RNAi molecules targeting the genome of the small cutworm
By designing RNAi molecules that target the cutworm genome and using synergistic formulations, the problems of cutworm resistance and environmental pollution have been solved, achieving highly efficient and environmentally friendly pest control.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANGHAI PLANT SCI BIOTECHNOLOGY LTD
- Filing Date
- 2021-12-23
- Publication Date
- 2026-06-30
AI Technical Summary
Existing chemical pesticides have problems with resistance, environmental pollution, and pesticide residues when controlling cutworm pests, necessitating the exploration of new and more efficient control methods.
RNAi molecules targeting the cutworm genome were designed to interfere with the expression of genes such as CPH, AiC5, LCP-22, RR-1, and cuti by synthesizing double-stranded RNA molecules. RNAi pesticides were developed and combined with synergistic formulations to improve insecticidal efficacy.
RNAi molecules achieved a mortality rate of over 80% against cutworms at a concentration of 200 mg/L. The synergistic formula further enhanced the control effect, providing an efficient and environmentally friendly pest control solution.
Smart Images

Figure BDA0003428412160000081 
Figure HDA0003428412170000011 
Figure HDA0003428412170000012
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biopesticide science and relates to RNAi molecules that target the genome of the cutworm and their use in the control of the cutworm. Background Technology
[0002] The cutworm (scientific name *Agrotis ypsilon*), commonly known as the groundworm or root-cutting worm, is a species of cutworm belonging to the genus *Agrotis* in the subfamily Noctuidae of the family Noctuidae. It is a significant pest affecting the growth and development of vegetables and various crops. The cutworm is a polyphagous pest with a very wide host range. It feeds on a variety of vegetables, including legumes, cruciferous vegetables, solanaceous vegetables, lilies, cucurbits, spinach, lettuce, and fennel, as well as 106 other crops such as peanuts, tobacco, hemp, and asparagus, during their seedling stages. It is also a major pest in orchards, nurseries, and lawns. Cutworm damage is most severe in spring and autumn. Young larvae feed on the above-ground parts of plants, consuming cotyledons and tender leaves, causing holes or notches. Middle and older larvae hide in shallow burrows during the day and emerge at night to feed on the tender stems near the soil surface, causing plant death, resulting in missing seedlings, broken rows, and even forced replanting, directly impacting crop production. In addition, the larvae can bore into and damage eggplant and pepper fruits, as well as the leaves of Chinese cabbage and kale, and excrete feces, causing the products to rot and thus affecting the commercial value of the vegetables.
[0003] The control of cutworms mainly relies on chemical control, such as 90% trichlorfon and 50% phoxim emulsifiable concentrate. However, with the increasing resistance of pests to pesticides, the use of highly toxic pesticides is being gradually banned, and the contradictions of environmental pollution and pesticide residues are becoming increasingly prominent. There is an urgent need to explore new and efficient control methods.
[0004] In recent years, research on RNA biopesticides has made significant progress and is gradually being applied commercially. On June 15, 2017, the U.S. Environmental Protection Agency (EPA) approved the world's first insect-resistant maize variety, MON87411, expressing insect dsRNA. RNA biopesticides, also known as nucleic acid pesticides, RNAi pesticides, or RNA interference agents, are novel biopesticides developed based on RNA interference technology. Their core component is a polynucleotide that can specifically bind to the mRNA transcribed from the target gene in the target organism. RNA interference (RNAi) refers to a highly conserved, evolutionarily induced phenomenon of post-transcriptional gene silencing, induced by double-stranded RNA (dsRNA) and resulting from the efficient and specific degradation of homologous messenger RNA (mRNA). Because RNAi technology can specifically eliminate or shut down the expression of specific genes, it is widely used in functional genomics research.
[0005] Currently, many international pesticide companies, such as Bayer-Monsanto, Dow AgroSciences, and Syngenta, are using this technology and investing a lot of human and material resources in the research and development of targeted insecticides. Some of their products are already on the market or about to be launched. Summary of the Invention
[0006] The inventors identified several gene loci in the *C. elegans* genome that significantly influence its growth and development as RNAi target genes. Five double-stranded RNAi molecules (dsRNAs) were designed for each target gene and added to artificial feed for *C. elegans* larvae to assess lethality. The experiments revealed that CPH, AiC5, LCP-22, RR-1, and cuti were highly effective RNAi target genes. Then, 30 dsRNA molecules were designed for each of these five genes and added to artificial feed for *C. elegans* larvae to assess lethality. Finally, five RNAi molecules targeting each of the respective RNAi target genes were screened. At a concentration of 200 mg / L in the feed, after five days of feeding, the lethality of all five RNAi molecules in *C. elegans* exceeded 80%.
[0007] Based on the above research results, the technical solution of the present invention is as follows.
[0008] 1. An RNAi molecule targeting the genome of the small cutworm, characterized in that it is a double-stranded RNA molecule composed of a sense strand and a complementary antisense strand, wherein the nucleotide sequence of the sense strand is selected from SEQ ID NOs:1-5.
[0009] The sense strand nucleotide sequence of the RNAi molecule AyCPH, which targets the CPH gene, is SEQ ID NO:1:
[0010] UUCCUGCUGUCUGUUGCUGCCGUCAUCGCCGUGGCCGUCGCUGUGCCCGCACAGCGCGGUCUAGUGGUUCCUGGACCCGCCGGCCCCGCCCCUGCCCCUGAAGACUCCUUCGCACCCAUUGCCAUCGGACCUGCCAUCAUCGACUCCUUCGAGCCCGUCGCUAUUGGACCCGCCAUCGUUAACCCCGUUGAGGGCAUCGCUGUUGGACCCGCUAUCGUCCACCCUAGUGAGGGUAUCUCUGUUGGACCCGCCAUCAUUCCUUUCCCCCUGCCCGAUGGUGCCCACGCUGAGGAGCCCGUUAUUGCUCCCUCUCCCGUGUCCGUCGUAGAAGGCCCCGCACCCUCUCCCGCUGCCGGCAGCCCCCUUGUUCAGGUCAUCGUGAACGUCAACCAGGCCGCCGCUGAGUCUAACCCCAUCUCCGUCGGACCCGCUAUCGUCCCCGAGCCCGUCGAGAUCAAGCCUGAGCCCGUCCACGUUGUGGAAGCCGCUCCUGAGCCCGUGCAGGUUGUUGAGGUCGCCCCUGAGCCCGUCCAGGUUGUGGAGGUUGCCCCCGUGCAGGUCGAGCCCGUCCAGAUCGGAGUCCCCAUCAUCCCUGAGGCUGCCGUCGUCCUCCCUGAGGAACUCAAC(SEQ ID NO:1);
[0011] The sense strand nucleotide sequence of the RNAi molecule AyAiC5 targeting the gene AiC5 is SEQ ID NO:2:
[0012] CUAUUGGCUCUGACGGCGUUCGCCUCAGCUAAACACGUUAGCUUUGAGAAUGCCAUCGAUUUAGAAGACAUCACCGCUUACGGAUACUUGUCUAAGAUCGGUGCCCCGCUUGCCGAGAAAAUCCGUCAAGCUGAGGAGCAGCAAGACAGCCAUGUCAGAAUUGUUGGCGGUUCCCUCUCAAGCCUCGGACAGUUCCCUCACCAGGCCGGUCUUCUGACACAGUUCGCUGGUGGUCAGGGAGUCUGCGGAGGCUCUCUCAUUAAAGCAAACCGUGUCGUUACCGCUGCACACUGCUGGUUCGAUGGUCAAAACCAGGGCAGGAGCGUAAUCGUGGUCCUUGGAUCAGUAAAUUUGUUCUCCGGUGGUAACAGACAAACAUCCACCAACAUUGUAAUGCACGGAAGCUGGAACCCGAGUUUGAUUCGUAACGACGUUGCCGUAAUCAGAAUAAACAACGUUGCCCUUAACAACAACAUCAACGUUAUCCCUCUGGCCACUGGUAGCGAGAGCUACGCCGGUGAAAACGCCGUCGCAUCUGGCUUCGGUUUGACCCGAGAUGGUGGAAGUGUAAGUGGAGCUUUGAGUCACGUUACCCUGCCUGUGAUCACGAACGCUGUGUGCAGAGGUUCCUUCCCUCUCAUCAUCCAGGACUCCAACAUUUGUGUUAGCGGCGCUGGUGGCAGGAGCACUUGCCAGGGUGACUCCGGUGGUCCCCUUACCGUCGUCAGAAGCGGAAGACCCAUCUUGAUUGGUAUCACUUCCUUCGGAUCUGCCCGUGGUUGCCAGGUUGGAUCCCCUGCCGCCUUCGCAAGGGUCACCUCCUUCGCCGCCUGGAUCAACGCACAG(SEQ ID NO:2);
[0013] The sense strand nucleotide sequence of the RNAi molecule AyLCP-22 targeting the gene LCP-22 is SEQ ID NO:3:
[0014] AUGAAAUUCGCAGCAGUGGUGAUUUUGGCGUGUGUGGCUGCCGCUAGCGCGCAGUUCAACAGCGGAGCAUACAACAGGAACCCCUACAACCCCUUCGCAAACCAGUACAGCCGUAACCAAUUCCAGUACAAGCCCACCCCCAAGCCUUUCCGCGCAUACACCCCCAUUGCAUACCCCUCGUCCACUGCUGCUCCCCGUCCCUUCGUCCCCGUCCCUGUGCCCGUGGCCAGGUACCAGGGUGAUGCCCGCAACGCUCAGAUCCUGAAAUACGGAAAUGAAGCCAACCCUGACGGCAGCUACGCUUACUUCUACGAAACCGACAACGGUAUCGCGGCUCAGGAACAGGGCACUCCCCGCAACUUCGGUGGAAACCCCCCUGUCGUCCCCGUUGUCGCCCAGGGAUCUUUCUCCUACACCUCGCCCGAGGGUCAGCCCAUCGCCAUCUCAUACGUCGCUGACGAGAACGGUUUCCAGCCCACUGGUGACGCCAUCCCCACUUCUCCCCCUAUUCCCGAACAGAUCGCCCGCGCCCUCGCCUACAUCGCCAAAAAUGCGCCCCUCAAGAAA(SEQ ID NO:3);
[0015] The sense strand nucleotide sequence of the RNAi molecule AyRR-1 targeting the gene RR-1 is SEQ ID NO:4:
[0016] AUGAAAUUCUUGGUACUUGCUCUGUGCGUGUGCGCUGCUAGCGCGGCGAGCUUCGGCUCCACUCCCUUCGGUGGUUACAAGAACUACAAGGGUUCCGCCGUGGCUGCCCCUGCAGCGGUCGCCGCUAAGGCCGCCGCCGUCGUUGCUGCCCCCUUCGUCGCUGCCGCUGAUGCCACCUACCAGGCUGGAAACGCCGUUUACCAAGGCGCCAAGAGCGUUGUCAACAAGGCUUACUCCGACGACGCUCAGGCCUCUGUCCUCCGCUCCGAGAGCGACGUGAGCGCAGACGGUUUCAAGUACACGUUCGAAACCUCCAACGGUAUCGGCGCUGAAGCUUACGGUUCCUACAGACAGGUCGGAGAAGCCGGUGGUGUUGUCUCCCAGGGUUCUUACAGAUACACCGCCCCUGACGGUACCCCCGUGGUUGUCAACUACGUCGCUGACGAGAACGGAUACCAGCCCUCGAGCGACAUCCUUCCCGUUGGCCCCGCCAUCCCCGAGGCGAUCGCCCGCUCCCUUGACUACAUCGCCGCCCAC(SEQ ID NO:4);
[0017] The sense strand nucleotide sequence of the RNAi molecule Aycuti targeting the gene cuUi is SEQ ID NO:5:
[0018] AACAUGAUCGCAUUUAAAACAGCAGCCAUCCUUCUCCUAGCGGCUUUCGCAGCCGCCCGACCCUGAGGAUUGGGAGCCCGAAGGUCACUCUCACUCCGAGCACACAAAGCCCUACCAUGUCACGGUGGUGAAGAAGAUCGGUGUCCCGGUCCCGCAUCCCGUGGCCGUCUCCGUCCCGCAGUACGUCAAGAUCCCCAUCCCGCAACCUUACCCCGUCCACGUG ACCGUGGAACAGCCUAUCCAUGUGCCAGUUUACAAGGUCGUGCCCCAGAUAGUGGAGAAGCCAGUGCCCUACACCGUUGAGAAGCCCGUCCCCUAUGAGGUCGAGAAGCCCUACCCCGUUGAGGUCGAAAAGAAGGUCGAGGUCCCAAUCCCCAAGCCUUACCCCGUCCACGUUCCCGUCUACAAACACGUCUACCACCACAAGGGAGGCCACAAGCAC(SEQID NO:5).
[0019] More preferably, the RNAi molecule with the positive strand nucleotide sequence of SEQ ID NO:4 is preferred.
[0020] A second aspect of the present invention is to provide an RNAi pesticide for controlling cutworms, comprising the aforementioned RNAi molecules AyCPH, AyAiC5, AyLCP-22, AyRR-1, Aycuti, or a mixture of two or more thereof.
[0021] Optionally, the aforementioned RNAi pesticide may also include a carrier or adjuvant that is beneficial to RNAi molecules, wherein the carrier and adjuvant can properly maintain the stability and activity of RNA molecules.
[0022] In one embodiment, the above-mentioned RNAi pesticide can be in the form of lyophilized powder, which is temporarily prepared into a solution before use.
[0023] When the above-mentioned RNAi pesticides are applied in the form of aqueous solutions, the concentration of the RNAi molecules in the aqueous solution can be 50-1000 mg / L, for example 100-500 mg / L.
[0024] To enhance the effectiveness of the aforementioned RNAi molecules in killing cutworms and improve the efficiency of this RNAi pesticide in controlling pests, the present invention also provides a synergistic formulation that can be combined with the aforementioned RNAi molecules to jointly constitute an RNAi pesticide with improved control efficacy. Specifically, the aforementioned RNAi molecules are dissolved in a synergistic formulation at a concentration of 20-400 mg / L, for example, 25-200 mg / L. The synergistic formulation may be a liquid formulation reported in patent document CN113100235A, which, by weight percentage, consists of the following components: 1-3% potassium oleate; 0.1-0.5% geraniol; 0.005-0.05% synergistic ether; 0.05-0.3% diatomaceous earth; 0.005-0.03% xanthan gum; 0.5-2% SDS; 0.05-0.3% sodium lauroyl sarcosinate; 0.05-0.3% UriUon X-100; 0.5-2% alkali metal chloride; 0.1-0.5% alkaline earth metal chloride; and the balance being water.
[0025] Preferably, the above-mentioned synergistic formulation comprises the following components by weight percentage: 2% potassium oleate; 0.3% geraniol; 0.01% synergistic ether; 0.1% diatomaceous earth; 0.01% xanthan gum; 1% SDS; 0.1% sodium lauroyl sarcosinate; 0.1% UriUon X-100; 0.73% sodium chloride; 0.223% potassium chloride; 0.2% magnesium chloride; 0.1% calcium chloride; and the balance being water.
[0026] Another aspect of this invention provides the application of the aforementioned RNAi molecule or RNAi pesticide in the control of cutworms. Specifically, the aforementioned RNAi pesticide is used to inhibit the growth of cutworm larvae and kill the cutworms.
[0027] Specifically, the aforementioned RNAi pesticides are applied to crops where cutworms grow. For example, the aforementioned RNAi pesticides are applied to corn, cotton, and vegetables.
[0028] Experiments show that when the 200 mg / L aqueous solution of the five RNAi molecules provided in this invention is sprayed onto the surface of feed and dried, and then fed to third-instar cutworm larvae, the mortality rate after 5 days reaches over 80%, indicating that the RNAi molecules have excellent control effects. The synergistic formula can further improve the control effect of RNAi molecules on cutworms. Attached Figure Description
[0029] Figure 1 This is a bar chart showing the lethality of five dsRNA molecules against cutworms. CK is the blank control (no treatment), CKB is the liquid formulation reported in patent document CN113100235A, and dsGEP is the negative control RNA molecule.
[0030] Figure 2This is a statistical bar chart showing the relative expression levels of five target genes in cutworm larvae after being fed dsRNA molecules for 5 days, compared to cutworm larvae that were not fed dsRNA molecules. Detailed Implementation
[0031] In the field of agricultural pest and disease control, two studies in 2002 discovered that silencing specific target genes could lead to abnormal insect development, embryonic malformation, and even death. This marked the beginning of the application of RNAi technology in entomological research and application. In 2007, reports confirmed that expressing insect dsRNA in transgenic plants could achieve insecticidal effects. These research findings provided strong evidence for the application of RNAi technology in pest control. The principle of RNAi technology is that RNA molecules can specifically bind to the mRNA transcribed from the target gene in the target organism, specifically silencing the expression of the target gene. It is characterized by high efficiency and strong specificity. RNAi technology essentially utilizes specific fragments of endogenous functional genes in organisms, synthesized in vitro and then introduced into the target species to inhibit gene expression, thereby hindering gene function and ultimately affecting the growth and development of the target species, even leading to death. Because of its species specificity, ease of target development, and easy degradation, RNAi pesticides possess most of the functions required for green pesticides, attracting the attention of many scientists and pesticide companies, and is hailed as the third revolution in pesticide production history.
[0032] To develop RNAi biopesticides for controlling cutworms, we screened numerous genes affecting their growth and development. We discovered that five genes in the genome—CPH, AiC5, LCP-22, RR-1, and cuti—can effectively serve as RNAi targets for developing high-lethal RNAi pesticides. These five genes encode the following proteins:
[0033] CPH: Cuticle protein CPH45. CPH45 interacts with chitin to form the Bouligand model, which stabilizes the complex structure of the epidermis, while maintaining its elasticity and other physical properties, and ensuring normal contraction and extension of the trunk and appendages.
[0034] LCP-22: LCP-22 precursor, a larval cuticle protein, thickens the insect's cuticle, reducing pesticide penetration and thus enhancing resistance. We hypothesize that inhibiting this gene to reduce the thickness or density of the insect's cuticle, increasing its permeability, could increase the penetration rate of chemical pesticides onto the insect's surface, thereby improving insecticidal efficiency.
[0035] RR-1: Minus strand cuticular protein RR-1 motif 42 precursor. Its resistance to adverse factors such as low temperature, dryness, and toxic chemicals helps to strengthen or stabilize the epidermal structure, resist these adverse factors, and maintain the insect's survival.
[0036] Cuti: minus strand putative cuticular protein, used for epidermal integration, body shape shaping, and ossification site construction.
[0037] AiC5: minus strand AiC5 chymotrypsinogen, is a potent proteolytic enzyme, an insect immune-related protein, and a pesticide resistance-related protein.
[0038] In this article, the terms “RNAi molecule,” “dsRNAi,” “double-stranded RNA molecule,” or “RNA interfering agent” are used interchangeably. They all refer to double-stranded molecules formed by the annealing of the sense and antisense strands.
[0039] Since the RNAi molecule of this invention targets the gene of Agrotis ypsilon, the above five RNAi target genes can be represented as AyCPH, AyAiC5, AyLCP-22, AyRR-1 and Aycuti, respectively.
[0040] More than 30 double-stranded RNA molecules were designed for these 5 genes. After experimental verification, the RNAi molecules with the best inhibitory effect on the target genes were screened out, and their sense strands are SEQ ID NOs:1-5.
[0041] On the other hand, for ease of description, the five RNAi molecules screened in this article are named after their corresponding target gene names: AyCPH, AyAiC5, AyLCP-22, AyRR-1, and Aycuti. Those skilled in the art will readily understand that these names represent different meanings in different contexts, signifying different nucleic acid substances (RNA or DNA).
[0042] The inventors also discovered that the synergist formulation for enhancing the insecticidal effect of dsRNA, previously reported in patent document CN113100235A, is still applicable to the RNAi molecule of the present invention. When used in combination, the lethality against cutworms can be increased, thus reducing the amount of RNAi molecule used, which is economically advantageous.
[0043] Preferably, the above-mentioned synergistic formulation comprises, by weight percentage, the following components: approximately 2% potassium oleate; approximately 0.3% geraniol; approximately 0.01% synergistic ether; approximately 0.1% diatomaceous earth; approximately 0.01% xanthan gum; approximately 1% SDS; approximately 0.1% sodium lauroyl sarcosinate; approximately 0.1% UriUon X-100; approximately 0.73% sodium chloride; approximately 0.223% potassium chloride; approximately 0.2% magnesium chloride; approximately 0.1% calcium chloride; and the balance being water.
[0044] It should be understood that in this article, when describing numerical characteristics, the terms "about" or "approximately" mean that the expressed number may have an error range or fluctuation range of ±10%, ±9%, ±8%, ±7%, ±6%, or ±5%.
[0045] When the synergistic formulation is mixed with RNAi molecules, the RNAi molecules are dissolved in the synergistic formulation at a concentration of 20-400 mg / L, preferably 20-300 mg / L, more preferably 25-200 mg / L.
[0046] The present invention will be further described below with reference to specific embodiments and accompanying drawings. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.
[0047] Example
[0048] In embodiments of the present invention, unless otherwise specified, the experimental operating temperature generally refers to room temperature (10-30°C).
[0049] This article involves the addition amount, content and concentration of various substances. Unless otherwise specified, the percentage content mentioned refers to the weight percentage.
[0050] In the examples, primer synthesis and RNA synthesis were performed by Platinum Biotech (Shanghai) Co., Ltd., and sequencing was performed by Shanghai Sunny Biotechnology Co., Ltd.
[0051] The molecular biology experiments in the examples included plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, and culture medium preparation, etc., mainly referring to "Molecular Cloning: A Laboratory Manual" (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. Specific experimental conditions can be determined through simple experiments if necessary.
[0052] PCR amplification experiments should be performed according to the reaction conditions or instructions provided by the plasmid or DNA template supplier. Adjustments can be made through simple experiments if necessary.
[0053] To examine the effects of RNAi molecules AyCPH, AyAiC5, AyLCP-22, AyRR-1, and Aycuti, the double-stranded RNA molecule dsGFP with the sense strand nucleotide sequence SEQ ID NO:6 was used as a negative control in this example.
[0054] AGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGU GAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCCGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUC(SEQID NO:6).
[0055] The primer sequences used in the examples are shown in Table 1.
[0056] Table 1. Primer sequences
[0057]
[0058] Where F is the forward primer and R is the reverse primer.
[0059] Example 1: Obtaining the target gene sequence
[0060] (1) Extraction of total RNA from small cutworms
[0061] Using cutworms as material, the RNA was extracted using the conventional Trizol method, purified using conventional methods, and treated with DNase to obtain a total RNA sample with a concentration ≥300 ng / μl, a total amount ≥6 μg, and an OD260 / 280 of 1.8–2.2.
[0062] (2) Isolation of mRNA and synthesis of cDNA
[0063] mRNA containing polyA was isolated using magnetic beads with oligo-dT, and then the first strand of cDNA was synthesized using random 6-mers and Invitrogen's Superscript II reverse transcriptase kit.
[0064] (3) Gene amplification and sequencing
[0065] Amplification was performed using the target gene-specific primers listed in Table 1. The obtained gene fragments were purified, ligated into the PMD-18 vector (Takara), transformed into the Top 10 *E. coli* strains, and screened using blue-white screening. Positive strains were sequenced. Primers for amplifying the target genes AyCPH, AyAiC5, AyLCP-22, AyRR-1, and Aycuti, as well as the negative control GFP gene, are shown in Table 1. Sequencing of positive strains confirmed their correctness.
[0066] Example 2: Synthesis of RNAi molecules
[0067] 2.1 Thirty-three RNAi molecules were designed targeting the AyCPH gene sequence. These were synthesized using the Thermo Fisher dsRNA synthesis kit MEGAscript. TM Synthesize using the T7 Transcription Kit (am1334), following the kit's detailed operating procedures. For example, the sense strand of the RNAi molecule can be SEQ ID NO:1, and the double-stranded molecule can be named AyCPH.
[0068] 2.2 Thirty-five RNAi molecules were designed targeting the AiC5 gene sequence. These were synthesized using the Thermo Fisher dsRNA synthesis kit MEGAscript. TM Synthesized using the T7 Transcription Kit (am1334), please refer to the kit for detailed operating procedures. For example, the sense strand of the RNAi molecule is SEQ ID NO:2, and the double-stranded molecule is named AyAiC5.
[0069] 2.3 Thirty RNAi molecules were designed targeting the AyLCP-22 gene sequence. These were synthesized using the Thermo Fisher dsRNA synthesis kit MEGAscript. TM Synthesize using the T7 Transcription Kit (am1334), following the kit's detailed operating procedures. For example, the sense strand of the RNAi molecule can be SEQ ID NO:3, and the double-stranded molecule can be named AyLCP-22.
[0070] 2.4 Thirty RNAi molecules were designed targeting the AyRR-1 gene sequence. These were synthesized using the Thermo Fisher dsRNA synthesis kit MEGAscript. TM Synthesize using the T7 Transcription Kit (am1334), following the kit's specific operating procedures. For example, the sense strand of the RNAi molecule can be SEQ ID NO:4, and the double-stranded molecule can be named AyRR-1.
[0071] 2.5 Thirty RNAi molecules were designed targeting the Aycuti gene sequence. These were synthesized using the Thermo Fisher dsRNA synthesis kit MEGAscript. TM Synthesize using the T7 Transcription Kit (am1334), following the kit's detailed operating procedures. For example, the sense strand of the RNAi molecule can be SEQ ID NO:5, and the double-stranded molecule can be named Aycuti.
[0072] 2.6 A double-stranded RNA molecule, dsGFP, with the sense strand nucleotide sequence SEQ ID NO:6, was synthesized as a negative control for the comparative experiment. The primer sequences for amplifying dsGFP are shown in Table 1 as GFP-F / GFP-R.
[0073] Example 3: Testing the effect of RNAi molecules on small cutworm larvae
[0074] Each dsRNA molecule synthesized in the examples was prepared into an aqueous solution with a concentration of 200 μg / ml. 1 ml of this solution was evenly sprayed onto the surface of 1 g of artificial feed (prepared as a sheet 0.5 cm thick) used as cutworm feed. After drying, 3rd instar cutworm larvae were introduced and allowed to feed. Larval survival data were investigated and recorded after 5 days of feeding. dsRNA synthesized from the green fluorescent protein (GFP) gene was used as a control. RNAi molecules with the highest lethality against each target gene were screened, yielding RNAi molecules with positive strand sequences of SEQ ID NOs: 1-5.
[0075] Example 4: Investigation of the control efficacy of five RNAi molecules against small cutworm larvae
[0076] 4.1 Five dsRNA molecules (AyCPH, AyAiC5, AyLCP-22, AyRR-1, and Aycuti) and the negative control dsGFP were dissolved in water to a concentration of 200 μg / ml. The solution was sprayed evenly onto a 0.5 cm thick layer of artificial feed at a dosage of 200 μg per gram of feed. After drying, 30 third-instar cutworm larvae were inoculated onto each sample. The larvae fed on the feed for the duration of their instar. Each dsRNA molecule sample was treated three times. The survival rate of the larvae was assessed on day 5 after treatment. Results are shown in [Table missing]. Figure 1 .
[0077] Figure 1 The statistical results of the lethality of five dsRNA molecules against small cutworm larvae are shown. CK in the figure is the blank control (no treatment), and CKB is the liquid formulation reported in patent document CN113100235A. The lethality rates of AyCPH (83%), AyAiC5 (89%), AyLCP-22 (92%), AyRR-1 (96%), and Aycuti (88%) are all higher than 83%. The RNAi molecule AyRR-1 showed the highest lethality.
[0078] 4.2 Cutworm larvae surviving 5 days after treatment with dsRNA molecules and 5 days after treatment with the negative control dsGFP were collected. Using the qRT-PCR primer pairs listed in Table 1, the expression levels of five target genes (AyCPH, AyAiC5, AyLCP-22, AyRR-1, and Aycuti) in their genomes were detected by quantitative real-time PCR (qRT-PCR). The relative expression levels of the five target genes were compared with those of untreated cutworm larvae, and the results are shown in the table below. Figure 2 .
[0079] The quantitative real-time PCR detection method includes the following steps:
[0080] Samples were taken 5 days after treatment, flash-frozen in liquid nitrogen, and then stored at -80°C. Total RNA was extracted using Reagent (Invitrogen) strictly following the instructions in the lab manual. The absorbance of the extracted total RNA sample was measured using a spectrophotometer, and the total RNA mass was determined by 1% agarose gel electrophoresis. The sample was then stored at -80°C until use.
[0081] Using the reverse transcription kit ReverTra cDNA was reversed using qPCR RT Master Mix with gDNA Remover (TOYOBO). The procedure was strictly followed according to the manual. After completion, the reaction solution was diluted 10 times and stored at -20℃ for later use.
[0082] The reaction system for quantitative real-time PCR detection was: cDNA Template 2 μL; Premix Ex Taq TM II 10 μL; forward primer 1 μL; reverse primer 1 μL; nuclease-free double-distilled water 6 μL.
[0083] The qRT-PCR reaction was performed using a two-step procedure, with the following reaction system: 95℃ for 30s, 95℃ for 5s, 60℃ for 30s, for 40 cycles.
[0084] Figure 2 The statistical results show the relative expression levels of five target genes in cutworm larvae after 5 days of feeding with various dsRNA molecules, compared to cutworm larvae that were not fed with dsRNA molecules. Specifically, the relative expression level of target gene AyCPH was 64% after feeding with RNAi molecule SEQ ID NO:1 (AyCPH5 molecule), 53% after feeding with RNAi molecule SEQ ID NO:2 (AyAiC5 molecule), 32% after feeding with RNAi molecule SEQ ID NO:3 (AyLCP-22 molecule), 12% after feeding with RNAi molecule SEQ ID NO:4 (AyRR-1 molecule), and 33% after feeding with RNAi molecule SEQ ID NO:5 (Aycuti molecule). This indicates that the expression of the small cutworm genome was suppressed and downregulated to varying degrees by these RNAi molecules, among which AyRR-1 molecule showed the strongest inhibitory effect on the target gene Aycuti, i.e., the strongest inhibitory effect on the genome.
[0085] The above experiments show that all five RNAi molecules of the present invention can effectively kill cutworms and reduce the damage caused by cutworms to crops such as corn, cotton and vegetables, and are expected to be developed into a green biological pesticide. sequence list <110> Shanghai Zhisheng Yougu Biotechnology Co., Ltd. <120> RNAi molecules targeting the genome of the small cutworm <130> SHPI2110547 <160> 6 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 627 <212> RNA <213> Artificial Sequence () <400> 1 uuccugcugu cuguugcugc cgucaucgcc guggccgucg cugugcccgc acagcgcggu 60 cuagugguuc cuggacccgc cggccccgcc ccugccccug aagacuccuu cgcacccauu 120 gccaucggac cugccaucau cgacuccuuc gagcccgucg cuauuggacc cgccaucguu 180 aaccccguug agggcaucgc uguuggaccc gcuaucgucc acccuaguga ggguaucucu 240 guuggacccg ccaucauucc uuucccccug cccgauggug cccacgcuga ggagcccguu 300 auugcucccu cucccguguc cgucguagaa ggccccgcac ccucucccgc ugccggcagc 360 ccccuuguuc aggucaucgu gaacgucaac caggccgccg cugagucuaa ccccaucucc 420 gucggacccg cuaucguccc cgagcccguc gagaucaagc cugagcccgu ccacguugug 480 gaagccgcuc cugagcccgu gcagguuguu gaggucgccc cugagcccgu ccagguugug 540 gagguugccc ccgugcaggu cgagcccguc cagaucggag uccccaucau cccugaggcu 600 gccgucgucc ucccugagga acucaac 627 <210> 2 <211> 846 <212> RNA <213> Artificial sequence () <400> 2 cuauuggcuc ugacggcguu cgccucagcu aaacacguua gcuuugagaa ugccaucgau 60 uuagaagaca ucaccgcuua cggauacuug ucuaagaucg gugccccgcu ugccgagaaa 120 auccgucaag cugaggagca gcaagacagc caugucagaa uuguuggcgg uucccucuca 180 agccucggac aguucccuca ccaggccggu cuucugacac aguucgcugg uggucaggga 240 gucugcggag gcucucucau uaaagcaaac cgugucguua ccgcugcaca cugcugguuc 300 gauggucaaa accagggcag gagcguaauc gugguccuug gaucaguaaa uuuguucucc 360 ggugguaaca gacaaacauc caccaacauu guaaugcacg gaagcuggaa cccgaguuug 420 auucguaacg acguugccgu aaucagaaua aacaacguug cccuuaacaa caacaucaac (此处原文本可能有误,推测为auucguaacg acguugccgu aaucagaaua aacaacguug cccuuaacaa caacaucaac 480)480 guuaucccuc uggccacugg uagcgagagc uacgccggug aaaacgccgu cgcaucuggc 540 gugaucacga acgcugugug cagagguucc uucccucuca ucauccagga cuccaacauu 660 uguguuagcg gcgcuggugg caggagcacu ugccagggug acuccggugg uccccuuacc 720 gucgucagaa gcggaagacc caucuugauu gguaucacuu ccuucggauc ugcccguggu 780 ugccagguug gauccccugc cgccuucgca agggucaccu ccuucgccgc cuggaucaac 840 gcacag 846 <210> 3 <211> 567 <212> RNA <213> Artificial sequence () <400> 3 augaaauucg cagcaguggu gauuuuggcg uguguggcug ccgcuagcgc gcaguucaac 60 agcggagcau acaacaggaa ccccuacaac cccuucgcaa accaguacag ccguaaccaa 120 uuccaguaca agcccacccc caagccuuuc cgcgcauaca cccccauugc auaccccucg 180 uccacugcug cuccccgucc cuucgucccc gucccugugc ccguggccag guaccagggu 240 gaugcccgca acgcucagau ccugaaauac ggaaaugaag ccaacccuga cggcagcuac 300 gcuuacuucu acgaaaccga caacgguauc gcggcucagg aacagggcac uccccgcaac 360 uucgguggaa accccccugu cguccccguu gucgcccagg gaucuuucuc cuacaccucg 420 cccgaggguc agcccaucgc caucucauac gucgcugacg agaacgguuu ccagcccacu 480 ggugacgcca uccccacuuc ucccccuauu cccgaacaga ucgcccgcgc ccucgccuac 540 aucgccaaaa augcgccccu caagaaa 567 <210> 4 <211> 537 <212> RNA <213> Artificial Sequence () <400> 4 augaaauucu ugguacuugc ucugugcgug ugcgcugcua gcgcggcgag cuucggcucc 60 acucccuucg gugguuacaa gaacuacaag gguuccgccg uggcugcccc ugcagcgguc 120 gccgcuaagg ccgccgccgu cguugcugcc cccuucgucg cugccgcuga ugccaccuac 180 caggcuggaa acgccguuua ccaaggcgcc aagagcguug ucaacaaggc uuacuccgac 240 gacgcucagg ccucuguccu ccgcuccgag agcgacguga gcgcagacgg uuucaaguac 300 acguucgaaa ccuccaacgg uaucggcgcu gaagcuuacg guuccuacag acaggucgga 360 gaagccggug guguugucuc ccaggguucu uacagauaca ccgccccuga cgguaccccc 420 gugguuguca acuacgucgc ugacgagaac ggauaccagc ccucgagcga cauccuuccc 480 guuggccccg ccauccccga ggcgaucgcc cgcucccuug acuacaucgc cgcccac 537 <210> 5 <211> 444 <212> RNA <213> Artificial sequence () <400> 5 aacaugaucg cauuuaaaac agcagccauc cuucuccuag cggcuuucgc agcugcccga 60 cccucugagg auugggagcc cgaaggucac ucucacuccg agcacacaaa gcccuaccau 120 gucacggugg ugaagaagau cggugucccg gucccgcauc ccguggccgu cuccgucccg 180 caguacguca agauccccau cccgcaaccu uaccccgucc acgugaccgu ggaacagccu 240 auccaugugc caguuuacaa ggucgugccc cagauagugg agaagccagu gcccuacacc 300 guugagaagc ccguccccua ugaggucgag aagcccuacc ccguugaggu cgaaaagaag 360 gucgaggucc caauccccaa gccuuacccc guccacguuc ccgucuacaa acacgucuac 420 caccacaagg gaggccacaa gcac 444 <210> 6 <211> 368 <212> RNA <213> Artificial sequence () <400> 6 aggacgacgg caacuacaag acccgcgccg aggugaaguu cgagggcgac acccugguga 60 accgcaucga gcugaagggc aucgacuuca aggaggacgg caacauccug gggcacaagc 120 uggaguacaa cuacaacagc cacaacgucu auauacuggc cgacaagcag aagaacggca 180 ucaaggugaa cuucaagauc cgccacaaca ucgaggacgg cagcgugcag cucgccgacc 240 acuaccagca gaacaccccc aucggcgacg gccccgugcu gguccccgac aaccacuacc 300 ugagcaccca guccgcccug agcaaagacc ccaacgagaa gcgcgaucac augguccugc 360 uggaguuc 368
Claims
1. An RNAi molecule targeting the genome of the small cutworm, characterized in that, It is a double-stranded RNA molecule composed of a sense strand and a complementary antisense strand, wherein the nucleotide sequence of the sense strand is SEQ ID NO:
4.
2. An RNAi pesticide for controlling cutworms, characterized in that, It contains the RNAi molecule as described in claim 1.
3. The RNAi pesticide as described in claim 2, characterized in that, It also includes vectors or adjuvants that maintain the stability of RNAi molecules.
4. The RNAi pesticide as described in claim 2, characterized in that, Its dosage form is lyophilized powder or solution.
5. The RNAi pesticide as described in claim 4, characterized in that, The concentration of the aqueous solution of RNAi molecules applied is 50-1000 mg / L.
6. The RNAi pesticide as described in claim 2, characterized in that, RNAi molecules are dissolved in a synergistic formulation at a concentration of 20-500 mg / L, the synergistic formulation comprising, by weight percentage: 1-3% potassium oleate; 0.1-0.5% geraniol; 0.005-0.05% synergistic ether; 0.05-0.3% diatomaceous earth; 0.005-0.03% xanthan gum; 0.5-2% SDS; 0.05-0.3% sodium lauroyl sarcosinate; 0.05-0.3% Triton X-100; 0.5-2% alkali metal chloride; 0.1-0.5% alkaline earth metal chloride; balance water.
7. The RNAi pesticide as described in claim 6, characterized in that, The synergistic formulation consists of the following components by weight percentage: 2% potassium oleate; 0.3% geraniol; 0.01% synergistic ether; 0.1% diatomaceous earth; 0.01% xanthan gum; 1% SDS; 0.1% sodium lauroyl sarcosinate; 0.1% Triton X-100; 0.73% sodium chloride; 0.223% potassium chloride; 0.2% magnesium chloride; 0.1% calcium chloride; and the balance being water.
8. A method for controlling cutworms, characterized in that, The RNAi pesticide as described in claim 2 is applied to crops where cutworms grow.
9. The method as described in claim 8, characterized in that, The crops mentioned are corn, cotton, or vegetables.
Citation Information
Patent Citations
Formula for improving dsRNA insecticidal effect
CN113100235A