of the parents and offspring, and then determine whether their offspring carry Robertsonian translocation-derived chromosomes to obtain the haplotypes of both parents and the embryo.

[0155] 6. Analyze the embryonic chromosome Robertson translocation based on the embryonic chromosome copy number variation (CNV) test results, the karyotype of the parents carrying the Robertson translocation, and the haplotype of the parents and the embryo. The SNP sites in step 4 are selected from the following combinations:

[0156]

[0157]

[0158]

[0159]

[0160] II. Main Experimental Steps of 12 Cases of Embryo Genetic Diagnosis

[0161] (1) Whole blood genomic DNA extraction

[0162] Samples from two parents and one daughter were obtained. The samples from the couple and the daughter were obtained from peripheral blood samples. The samples were extracted using the MagPure Fast BloodDNA LQ Kit (manufacturer: Meiji Biotechnology, catalog number: MD5111-03) according to the kit instructions. The concentration of the obtained sample DNA was determined by Qubit 4.0.

[0163] The concentration of DNA samples was measured using a dsDNA HS Assay Kit (manufacturer: Yisheng Biotechnology; catalog number: 12642ES76), and the test was performed according to the operating procedures in the kit manual.

[0164] (2) Multiplex PCR amplification

[0165] Primers were synthesized using the primer tables for chromosome 13 and chromosome 14 in Tables 1 and 2, and the 5 embryo samples with non-chimeric results, namely CML-07, CML-08, CML-09, CML-11, and CML-12, were tested in the next step according to the CNV results in step 2 of step 6) of the above step 1, namely Table 7. The 5 embryos and 3 peripheral blood products after quantification were added with reagents for multiplex PCR amplification according to the multiplex amplification system (manufacturer: Fapon; item number: MDT131) according to the following system:

[0166] Reaction conditions:

[0167]

[0168] Quality inspection of multiple amplification products: Take 1.5 μL of the amplification products for electrophoresis quality inspection, agarose gel concentration (2%), to confirm that the target fragments were successfully amplified.

[0169] Purification of amplification products: Magnetic beads were used to purify amplification products. In this step, DNA Clean Beads Kit (manufacturer: Yisheng Biotechnology; catalog number: 12601ES56) was used, supplemented with 42 μL of nuclease-free water, sample: magnetic beads = 1:1.2; 20 μL of multiple products were obtained.

[0170] The concentration of the purified PCR product was determined using Qubit4.0 and the dsDNA HS Assay Kit (manufacturer: Yisheng Biotechnology; catalog number: 12642ES76) was used for concentration determination, and the detection was performed according to the operating procedures in the kit instructions.

[0171] (3) Library construction

[0172] The library construction kit used in this step is Fapon Two-Step Library Prep Kit for IonTorrent (Manufacturer: Fapon; Catalog Number: NK012), and its steps are consistent with steps 2-3 in step 1.

[0173] (4) Template preparation

[0174] The library products were homogenized and mixed to 100 pM.

[0175] 1) Convert ng / ul concentration to nM concentration, as shown in the figure

[0176]

[0177] 2) Sampling is performed according to the following formula

[0178] Volume ofsamples=V(f)*C(f) / #*C(i)

[0179] Note: Among them,

[0180] V(f): final volume of sample after mixing;

[0181] C(f): final concentration of all samples after mixing;

[0182] #: The number of all samples in Mix;

[0183] C(i): initial concentration of each sample (nM);

[0184] Finally, the final volume was made up with EB.

[0185] Template preparation and template enrichment were performed according to the standard operating instructions of the Ion P1 Hi-Q OT2200 kit (manufacturer: Life Technologies; catalog number A26434).

[0186] (5) High-throughput sequencing: The DNA library obtained in step (4) is subjected to high-throughput sequencing based on the Ion Torrent sequencing platform to obtain sequencing results.

[0187] Sequencing was performed according to the standard operating instructions of the Ion P1 Hi-Q Sequencing 200 Kit (manufacturer: Life Technologies; catalog number A26772).

[0188] (6) Data analysis

[0189] A benchmark database was constructed using known normal samples, the relative sequence values ​​(RC) of chromosomes 13 and 14 were calculated for each sample, and the haplotype results of CMLNE were used to determine the chromosome monosomy of both parents.

[0190] (7) Haplotype analysis

[0191] (1) Sample test results are shown in Table 6.

[0192] (2) The results of CNV analysis are shown in Table 7.

[0193] (3) The results of chromosome 13 haplotype are shown in Figure 1 , Figure 2 .

[0194] (4) The results of chromosome 14 haplotype are shown in Figure 3 , Figure 4 .

[0195] (5) The results of chromosome 13 haplotype analysis are shown in Table 8.

[0196] (6) The results of chromosome 14 haplotype analysis are shown in Table 9.

[0197] Table 6 Sample test results show

[0198]

[0199] Table 7 CNV analysis results show

[0200]

[0201]

[0202] Table 8 Results of chromosome 13 haplotype analysis

[0203]

[0204] Table 9 Results of chromosome 14 haplotype analysis

[0205]

Claims

1. A primer combination for detecting Robertsonian translocation of chromosomes in human embryos, comprising a primer combination for a SNP site on chromosome 13, a primer combination for a SNP site on chromosome 14, a primer combination for a SNP site on chromosome 15, a primer combination for a SNP site on chromosome 21, and a primer combination for a SNP site on chromosome 22; wherein the primer combination comprises: (1) The primer combination for the SNP site of chromosome 13 is the following primer set: a forward primer sequence of SEQ ID NO: 2n-1, a reverse primer sequence of SEQ ID NO: 2n, where n is a natural number selected from 1-129; (2) The primer combination for the SNP site of chromosome 14 is the following primer set: a forward primer sequence of SEQ ID NO: 2n-1, a reverse primer sequence of SEQ ID NO: 2n, where n is a natural number selected from 130-259; (3) The primer combination for the SNP site of chromosome 15 is the following primer set: forward primer sequence SEQ ID NO: 2n-1, reverse primer sequence SEQ ID NO: 2n, where n is a natural number selected from 260-369; (4) The primer combination for the SNP site of chromosome 21 is the following primer set: a forward primer sequence of SEQ ID NO: 2n-1, a reverse primer sequence of SEQ ID NO: 2n, where n is a natural number selected from 370-490; (5) The primer combination for the SNP site of chromosome 22 is the following primer set: a forward primer sequence of SEQ ID NO: 2n-1, a reverse primer sequence of SEQ ID NO: 2n, where n is a natural number selected from 491-597; The SNP sites include the following sites: <h2 style=";text-align:left;direction:ltr">Chr13: rs9581127, rs4441121, rs9581196, rs7327770, rs9319224, rs4770840, rs4770842, rs11616593, rs1022917, rs7993967, rs504544, rs638773 ,rs912872, rs2774494, rs491873, rs1475325, rs577178, rs2611308, rs2611310, rs9512327, rs9319331, rs661471, rs1888312, rs1806658, rs798525 7,rs1330731,rs7325950,rs9509098,rs877098,rs9315400,rs945370,rs1537787,rs1537791,rs945372,rs9509107,rs9509109,rs6490533,rs732 1990, rs7324573, rs12322993, rs2313854, rs1335872, rs4335644, rs9509194, rs9509195, rs9509209, rs7323298, rs9315569, rs953957, rs2183207 rs4578496,rs9552175,rs4770027,rs9509211,rs3936015,rs79475914,r s12428869,rs115135024,rs9509247,rs9509441,rs572640,rs9316060,r s2585890,rs9509488,rs9509497,rs57961085,rs9552361,rs144534964,rs17278868,rs1327178,rs3783152,rs11616379,rs78730531,rs1199938, rs2761909, rs1886861, rs9550757, rs9316506, rs9509833, rs9506722, rs4770189, rs9580189, rs749170, rs7999069, rs9506746, rs9509921, rs733 3403,rs4769179,rs1570733,rs942231,rs9506758,rs12865369,rs95099 48,rs3129596,rs9316741,rs9552601,rs2320809,rs7994054,rs9510058,<h2 style=";text-align:left;direction:ltr">rs6490715, rs9317008, rs9550843, rs9510308, rs4770302, rs9510340, rs2114224, rs9552733, rs9506980, rs4770371, rs872271, rs9510597, rs3794371, rs9552867, rs518727, r s4770437, rs9578586, rs9552937, rs7489602, rs4143617, rs2274928, rs9510750, rs9580642, rs9510770, rs3794350, rs9553022, rs7993131, rs3794334, rs9318086, rs9580769 Chr14:rs28609794,rs28671467,rs2251143,rs2489770,rs1686549,rs1892239,rs937025,rs1630546,rs1686594,rs11621796,rs2792146,rs8021956,rs10142989,rs3850313,rs10141228,rs8010858,rs10873109,rs12587697,rs2775236,rs1959641,rs2775233,rs962479,rs2775234,rs979798,rs1959636,rs1958715,rs1959629,rs944399,rs1958718,rs1952820,rs12588910,rs4981728,rs12433363,rs4144240,rs2210191,rs17277088,rs8005245,rs9323534,rs2039235,rs17097307,rs10147184,rs1958698,rs10141836,rs8021846,rs4981088,rs1953555,rs11624675,rs8014956,rs8003958,rs1953552,rs1760904,rs1760903,rs1713423,rs6575809,rs7154662,rs4982086,rs7150924,rs938881,rs2275007,rs1760944,rs1130409,rs12147458,rs7149433,rs4981223,rs1009310,rs28460579,rs4981259,rs12372906,rs891299,rs12587456,rs1010461,rs8004382,rs1888562,rs8003578,rs6571363,rs8010867,rs75545359,rs6571394,rs11156743,rs11156753,rs10138807,rs1243459,rs12432962,rs943991,rs1952151,rs1958395,rs7149011,rs11629332,rs12432043,rs7154575,rs3736824,rs11157019,rs926027,rs12590415,rs8017132,rs1569287,rs7160973,<h2 style=";text-align:left;direction:ltr">rs2075477,rs2075478,rs4982495,rs12879132,rs12432727,rs28583314,rs8007442,rs7157624, rs8022682,rs3827932,rs7147975,rs12431534,rs4982588,rs10047934,rs8007403,rs2293732,rs 227866, rs226998, rs1263639, rs1263640, rs5742803, rs8005354, rs970348, rs4982648, rs7151103, rs12433985, rs8019656, rs2073345, rs743257, rs3811182, rs4982727, rs77828441, rs8003631 Chr15:rs71464574,rs7179358,rs4932079,rs4038410,rs60615788,rs3817032,rs1818080,rs28657025,rs11857633,rs6422230,rs6600022,rs7496540,rs6600034,rs6600041,rs75255127,rs12442259,rs12441699,rs7496888,rs12437683,rs11248795,rs12916204,rs1814945,rs6600085,rs9635445,rs1908936,rs56401292,rs4778566,rs12592629,rs3812924,rs7181789,rs34324428,rs7170784,rs17137384,rs6606817,rs11263678,rs999842,rs1545060,rs67278742,rs11638659,rs7182936,rs7167687,rs57848577,rs4778298,rs59413773,rs45464395,rs1109036,rs2346695,rs17137226,rs76194208,rs61388954,rs2044372,rs11853131,rs12439364,rs8042352,rs1562203,rs12900257,rs3890107,rs4257175,rs11857798,rs4778536,rs12903906,rs4778558,rs12439354,rs12373002,rs28544508,rs11639077,rs6576483,rs4480754,rs850817,rs850813,rs850812,rs699329,rs699330,rs12914458,rs878247,rs67664694,rs1722802,rs61999926,rs1524845,rs12440861,rs1903251,rs11636636,rs8037816,rs12902723,rs35174852,rs7172367,rs2017497,rs11635083,rs2061505,rs12908063,rs67663858,rs12916148,rs2085738,rs2169118,rs898368,rs1380547,<h2 style=";text-align:left;direction:ltr">rs11633562, rs17759506, rs17117862, rs4778358, rs12437807, rs12914082, rs17760092, rs8033044, rs7164093, rs980634, rs17760249, rs1903247, rs4778266, rs12905098 Chr21:rs1295228677,rs2775054,rs13050604,rs7278737,rs13048561,rs926880,rs447420,rs454215,rs2822526,rs4816274,rs2822529,rs2822537,rs2254297,rs980268,rs2822582,rs2822587,rs2142242,rs2822618,rs2822625,rs13050350,rs2822647,rs2142239,rs1882884,rs2822657,rs2822659,rs11088040,rs6516781,rs3761320,rs2822716,rs760345,rs9636587,rs466541,rs461853,rs1000728,rs2822809,rs439328,rs1037807,rs28431355,rs461309,rs466557,rs9983503,rs2822858,rs2822860,rs2822861,rs8127644,rs8134250,rs62218098,rs2822908,rs2822909,rs4817370,rs964035,rs2822975,rs2256417,rs2039239,rs975336,rs2823054,rs2403877,rs1556286,rs2823056,rs2823061,rs9978683,rs7282412,rs2823066,rs2256038,rs9974193,rs7279893,rs1014526,rs965098,rs2823141,rs2823158,rs2823165,rs2823177,rs2823245,rs2205532,rs2205533,rs2823252,rs427761,rs1786007,rs9305765,rs11088585,rs11911959,rs8126683,rs9979472,rs2823795,rs1375625,rs9636653,rs7275493,rs7276173,rs2823981,rs2150381,rs62221673,rs2823989,rs2823990,rs1475860,rs2178914,rs2824157,rs1014604,rs11088604,rs1319427,rs56260038,rs969905,rs11700487,rs4818324,rs4143391,rs6517737,rs2824246,rs8133027,rs182174,rs202873,rs1999288,rs208898,rs11702664,rs2824292,rs2251967,rs764657,rs2846881,rs2249100,rs2249449,rs2250305,rs2824376,rs2824397;, <h2 style=";text-align:left;direction:ltr">Chr22:rs1981533,rs174289,rs7284169,rs174345,rs174348,rs174371, rs5992838,rs5992841,rs369081,rs436590,rs448184,rs390745,rs43763 3,rs399757,rs2111546,rs1003361,rs2016042,rs5992884,rs1867353,r s5746489,rs3747031,rs3213927,rs431071,rs439712,rs1077543,rs4486 80,rs5747948,rs11089247,rs9618453,rs2073775,rs6518515,rs2074003,rs2238739,rs2238743,rs2238745,rs5993488,rs1557844,rs2238752,r s2238755,rs2800958,rs2800970,rs2189491,rs2800981,rs807759,rs22 40110,rs5747997,rs712959,rs5746671,rs698422,rs11704250,rs756652 ,rs2283652, rs5748219, rs5993647, rs2073758, rs5748232, rs5993650, rs2073759, rs2073761, rs885985, rs5993709, rs1476445, rs5748391, rs747 226, rs6518580, rs4819519, rs737869, rs713675, rs2073762, rs3087869, rs5746849, rs740603, rs165849, rs1990249, rs5761392, rs1005640, rs103 5239,rs8137132,rs62219029,rs165630,rs2269830,rs2269831,rs16584 6,rs2329483,rs2329583,rs165764,rs165730,rs165680,rs165862,rs467 5,rs2236643,rs6928,rs13943,rs743409,rs5999550,rs9607287,rs4821 402,rs4821629,rs2213141,rs762471,rs5756751,rs1894250,rs5750601,<h2 style=";text-align:left;direction:ltr">rs2073454, rs1543779, rs5757568, rs5757569.

2. Use of the primer combination for detecting Robertsonian translocation of human embryonic chromosomes according to claim 1 in preparing a diagnostic reagent for detecting Robertsonian translocation of chromosomes.

3. Use of the primer combination for detecting Robert's translocation of chromosomes in human embryos according to claim 1 in preparing a kit for detecting Robert's translocation of chromosomes.

Images