Use of a reagent for detecting a marker in the manufacture of a product for diagnosing and / or prognosing chronic obstructive pulmonary disease

By detecting the expression levels of NOSIP, AGMAT, and LINC01215, a diagnostic and predictive product for chronic obstructive pulmonary disease was developed, which solves the problem of misdiagnosis in the existing diagnostic criteria of FEV1/FVC < 70%, and enables early and accurate diagnosis and screening of high-risk groups.

CN116298310BActive Publication Date: 2026-06-16QINGDAO CARDIOVASCULAR DISEASE HOSPITAL CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
QINGDAO CARDIOVASCULAR DISEASE HOSPITAL CO LTD
Filing Date
2023-02-17
Publication Date
2026-06-16

AI Technical Summary

Technical Problem

The current technology uses FEV1/FVC < 70% as the diagnostic criterion for chronic obstructive pulmonary disease, which leads to a large number of clinical misdiagnoses and lacks accurate early diagnostic methods.

Method used

Using biomarker reagents, including NOSIP, AGMAT, and LINC01215, and employing methods such as protein immunoassay, nucleic acid sequencing, and nucleic acid hybridization, we will detect the expression levels of these biomarkers in samples to develop products and systems for the diagnosis and prediction of chronic obstructive pulmonary disease.

🎯Benefits of technology

It provides a reliable early diagnostic tool that can significantly distinguish between patients with chronic obstructive pulmonary disease and healthy individuals, guide prevention and screening for high-risk groups, and reduce the misdiagnosis rate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116298310B_ABST
    Figure CN116298310B_ABST
Patent Text Reader

Abstract

The application provides application of a reagent for detecting a marker in preparation of a product for diagnosing and / or predicting chronic obstructive pulmonary disease. The marker of the application is any one or more of NOSIP, AGMAT and LINC01215. It is found for the first time that NOSIP, AGMAT and / or LINC01215 are significantly differentially expressed between blood samples of patients with chronic obstructive pulmonary disease and normal persons. Whether NOSIP, AGMAT and / or LINC01215 are differentially expressed in blood of a subject can be detected as a method for early diagnosis of chronic obstructive pulmonary disease. Accordingly, tools and products for early diagnosis of chronic obstructive pulmonary disease can be developed, which are of great significance for guiding prevention and screening of high-risk groups of chronic obstructive pulmonary disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to the application of reagents for detecting biomarkers in the preparation of products for diagnosing and / or predicting chronic obstructive pulmonary disease. Background Technology

[0002] Chronic obstructive pulmonary disease (COPD) is a common, preventable, and treatable disease characterized by persistent airflow limitation. This airflow limitation progressively develops and is associated with an enhanced chronic inflammatory response of the airways and lungs to toxic particles or gases. COPD is one of the most common diseases in respiratory medicine, characterized by persistent chronic inflammation of the airways. This inflammation is not limited to the lungs; most patients experience a systemic inflammatory response, i.e., extrapulmonary effects. The most common systemic clinical manifestations include weight loss, skeletal muscle dysfunction, and malnutrition, as well as depression, with or without anxiety, and loss of appetite. COPD has a long course, characterized by persistent, incompletely reversible airflow limitation. Currently, the gold standard for diagnosing COPD is pulmonary function testing after bronchodilator inhalation, with FEV1 / pre < 80% and FEV1 / FVC < 70%. COPD can be divided into two stages based on disease progression: stable phase and acute exacerbation phase. With the increasing aging of the global population and the growing severity of global environmental problems, the prevalence and mortality rates of COPD (Chronic Obstructive Pulmonary Disease) are gradually rising. This not only poses a significant threat to global public health and severely impacts patients' ability to work and their quality of life, but also increases the financial burden of medical care on individuals and families. According to the World Health Organization, there are currently 600 million people with COPD worldwide, and an average of approximately 2.7 million people die from it each year. COPD has become the fourth leading cause of death worldwide, after cerebrovascular disease, heart disease, and acute pulmonary infections. The high incidence and mortality rates of chronic obstructive pulmonary disease have now attracted global attention.

[0003] COPD diagnosis relies on medical history, symptoms, signs, imaging, and pulmonary function tests. Patients typically have the following medical histories: ① long-term heavy smoking history; ② long-term exposure to harmful substances or gases; ③ familial COPD; ④ history of recurrent respiratory infections and acute exacerbations. Main clinical symptoms include: ① chronic cough, worse in the morning and less pronounced at night; ② often accompanied by sputum production, which is purulent when complicated by infection; ③ dyspnea is a hallmark symptom of COPD and a major cause of patient anxiety; ④ chest tightness and shortness of breath may occur, but are not specific; ⑤ extrapulmonary effects may be present. As the disease progresses, the following signs appear: ① barrel chest; ② decreased breath sounds; ③ hyperresonance on percussion. Chest X-ray: early stages may show no obvious changes, but as the disease progresses, increased lung field translucency, a flattened diaphragm, and an increased anteroposterior diameter of the thoracic cavity may appear on the chest X-ray, indicating excessive lung inflation; hilar vessels may appear as stumps, and bullae may sometimes be visible. Pulmonary function tests: Pulmonary function tests are performed after bronchodilator inhalation. A diagnosis can be made if FEV1 / pre < 80% and FEV1 / FVC < 70%. Both the GOLD (Global Initiative for Chronic Obstructive Lung Disease) guidelines and my country's "Guidelines for the Diagnosis and Treatment of Chronic Obstructive Lung Disease" use FEV1 / FVC < 70% as the diagnostic criterion for COPD. With the widespread promotion of this diagnostic model, it has been increasingly accepted by pulmonologists and pulmonary function testing technicians both domestically and internationally in recent years. However, increasing evidence suggests that using FEV1 / FVC < 70% as the diagnostic criterion for COPD can lead to a large number of clinical misdiagnoses, and this diagnostic criterion is currently facing unprecedented challenges. Therefore, developing a method for accurate early diagnosis of COPD is one of the urgent problems to be solved in this field. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides the application of a reagent for detecting biomarkers in the preparation of products for diagnosing and / or predicting chronic obstructive pulmonary disease. The technical solution of this invention is implemented as follows:

[0005] In one aspect, the present invention relates to the use of a reagent for detecting a biomarker in the preparation of products for diagnosing and / or predicting chronic obstructive pulmonary disease, said biomarker being any one or more of NOSIP, AGMAT, and LINC01215.

[0006] As a preferred embodiment, the reagents include those used to detect the expression levels of one or more of NOSIP, AGMAT, and LINC01215 in a sample using protein immunoassay, dye assay, nucleic acid sequencing, nucleic acid hybridization, digital imaging, chromatography, or mass spectrometry.

[0007] As a preferred embodiment, the reagent used to detect the expression levels of one or more of NOSIP, AGMAT, and LINC01215 in a sample using protein immunoassay includes an antibody; the antibody is a labeled antibody that is specific to one or more epitopes of NOSIP, AGMAT, and LINC01215.

[0008] The reagent used to detect the expression levels of one or more of NOSIP, AGMAT, and LINC01215 in a sample using dye technology includes a dye; the dye is a dye specific to one or more of NOSIP, AGMAT, and LINC01215.

[0009] The reagent used to detect the expression levels of one or more of NOSIP, AGMAT, and LINC01215 in a sample using nucleic acid sequencing technology includes primers; the primers are primers that specifically bind to one or more sequences of NOSIP, AGMAT, and LINC01215.

[0010] The reagent used to detect the expression levels of one or more of NOSIP, AGMAT, and LINC01215 in a sample using nucleic acid hybridization technology includes a probe; the probe is a labeled probe that is specifically complementary to one or more of the sequences of NOSIP, AGMAT, and LINC01215.

[0011] In another aspect, the present invention provides a product for diagnosing and / or predicting chronic obstructive pulmonary disease, the product comprising a detection kit including reagents for detecting the expression levels of one or more of NOSIP, AGMAT, and LINC01215 in a sample; the detection kit further comprising reagents for detecting an internal reference gene, the reagents for detecting the internal reference gene including primers and / or probes targeting the internal reference gene.

[0012] As a preferred embodiment, the detection kit further includes dNTPs and Mg. 2+ Ions, DNA polymerase, or containing dNTPs, Mg 2+ The PCR system of ions and DNA polymerase; the detection kit also includes bisulfite, bisulfite or hydrazine.

[0013] In a preferred embodiment, the product further includes a chip and a test strip, the test strip comprising a test strip carrier and oligonucleotides immobilized on the test strip carrier, the oligonucleotides being capable of detecting the expression levels of one or more of NOSIP, AGMAT, LINC01215 or functional fragments thereof.

[0014] In another aspect, the present invention relates to the application of a biomarker in constructing a diagnostic and / or predictive system for chronic obstructive pulmonary disease (COPD), wherein the biomarker is any one or more of NOSIP, AGMAT, and LINC01215; the system includes a detection module and an evaluation module; the detection module is used to detect the expression level of one or more of NOSIP, AGMAT, and LINC01215 in a subject sample; the evaluation module is used to compare the subject's detection value obtained by the detection module with the detection value of a normal sample or a normal reference value, and when the expression level of one or more of NOSIP, AGMAT, and LINC01215 is significantly lower than the detection value of a normal sample or a normal reference value, the subject is judged to be a patient with COPD or the subject is judged to have a high risk of having COPD.

[0015] In another aspect, the present invention relates to the use of a biomarker in screening drugs for the diagnosis and / or prediction of chronic obstructive pulmonary disease, said biomarker being any one or more of NOSIP, AGMAT, and LINC01215.

[0016] As a preferred embodiment, the method for screening drugs for diagnosis and / or prediction of chronic obstructive pulmonary disease includes the following steps: (1) adding the drug to be tested to a system expressing or containing one or more of NOSIP, AGMAT, and LINC01215; (2) detecting the expression level of one or more of NOSIP, AGMAT, and LINC01215 in the system; and (3) selecting drugs that can significantly increase the expression level of one or more of NOSIP, AGMAT, and LINC01215 as candidate drugs.

[0017] As a preferred embodiment, the test drug includes, but is not limited to: reagents, binding molecules, and small molecule compounds designed to promote the expression of one or more of NOSIP, AGMAT, and LINC01215 genes or their upstream or downstream genes; the system is selected from: cell system, subcellular system, solution system, tissue system, organ system, or animal system.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention is the first to discover that there are significant differential expressions of NOSIP, AGMAT and / or LINC01215 in blood samples of patients with chronic obstructive pulmonary disease and normal individuals. The detection of differential expression of NOSIP, AGMAT and / or LINC01215 in the blood of subjects can serve as a method for the early diagnosis of chronic obstructive pulmonary disease. Based on this, tools and products for the early diagnosis of chronic obstructive pulmonary disease can be developed, which is of great significance for guiding the prevention and screening of high-risk groups of chronic obstructive pulmonary disease. Attached Figure Description

[0019] Figure 1 A graph showing the differential expression of NOSIP between patients with chronic obstructive pulmonary disease (COPD) and healthy controls;

[0020] Figure 2 A graph showing the differential expression of AGMAT between patients with chronic obstructive pulmonary disease (COPD) and healthy controls;

[0021] Figure 3 The graph shows the results of differential expression of LINC01215 between patients with chronic obstructive pulmonary disease (COPD) and healthy controls.

[0022] Figure 4 The graph shows the diagnostic efficacy of NOSIP as a diagnostic marker for chronic obstructive pulmonary disease.

[0023] Figure 5 The graph shows the diagnostic efficacy of AGMAT as a diagnostic marker for chronic obstructive pulmonary disease.

[0024] Figure 6 The graph shows the diagnostic efficacy of LINC01215 as a diagnostic marker for chronic obstructive pulmonary disease.

[0025] Figure 7 The graph shows the differential expression of NOSIP, AGMAT, and LINC01215 between patients with chronic obstructive pulmonary disease and healthy controls. Figure A: NOSIP, Figure B: AGMAT, Figure C: LINC01215.

[0026] Figure 8 Volcano plots and heatmaps showing differentially expressed mRNAs in chronic obstructive pulmonary disease, where Figure A: Volcano plot, Figure B: Heatmap;

[0027] Figure 9 Volcano and Manhattan plots showing differentially methylated sites in chronic obstructive pulmonary disease, where A: volcano plot, B: Manhattan plot;

[0028] Figure 10 A statistical graph showing the results of hypermethylated and low-expression genes in chronic obstructive pulmonary disease;

[0029] Figure 11 A graph showing the GO enrichment analysis results of highly methylated, poorly expressed genes in chronic obstructive pulmonary disease;

[0030] Figure 12 A graph showing the results of KEGG enrichment analysis of hypermethylated and low-expression genes in chronic obstructive pulmonary disease;

[0031] Figure 13 A protein-protein interaction network diagram showing the hypermethylated, low-expression genes in chronic obstructive pulmonary disease. Detailed Implementation

[0032] The present invention will be further illustrated below with reference to specific embodiments. These embodiments are for illustrative purposes only and should not be construed as limiting the invention. Those skilled in the art will understand that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the invention. The scope of the invention is defined by the claims and their equivalents. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or according to the manufacturer's recommendations.

[0033] Unless otherwise defined, all technical terms in the context of this invention have the same meaning as understood by one of ordinary skill in the art. Furthermore, some terms are explained below.

[0034] As used in this article, the term "primer" refers to a 7-50 nucleic acid sequence that forms a base pair complementary to the template strand and serves as the starting point for template replication. Primers are usually synthesized, but naturally occurring nucleic acids can also be used. The primer sequence does not necessarily need to be identical to the template sequence, as long as it is sufficiently complementary to hybridize with the template. Additional features that do not alter the basic properties of the primer can be incorporated. Examples of such additional features include methylation, capping, substitution of more than one nucleic acid with a homologue, and modifications between nucleic acids, but are not limited to these.

[0035] As used herein, the term "probe" refers to a nucleic acid fragment, such as RNA or DNA, ranging from a few to hundreds of bases long, that can specifically bind to mRNA and whose presence can be determined by labeling. Probes can be prepared in the form of oligonucleotide probes, single-stranded DNA probes, double-stranded DNA probes, and RNA probes. In this invention, cervical cancer can be predicted by hybridization using the labeled polynucleotides and complementary probes of this invention, based on whether or not hybridization occurs. Appropriate selection of probes and hybridization conditions can be modified based on knowledge in the art.

[0036] As used herein, the term "antibody" refers to a substance that specifically binds to an antigen to induce an antigen-antibody reaction. For the purposes of this invention, an antibody refers to an antibody that specifically binds to the biomarkers (NOSIP, AGMAT, LINC01215) of this invention for the early diagnosis of chronic obstructive pulmonary disease. The antibodies of this invention include polyclonal antibodies, monoclonal antibodies, and recombinant antibodies. These antibodies can be readily prepared using techniques known in the art. For example, polyclonal antibodies can be produced according to methods known in the art, including injecting the aforementioned biomarker protein antigen into an animal and obtaining serum containing the antibody from blood collected from the animal. Such polyclonal antibodies can be prepared from any animal, such as a goat, rabbit, sheep, monkey, horse, pig, cattle, or dog. Furthermore, monoclonal antibodies can be prepared using hybridoma methods or phage antibody library techniques known in the art. Antibodies prepared by the above methods can be separated and purified using methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, and affinity chromatography. Moreover, the antibodies of this invention not only include the complete morphology having two full-length light chains and two full-length heavy chains, but also functional fragments of the antibody molecule. The functional fragment of an antibody molecule refers to a fragment that has at least antigen-binding function, including Fab, F(ab'), F(ab')2, and Fv, etc. Furthermore, the antibodies of this invention are commercially available.

[0037] As used herein, the terms “comprising,” “including,” “having,” “containing,” or “involving” are inclusive or open-ended and do not exclude other unlisted elements or method steps. The term “consisting of” is considered to be a preferred embodiment of the term “comprising.” If a group is defined herein as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists only of those embodiments.

[0038] As used herein, the term "sample" refers to a composition obtained from or derived from a subject (e.g., an individual of interest) containing cells and / or other molecular entities to be characterized and / or identified based on, for example, physical, biochemical, chemical, and / or physiological characteristics. For example, a sample refers to any sample derived from a subject of interest that is expected or known to contain cells and / or molecular entities to be characterized. Samples include, but are not limited to, tissue samples (e.g., tumor tissue samples), primary or cultured cells or cell lines, cell supernatants, cell lysates, platelets, serum, plasma, vitreous fluid, lymph, synovial fluid, follicular fluid, semen, amniotic fluid, milk, whole blood, blood-derived cells, urine, cerebrospinal fluid, saliva, sputum, tears, sweat, mucus, tumor lysates, tissue culture fluid, tissue extracts, homogenized tissue, tumor tissue, cell extracts, and combinations thereof. As a preferred embodiment, the sample is selected from a blood sample of the subject.

[0039] As used herein, the terms “expression level” or “expression quantity” refer to the level or amount of polynucleotide or amino acid products or proteins in a biological sample. “Expression” generally refers to the process by which information encoded by a gene is transformed into a structure that is present and functioning in the cell. Therefore, the “expression” of a marker used herein refers to transcription into a polynucleotide, translation into a protein, or even a post-translational modification of a protein. Fragments of transcribed polynucleotides, translated proteins, or post-translational modified proteins are also considered expressed, whether they originate from transcripts produced by alternative splicing or degraded transcripts, or from post-translational processing of proteins (e.g., by proteolysis). “Expressed genes” include those transcribed into polynucleotides (e.g., mRNA) and then translated into proteins, as well as those transcribed into RNA but not translated into proteins (e.g., transfer RNA and ribosomal RNA).

[0040] As used in this article, the term "AUC" or "AUC value" refers to the Area Under the Receiver Operating Characteristic (ROC) curve, a graphical representation of the performance of a binary classifier system as a function of its discrimination threshold. This curve is created by plotting the true positive rate against the false positive rate at various threshold settings. The true positive rate is also referred to as sensitivity. The false positive rate is calculated as 1 - specificity. Therefore, the ROC curve is a graphical representation of the true positive rate against the false positive rate (sensitivity vs. (1 - specificity)) over a range of cutoff values ​​and a way to select the optimal cutoff value for clinical use. Expressing accuracy as the Area Under the ROC Curve (AUC) provides a useful parameter for comparing test performance. An AUC close to 1 indicates that the test is highly sensitive and highly specific, while an AUC close to 0.5 indicates that the test is neither sensitive nor specific.

[0041] In specific embodiments of the present invention, all experiments were performed at least three times. Results were expressed as mean ± standard deviation. Statistical analysis was performed using SPSS software. Paired t-tests were used for comparisons between two groups, one-way ANOVA was used for comparisons of three or more groups, and LSD-t tests were used for multiple comparisons. A p-value < 0.05 was considered statistically significant.

[0042] To overcome the technical problem in this field that using FEV1 / FVC < 70% as the diagnostic criterion for COPD leads to a large number of clinical misdiagnoses, the inventors of this invention have for the first time identified biomarkers that can be used for accurate early diagnosis of chronic obstructive pulmonary disease. These biomarkers include NOSIP, AGMAT, and LINC01215, which can distinguish between patients with chronic obstructive pulmonary disease and healthy individuals with high diagnostic capability.

[0043] Therefore, in a first aspect of the invention, the use of a reagent for detecting the expression levels of one or more of NOSIP, AGMAT, and LINC01215 in the preparation of products for the early diagnosis and / or prediction of chronic obstructive pulmonary disease is provided.

[0044] The biomarkers NOSIP (Nitric oxide synthase interacting protein, Gene ID: 51070), AGMAT (Agmatinase, Gene ID: 79814), and LINC01215 (Long intergenic non-protein coding RNA1215, Ensembl: ENSG00000271856) include genes and their encoded proteins, as well as their homologs, mutations, and isotypes. This term encompasses full-length, unprocessed biomarkers, as well as any form of biomarker derived from cell-processed sources. The term also encompasses naturally occurring variants of the biomarker (e.g., splice variants or alleles). Gene IDs are available at https: / / www.ncbi.nlm.nih.gov / gene / .

[0045] In one implementation, at least one gene selected from NOSIP, AGMAT, and LINC01215 is compared to a reference level of the corresponding gene. This comparison enables the determination of whether an individual has chronic obstructive pulmonary disease (COPD) or the level of risk for COPD.

[0046] In a preferred embodiment, the reference level is determined by measuring the levels isolated from at least one subject who does not have chronic obstructive pulmonary disease (healthy subject) (e.g., isolated from at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 150, 200, 250, 300, 400, 500 or). The level was determined by at least one reference biological sample (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 150, 200, 250, 300, 400, 500, or 1000 reference biological samples) from 1000 healthy subjects without chronic obstructive pulmonary disease (COPD). The at least one subject without COPD can be considered a healthy subject relative to a patient with COPD.

[0047] In a preferred embodiment, the expression levels of NOSIP, AGMAT, and LINC01215 were significantly downregulated in patients with chronic obstructive pulmonary disease compared with normal controls (reference level).

[0048] In a preferred embodiment, the expression levels of NOSIP, AGMAT, and LINC01215 are detected to determine whether the subject has chronic obstructive pulmonary disease (COPD) or the level of risk of having COPD.

[0049] In this invention, the samples include, but are not limited to, tissue samples, blood samples (e.g., whole blood or blood components, such as blood cells / cell components, serum or plasma), urine samples, aqueous humor, or samples from other peripheral sources.

[0050] In a specific embodiment of the present invention, the sample is selected from blood from the subject.

[0051] The test kit for early diagnosis or prediction of chronic obstructive pulmonary disease provided in the second aspect of the invention may also contain materials desired from a commercial and user point of view, including buffers, reagents and / or diluents for determining the aforementioned levels.

[0052] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. The following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods not specifically described in the embodiments are generally performed under conventional conditions or as recommended by the manufacturer.

[0053] Example 1

[0054] Real-time PCR detection of gene expression in COPD samples

[0055] 1. Source of the study population

[0056] This invention retrospectively collected blood samples from 14 patients with chronic obstructive pulmonary disease (COPD) admitted to Qingdao Fuwai Cardiovascular Hospital as the experimental group. The sample information for the experimental group is shown in Table 1, with sample numbers 17-30. Blood samples were also collected from 16 healthy volunteers undergoing physical examinations during the same period as the control group, with sample numbers 1-16. The experimental procedures were explained to all participants and their families, and informed consent was obtained. The study also received approval from the organization's ethics committee.

[0057] The inclusion and exclusion criteria for chronic obstructive pulmonary disease are as follows:

[0058] Inclusion criteria: ① Patients in the study group were clinically diagnosed with chronic obstructive pulmonary disease, with recent continuous worsening of clinical symptoms, acute phase lasting <7 days, and complete medical records; ② Patients signed the informed consent form for this study.

[0059] Exclusion criteria: ① Patients with concurrent neoplastic diseases such as lung cancer, liver cancer, and colorectal cancer; ② Patients who used antibiotics in the month their blood sample was collected; ③ Patients with concurrent severe mental disorders such as schizophrenia; ④ Patients with concurrent other respiratory diseases such as bronchial asthma and pulmonary tuberculosis; ⑤ Patients with severe respiratory distress requiring mechanical ventilation.

[0060] Table 1. Sources of blood sample information for chronic obstructive pulmonary disease in the experimental group.

[0061] Sample Name Sample number Sample source 1 17 Sun** 2 18 king** 3 19 appoint** 4 20 Chu** 5 21 week** 6 22 king** 7 23 Yang** 8 24 untie** 9 25 business** 10 26 open** 11 27 ox** 12 28 open* 13 29 List** 14 30 Liu**

[0062] 2. Main reagents for the experiment

[0063] The main experimental reagents used in this embodiment are shown in Table 2.

[0064] Table 2 Main experimental reagents in this embodiment

[0065]

[0066] 3. Main experimental instruments

[0067] The main experimental instruments used in this embodiment are shown in Table 3.

[0068] Table 3 Main experimental instruments in this embodiment

[0069] Instrument Name Instrument Model factory centrifuge Centrifuge 5424R Eppendorf NanoVue Plus 28956057 BIOCHROM LTD Real-time PCR instrument ABI7300 Applied Biosystems

[0070] 4. Experimental Methods

[0071] (1) Primer design

[0072] Real-Time PCR primers for gene detection. The primers listed in Table 4 below were synthesized by BOMIDE.

[0073] Table 4. Primer sequence information for Real-Time PCR detection of genes.

[0074] Primer name Primer sequences (5' to 3') GAPDH-F (Internal Reference) GGAGCGAGATCCCTCCAAAAT(SEQ ID NO:1) GAPDH-R (Internal Reference) GGCTGTTGTCATACTTCTCATGG(SEQ ID NO:2) ACTB-F (Internal Reference) CATGTACGTTGCTATCCAGGC(SEQ ID NO:3) ACTB-R (Internal Reference) CTCCTTAATGTCACGCACGAT(SEQ ID NO:4) NOSIP-F GGGTCCTCCAAGTAAGGACAAG(SEQ ID NO:5) NOSIP-R GAGCTGTCTAGCGGTGTGAAGT(SEQ ID NO:6) AGMAT-F ACGACCTTGGATCCCTACAGA(SEQ ID NO:7) AGMAT-R AGCAATTTCAGGTGTCCCTGT(SEQ ID NO:8) LINC01215-F GGTTGTGAGAGGGGACCAAT(SEQ ID NO:9) LINC01215-R GGCAGGAGAATAGGGTCTGG(SEQ ID NO:10)

[0075] (2) Extract total RNA from samples

[0076] ① Add 0.75 mL of lysis buffer RLS to each 0.25 mL blood sample, and pipette the liquid sample several times to help lyse the cells in the sample. Repeat every 5-10 × 10⁻⁶ cycles. 6 Add at least 0.75 mL of lysis buffer RLS to each cell. The final volume ratio of lysis buffer RLS to liquid sample is always 3:1.

[0077] ② Add 0.75 mL of lysis buffer RLS to the EP tube, then add 0.25 mL of blood sample, shake vigorously for 30 seconds to mix, and incubate at 15-30℃ for 10 minutes to allow complete decomposition of ribosomes.

[0078] ③ Add 0.2 mL of chloroform to each 0.75 mL of lysis buffer RLS, shake vigorously for 15 s, and let stand at room temperature for 5 min.

[0079] ④ Centrifuge at 4℃ and 12000rpm for 10 minutes. The sample will separate into three layers: a lower organic phase, a middle layer, and an upper colorless aqueous phase. RNA is present in the upper aqueous phase. The volume of the aqueous phase layer is approximately 70% of the volume of the added RLS. Transfer the aqueous phase to a new tube for the next step.

[0080] ⑤ Add 1 volume of 70% ethanol (first check if anhydrous ethanol has been added), and mix by inverting (a precipitate may form at this point). Transfer the resulting solution and any precipitate together into the adsorption column RA (the adsorption column is fitted inside the collection tube).

[0081] ⑥ Centrifuge at 12000 rpm for 45 seconds, discard the waste liquid, and put the adsorption column back into the collection tube.

[0082] ⑦ Add 0.5 mL of protein removal solution RE, centrifuge at 12000 rpm for 45 s, and discard the waste liquid.

[0083] ⑧ Add 0.5 mL of rinsing buffer RW (first check if anhydrous ethanol has been added), centrifuge at 12000 rpm for 45 s, and discard the waste liquid.

[0084] ⑨ Add 0.5 mL of rinsing buffer RW, centrifuge at 12000 rpm for 45 s, and discard the waste liquid.

[0085] ⑩ Place the adsorption column RA back into the collection tube and centrifuge at 13000 rpm for 2 min to remove as much of the washing solution as possible, so as to avoid residual ethanol in the washing solution inhibiting the downstream reaction.

[0086] Remove the adsorption column RA and place it in an RNase-free centrifuge tube. Add 30-50 μL of RNase-free water (preheating in a 65-70°C water bath beforehand will improve the effect) to the center of the adsorption membrane, based on the expected RNA yield. Incubate at room temperature for 2 minutes, then centrifuge at 12000 rpm for 1 minute. If more RNA is needed, the resulting solution can be added back to the adsorption column and centrifuged for 1 minute, or an additional 30 μL of RNase-free water can be added and centrifuged for 1 minute. Combine the two eluents.

[0087] (3) Reverse transcription to synthesize mRNA and cDNA

[0088] mRNA reverse transcription was performed using the FastKing cDNA First-Strand Synthesis Kit (catalog number: KR116). First, genomic DNA was removed. In a test tube, 2.0 μL of 5×g DNA Buffer, 1 μg of Total RNA, and RNase-Free ddH2O were added to a final volume of 10 μL. The mixture was heated in a water bath at 42°C for 3 min. Then, 2.0 μL of 10×King RT Buffer, 1.0 μL of FastKing RT Enzyme Mix, 2.0 μL of FQ-RT Primer Mix, and 5.0 μL of RNase-Free ddH2O were added to the same test tube, bringing the total volume to 20 μL. The mixture was then heated in a water bath at 42°C for 15 min and then at 95°C for 3 min. For long-term storage of the synthesized cDNA, please store at -20°C or lower.

[0089] (4) Real-Time PCR Detection

[0090] ① Instruments and analytical methods

[0091] Using an ABI 7300 real-time PCR instrument, 2 -△△CT The method is used to perform relative quantitative analysis of the data.

[0092] ② Operation process

[0093] Reaction system: Amplification was performed using SuperRealPreMix Plus (SYBR Green) (catalog number: FP205), and the experimental procedures were performed according to the product instructions. The RealTime reaction system is shown in Table 5.

[0094] Table 5 Reaction System

[0095] reagents Usage 2×SuperReal PreMix Plus 10μL Upstream primer (10 μM) 0.6μL Downstream primer (10 μM) 0.6μL <![CDATA[50×ROX Reference Dye △ ]]> 2μL DNA template 2μL Sterile distilled water 4.8μL

[0096] Amplification program: 95℃ for 15 min, (95℃ for 10 sec, 55℃ for 30 sec, 72℃ for 32 sec) × 40 cycles, 95℃ for 15 sec, 60℃ for 60 sec, 95℃ for 15 sec).

[0097] Primer screening: After mixing the cDNA from each sample, the mixture was used as a template for 10-fold serial dilution. 2 μL of each diluted sample was used as a template for amplification with the target gene primer and the internal reference gene primer, respectively. Melting curve analysis was performed at 60-95℃. Primers were screened based on the principles of high amplification efficiency and single peak in the melting curve.

[0098] Real-Time PCR detection of samples: 2 μL of cDNA from each sample was diluted 3-10 times and used as template for amplification using primers for the target gene and internal reference gene, respectively (see Table 6). Melting curve analysis was performed at 60-95℃.

[0099] Table 6. Sample Real-Time PCR Detection Design

[0100] template Sample cDNA Sample cDNA Number of repeated detection channels 3 3 Primers Target gene primers Internal reference gene primers

[0101] Relative quantitative analysis of each sample: Based on the original Real-Time PCR test results, according to 2... -△△ct The relative quantitative calculation formula is as follows:

[0102]

[0103] The relative quantitative results of the target gene for each sample were calculated, that is, the difference in the mRNA transcription level of the target gene between each other sample and the control sample.

[0104] 5. Experimental Results

[0105] The results showed that, compared with healthy controls, patients with chronic obstructive pulmonary disease (COPD) exhibited significantly different levels of NOSIP, AGMAT, and LINC01215 in their blood (P<0.05). Specifically, NOSIP expression was significantly downregulated in the blood of COPD patients compared with healthy controls (see...). Figure 1AGMAT expression was significantly downregulated in the blood of patients with chronic obstructive pulmonary disease (see [link to relevant documentation]). Figure 2 LINC01215 expression was significantly downregulated in the blood of patients with chronic obstructive pulmonary disease (see [link to relevant documentation]). Figure 3 ).

[0106] Example 2

[0107] Analysis and validation of diagnostic efficacy

[0108] 1. Experimental Methods

[0109] ROC curves were plotted using pROC (version 1.15.0) in R to analyze the diagnostic efficacy (sensitivity, specificity, AUC) of each gene (NOSIP, AGMAT, LINC01215) in the chronic obstructive pulmonary disease (COPD) dataset (GSE94916, Control: COPD = 6:6, sample type: peripheral blood samples). When analyzing the diagnostic efficacy of NOSIP, AGMAT, and LINC01215 as biomarkers for COPD, the expression levels of these genes were directly used. The level corresponding to the highest Youden index was selected as the cutoff value for diagnosing COPD by that biomarker. Logistic regression was performed on the expression levels of each gene, and the probability of each individual having the disease was calculated using the fitted regression curve. Different probability thresholds were determined, and the corresponding diagnostic efficacy results (sensitivity, specificity, and accuracy, etc.) were calculated based on these thresholds.

[0110] 2. Experimental Results

[0111] Analysis and validation results of diagnostic efficacy showed that NOSIP, AGMAT, and LINC01215 have high accuracy, sensitivity, and specificity in the early diagnosis of chronic obstructive pulmonary disease (COPD) (see [link to relevant documentation]). Figures 4-6 Furthermore, NOSIP, AGMAT, and LINC01215 were all significantly downregulated in chronic obstructive pulmonary disease (see [link to relevant documentation]). Figure 7 This indicates that NOSIP, AGMAT, and LINC01215 can be used in the auxiliary diagnosis of early chronic obstructive pulmonary disease in clinical practice.

[0112] Example 3

[0113] Integrated analysis based on high-throughput transcriptome and methylation data

[0114] Differential mRNA analysis: The GSE42057 dataset was downloaded from the GEO database. Probes were mapped to genes, and the average value of multiple probes for a single gene was taken as the expression level of that gene. Differential analysis of the mRNA dataset was performed using the limma package in R-4.0.5. The screening criterion was set as P.Value < 0.05. Analysis yielded 1592 differentially expressed genes, including 479 upregulated and 1113 downregulated. The differential mRNA volcano plot is shown below. Figure 8 A, and its corresponding heatmap are shown below. Figure 8 B.

[0115] Differential methylation analysis: Differential methylation analysis was performed on the methylation data (GSE118468) using the CHAMP package. The screening criteria were P.Value < 0.05 & |deltaBeta| > 0.1, resulting in 5840 differential methylation sites and 2634 differentially methylated genes, including 607 hypermethylated genes and 2027 hypomethylated genes. The volcano plot of the differential methylation sites is shown below. Figure 9 A, and its corresponding Manhattan diagram, see [see A]. Figure 9 B.

[0116] Highly methylated, low-expression genes: The intersection of differentially downregulated genes and highly methylated genes was used to obtain differentially expressed genes regulated by abnormal methylation, resulting in 81 genes with downregulated expression due to high methylation modification. Statistical results for highly methylated, low-expression genes are shown below. Figure 10 .

[0117] GO and KEGG enrichment analysis of hypermethylated, low-expression genes: GO and KEGG functional enrichment analyses were performed on hypermethylated, low-expression genes using the David database (https: / / david.ncifcrf.gov / tools.jsp). The selection criterion was P-value < 0.05. The GO enrichment analysis results are shown below. Figure 11 As shown, the KEGG enrichment analysis results are as follows: Figure 12 As shown.

[0118] Protein-protein interaction network diagram of hypermethylated and low-expression genes: In order to explore the protein-protein interaction relationships among the screened differentially expressed genes with abnormal methylation modifications, this embodiment uses the online database STRING to construct the PPI network of 81 screened hypermethylated and low-expression genes. Figure 13A PPI network of 81 highly methylated, low-expression genes constructed using the STRING database is shown. This PPI network includes 373 interacting gene pairs. The results obtained from the STRING database were then imported into Cytoscape software (http: / / www.cytoscape.org / ), and the CytoHubba plugin was used to screen for core genes (HUB genes). The screened core genes included NOSIP. This result further demonstrates its effectiveness in the early diagnosis of chronic obstructive pulmonary disease.

[0119] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. The use of a reagent for detecting a biomarker in the preparation of products for diagnosing and / or predicting chronic obstructive pulmonary disease, characterized in that: The marker is any one or more of NOSIP, AGMAT, and LINC01215.

2. The use of the reagent for detecting the biomarker according to claim 1 in the preparation of products for diagnosing and / or predicting chronic obstructive pulmonary disease, characterized in that: The reagents include those used to detect the expression levels of one or more of NOSIP, AGMAT, and LINC01215 in a sample using protein immunoassay, dye assay, nucleic acid sequencing, nucleic acid hybridization, digital imaging, chromatography, and mass spectrometry.

3. The use of the reagent for detecting the biomarker according to claim 2 in the preparation of products for diagnosing and / or predicting chronic obstructive pulmonary disease, characterized in that: The reagent used to detect the expression levels of one or more of NOSIP, AGMAT, and LINC01215 in a sample using protein immunoassay includes an antibody; the antibody is a labeled antibody that is specific to one or more epitopes of NOSIP, AGMAT, and LINC01215. The reagent used to detect the expression levels of one or more of NOSIP, AGMAT, and LINC01215 in a sample using dye technology includes a dye; the dye is a dye specific to one or more of NOSIP, AGMAT, and LINC01215. The reagent used to detect the expression levels of one or more of NOSIP, AGMAT, and LINC01215 in a sample using nucleic acid sequencing technology includes primers; the primers are primers that specifically bind to one or more sequences of NOSIP, AGMAT, and LINC01215. The reagent used to detect the expression levels of one or more of NOSIP, AGMAT, and LINC01215 in a sample using nucleic acid hybridization technology includes a probe; the probe is a labeled probe that is specifically complementary to one or more of the sequences of NOSIP, AGMAT, and LINC01215.

4. The application of a biomarker in constructing a diagnostic and / or predictive system for chronic obstructive pulmonary disease, characterized in that: The marker is any one or more of NOSIP, AGMAT, and LINC01215; The system includes a detection module and an evaluation module; The detection module is used to detect the expression level of one or more of NOSIP, AGMAT, and LINC01215 in the subject sample; The assessment module is used to compare the subject's detection value obtained by the detection module with the normal sample detection value or normal reference value. When the expression level of one or more of NOSIP, AGMAT, and LINC01215 is significantly lower than the normal sample detection value or normal reference value, the subject is judged to be a patient with chronic obstructive pulmonary disease or the subject is judged to have a high risk of chronic obstructive pulmonary disease.