Use of miR-541 in preparation of a non-invasive diagnosis and prognosis evaluation kit for liver fibrosis / cirrhosis
By detecting the expression level of miR-541 in the serum of patients with cirrhosis, and using reverse transcription and RT-PCR methods, the challenges of non-invasive diagnosis and prognostic assessment have been solved, enabling accurate judgment of the condition and prognosis of patients with cirrhosis and guiding clinical treatment.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-09
- Publication Date
- 2026-04-07
AI Technical Summary
Current technologies lack effective non-invasive diagnostic biomarkers and prognostic assessment methods to predict the severity and complications of liver fibrosis and cirrhosis, especially the prognosis of patients with cirrhosis. Traditional diagnostic methods, such as liver biopsy, are highly invasive and imaging examinations are expensive. Furthermore, there is insufficient research on the application of microRNA in cirrhosis.
The expression level of miR-541 was detected by serum miRNA extraction, reverse transcription and RT-PCR. Using miR-541 as a molecular marker, the severity, complications and prognosis of cirrhosis were judged by detecting its expression level in the serum of patients with cirrhosis.
This provides a non-invasive method to assess the prognosis of patients with cirrhosis, accurately determine the severity of their condition and the risk of complications, guide treatment, and delay or prevent decompensation in compensated cirrhosis.
Smart Images
Figure SMS_2 
Figure SMS_3 
Figure HDA0003934247620000011
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to the application of a microRNA, and more specifically, to the application of miR-541 in the preparation of a non-invasive diagnostic and prognostic kit for liver fibrosis / cirrhosis. Background Technology
[0002] Liver fibrosis is an early stage of cirrhosis. Once it progresses to cirrhosis, especially decompensated cirrhosis, many complications such as hepatic encephalopathy, esophageal variceal bleeding, and ascites with infection will follow, drastically reducing survival rates and making it one of the most life-threatening diseases. It is mainly characterized by the continuous activation of hepatic stellate cells (HSCs) and excessive extracellular matrix deposition under long-term stimulation of the liver by various acute and chronic damaging factors such as viruses (HBV / HCV, toxins, drugs, alcohol, oxidative stress factors, etc.). HSC activation is a key step in the development of liver fibrosis. The mechanism of liver fibrosis is not fully understood, especially the key targets, cells, and molecules, which require further in-depth research and confirmation. Multiple signaling pathways and molecules can inhibit or maintain the development of liver fibrosis by suppressing or maintaining HSC activation and proliferation.
[0003] Early identification and intervention of liver fibrosis hold promise for reversing fibrosis and preventing its progression to irreversible cirrhosis or liver cancer. Current diagnostic methods mainly include liver biopsy, imaging examinations such as ultrasound and MRI, blood biomarkers, biochemical models, and liver stiffness testing. Liver biopsy remains the gold standard for diagnosing liver fibrosis, but it is highly invasive and difficult for many patients to tolerate. Imaging examinations such as MRI are expensive, deterring many patients. In recent years, with the promotion and advancement of non-invasive diagnostic technologies, more and more research has focused on serum biomarkers and biochemical models. Among these, microRNAs (miRNAs) are highly favored by researchers due to their stable presence in serum and may serve as good non-invasive diagnostic biomarkers, therapeutic targets, and prognostic factors. Currently, there are relatively few studies on the non-invasive diagnosis and prognostic analysis of miRNAs in cirrhosis, with small sample sizes, mostly limited to a single indicator, lacking in-depth research, and many lack supporting molecular mechanisms, thus failing to meet clinical predictive requirements.
[0004] There is an urgent need in this field to find relevant non-invasive diagnostic biomarkers that can predict the condition and prognosis of liver fibrosis / cirrhosis. Research in this area is of great significance for the clinical treatment of liver fibrosis / cirrhosis and the prevention of liver cancer.
[0005] MicroRNA 541 (miR-541) is a 22-nucleotide non-coding RNA (UGGUGGGCACAGAAUCUGGACU, SEQ ID NO:1) located on human chromosome 14 and is a member of the miRNA cluster in the DLK1 / DIO3 imprinted gene region. In our previous study of hepatocyte nuclear factor 4α, we found that it can transcribe and regulate the miR-379-656 cluster in the DLK1 / DIO3 imprinted gene region, and miR-541 is also in this cluster. Our previous studies on the role of miR-541 in hepatocellular carcinoma suggest that it can inhibit hepatocellular carcinoma, is related to the prognosis of hepatocellular carcinoma, and can inhibit sorafenib resistance by inhibiting autophagy (Xu WP, et al. miR-541 potentiates the response of human hepatocellular carcinoma tosorafenib treatment by inhibiting autophagy. Gut. 2020; 69(7):1309-1321). Besides affecting tumors such as liver cancer and cholangiocarcinoma, miR-541 can also influence cell differentiation, regulate lung and kidney fibrosis, and its expression decreases in damaged tissues. Liver fibrosis is a repair response of the liver to damaging factors, but its molecular mechanism is not fully understood, and effective therapeutic targets and prognostic markers are very limited.
[0006] However, there are currently no reports on the expression changes of miR-541 in the serum of patients with cirrhosis, or whether it can be used as a non-invasive diagnostic marker and prognostic factor for cirrhosis. Summary of the Invention
[0007] The purpose of this invention is to provide new applications for miR-541, particularly in the preparation of non-invasive diagnostic biomarkers and prognostic assessment kits for liver fibrosis / cirrhosis.
[0008] Through extensive and in-depth research, the inventors have discovered for the first time that detecting the expression level of miR-541 in the serum of patients with cirrhosis using serum miRNA extraction, reverse transcription, and RT-PCR can determine the severity of cirrhosis, the presence of decompensated complications such as ascites in compensated cirrhosis patients, and the survival rate of cirrhosis patients. Based on this correlation between miR-541 expression level and cirrhosis, using miR-541 as a molecular marker to detect its expression level can guide the prognosis of cirrhosis patients.
[0009] In a first aspect, the invention provides the use of miR-541 as a diagnostic marker in the preparation of a prognostic assessment kit for liver fibrosis / cirrhosis.
[0010] Furthermore, the prognostic assessment kit includes reagents for detecting the expression level of miR-541 in the serum of patients with cirrhosis using miRNA reverse transcription and RT-PCR methods.
[0011] Furthermore, the prognostic assessment kit is a non-invasive prognostic assessment kit.
[0012] Furthermore, the application refers to using miR-541 as a molecular marker and analyzing the expression level of miR-541 in the serum of patients with cirrhosis using serum miRNA extraction, reverse transcription, and RT-PCR.
[0013] Furthermore, in the aforementioned application, the expression level of miR-541 was categorized using the median miR-541 expression score in the serum of 84 patients with liver cirrhosis (1.07). The boundary is 10E-7); when it is above the median, it is considered high expression of miR-541, and when it is below the median, it is considered low expression of miR-541.
[0014] The discovery of the correlation between miR-541 and cirrhosis in this invention provides a novel approach to predicting the severity of cirrhosis, the occurrence of complications, and patient survival or death. It plays a crucial role in assessing the prognosis of cirrhosis patients and offers significant guidance for preventing or delaying decompensation in compensated cirrhosis. When the expression level of miR-541 is below the median, compensated cirrhosis is prone to complications such as ascites and hepatic encephalopathy, increasing the risk of death for cirrhosis patients.
[0015] In a second aspect, the invention provides the use of a reagent for detecting serum miR-541 expression levels in the preparation of a prognostic assessment kit for liver fibrosis / cirrhosis.
[0016] Furthermore, the reagent for detecting serum miR-541 expression is a reagent that uses miRNA reverse transcription and RT-PCR to detect the expression level of miR-541 in the serum of patients with cirrhosis.
[0017] A third aspect of the present invention provides a non-invasive prognostic assessment kit for liver fibrosis / cirrhosis, the kit comprising reagents for detecting the expression level of miR-541 in the serum of patients with cirrhosis using miRNA reverse transcription and RT-PCR methods.
[0018] The advantages of this invention are:
[0019] This invention utilizes serum miRNA extraction, reverse transcription, and RT-PCR to determine the expression level of miR-541 in the serum of patients with cirrhosis. Combined with follow-up information, it was determined that the expression level of miR-541 is correlated with the prognosis of patients with cirrhosis. miR-541 can be used to prepare a non-invasive molecular marker for judging the prognosis of patients with cirrhosis, and it also has important guiding significance for the prevention or delay of decompensation in compensated cirrhosis. Attached Figure Description
[0020] Figure 1 The expression of miR-541 was decreased in activated hepatic stellate cells and cirrhotic liver tissue. A represents the expression of miR-541 in LX-2 cells after treatment with different concentration gradients of TGF-β; B represents the expression of miR-541 in LX-2 cells at different time points after treatment with 5 ng / ml TGF-β; and C represents the expression of miR-541 in cirrhotic and normal liver tissues.
[0021] Figure 2 miR-541 inhibits the proliferation of hepatic stellate cells in vitro. Specifically, A represents the inhibition of LX-2 proliferation by overexpressing miR-541, and B represents the promotion of LX-2 proliferation by downregulating miR-541.
[0022] Figure 3 The study investigated the in vitro inhibition of hepatic stellate cell activation by miR-541. Specifically, A represents the inhibition of liver fibrosis markers Acta2 and Col1a1 mRNA expression by overexpressing miR-541; B represents the inhibition of liver fibrosis markers Acta2 and Col1a1 protein expression by overexpressing miR-541; C represents the promotion of liver fibrosis markers Acta2 and Col1a1 mRNA expression by downregulating miR-541; and D represents the promotion of liver fibrosis markers Acta2 and Col1a1 protein expression by downregulating miR-541.
[0023] Figure 4 This study investigated the decreased expression of miR-541 in the serum of patients with cirrhosis and its correlation with the severity of cirrhosis. Specifically, A represents the expression of miR-541 in the serum of healthy individuals, patients with compensated cirrhosis, and patients with decompensated cirrhosis; B represents the correlation between serum miR-541 levels and MELD scores in patients with cirrhosis; and C compares the expression of serum miR-541 in patients with cirrhosis at different Child-Pugh classifications.
[0024] Figure 5 This is a comparative graph showing the complications of patients with compensated cirrhosis grouped according to serum miR-541 expression levels. In the graph, A compares the incidence of ascites between the high and low serum miR-541 expression groups, and B compares the incidence of hepatic encephalopathy between the high and low serum miR-541 expression groups.
[0025] Figure 6 This is a curve showing the complication-free survival of patients with cirrhosis grouped according to serum miR-541 expression levels.
[0026] Figure 7 The overall survival curves are shown for grouping cirrhotic patients based on serum miR-541 expression levels. Detailed Implementation
[0027] The specific implementation methods provided by the present invention will be described in detail below with reference to the embodiments. The following embodiments are implemented under the premise of the technical solution of the present invention, and detailed implementation methods and specific operation processes are given. However, the protection scope of the present invention is not limited to the following embodiments.
[0028] Example 1:
[0029] LX-2 cells were stimulated with different concentrations of TGF-β (0 ng / ml, 2.5 ng / ml, 5 ng / ml, and 10 ng / ml). After 48 hours of stimulation, the cells were collected and RNA was extracted. The expression of miR-541 was detected by RT-PCR. The results showed that the expression of miR-541 was significantly decreased at 5 ng / ml TGF-β. Figure 1 Furthermore, LX-2 was stimulated with 5 ng / ml TGF-β, and the expression of miR-541 was detected at different time points (0h, 12h, 24h, 48h). It was found that miR-541 expression decreased significantly after 24h and 48h. Figure 1 The results suggest that miR-541 expression is decreased in activated hepatic stellate cells.
[0030] Example 2:
[0031] Liver tissue specimens from 20 patients with liver fibrosis / cirrhosis after transplantation and 20 discarded donor liver specimens (all liver tissue specimens were from Ruijin Hospital) were randomly selected. The tissues were ground, RNA was extracted using the Trizol method, and miR-541 expression was detected by RT-PCR. The results showed that miR-541 expression was decreased in cirrhotic tissues. Figure 1 ).
[0032] The specific methods for detecting the expression level of miR-541 in cells and tissues are as follows:
[0033] 1. Extract total RNA from collected cell or tissue samples using the Trizol method and quantify it. The specific steps are as follows:
[0034] (1) Grind the tissue or cultured cells, add 1 ml of Trizol; repeatedly pipette until the mixture is uniform and non-viscous, fully lyse the tissue or cells, and transfer it into a 1.5 ml Ep tube;
[0035] (2) Add 200 μl of chloroform (1 / 5 of the volume of Trizol) to each Ep tube, shake well to mix, and let stand at room temperature for about 5 minutes;
[0036] (3) Centrifuge 12000g in a centrifuge that has been pre-cooled to 4 ℃ for 15 minutes;
[0037] (4) At this time, the solution can be in three layers. Carefully transfer the upper transparent liquid into a new clean 1.5ml Ep tube, add 500μl isopropanol (equal volume to the upper transparent liquid), invert the Ep tube 6-8 times to mix it, and precipitate at -80℃ for about 30 minutes.
[0038] (5) Centrifuge at 12000g for 10 minutes at 4℃. At this time, a white precipitate can be seen at the bottom of the tube.
[0039] (6) Remove the supernatant, add 1 ml of 85% ethanol (prepared with DEPC water) to the Ep tube and gently tap the precipitate;
[0040] (7) Centrifuge at 7500g for 5 minutes at 4℃, discard the supernatant again, rinse once more, or directly invert the Ep tube to dry at room temperature;
[0041] (8) When the white precipitate is translucent, add an appropriate amount of DEPC water to dissolve the RNA;
[0042] (9) Measure the RNA concentration and the 260 nm / 280 nm value, and use it directly or store the RNA in a -80 ℃ refrigerator for later use.
[0043] 2. Reverse transcription using the tailing method, the preparation system and conditions are as follows:
[0044]
[0045] Reaction conditions: 37℃ for 60 min, 85℃ for 5 min, 4℃ -
[0046] 3. RT-PCR
[0047] Serum miRNA expression levels were analyzed using the SYBR Premix Ex Taq kit and Step-one real-time quantitative PCR instrument, with U6 as the internal control.
[0048] PCR reaction system:
[0049]
[0050] PCR reaction conditions: 94 ℃ for 30 s, 94 ℃ for 10 s, 60 ℃ for 30 s, for a total of 40 cycles (two-step method), and the ΔΔCt method was used for calculation and analysis.
[0051] Example 3:
[0052] Activated human hepatic stellate cells (LX-2) were transfected with a chemically synthesized miR-541 mimic to upregulate miR-541 expression, or transfected with a 2-methoxy-modified miR-541 complementary strand (miR-541 inhibitor) to inhibit miR-541 activity. The number of viable cells was detected using a CCK8 cell-counting kit, and growth curves were plotted to observe changes in proliferation. Results showed that upregulation of miR-541 inhibited LX-2 cell proliferation, while downregulation of miR-541 promoted LX-2 cell proliferation. Figure 2 The results suggest that miR-541 can inhibit the proliferation of activated hepatic stellate cells.
[0053] Example 4:
[0054] Activated LX-2 cells were transfected with miR-541 mimic or miR-541 inhibitor to upregulate or downregulate miR-541 expression. After culturing cells for 48 hours, RNA was extracted using the Trizol method, and cDNA was obtained by reverse transcription. RT-PCR was used to confirm the mRNA expression of Acta2 and Col1a1. Western blot was used to detect the protein expression of α-SMA and Col1a1. The results suggest that upregulation of miR-541 inhibits the expression of Acta2 and Col1a1, while downregulation of miR-541 promotes the expression of Acta2 and Col1a1. Figure 3 The results showed that miR-541 could inhibit the activation of hepatic stellate cells.
[0055] Example 5:
[0056] Serum samples from 84 patients with cirrhosis (all serum samples were obtained from Shanghai Changzheng Hospital and diagnosed with cirrhosis by two clinicians) and 50 healthy controls were randomly selected. RNA was extracted using a serum miRNA extraction kit, and the expression level of miR-541 in the serum of patients with cirrhosis was detected by RT-PCR. This method included the following steps:
[0057] 1. Total miRNA was extracted from serum using the miReasy Serum / Plasma Advanced Kit, as described below.
[0058] 2. miRNA reverse transcription, using the same method as tissue miRNA reverse transcription.
[0059] 3. RT-PCR, same method as for tissue analysis, with Ce-miR-39 as the internal control.
[0060] The specific steps for miRNA extraction are as follows:
[0061] (1) Take the serum sample out of the -80℃ freezer, thaw it, and centrifuge it for later use.
[0062] (2) Take 200 μL of serum and transfer it to a new 1.5 mL EP tube.
[0063] (3) Add 60ul Buffer RPL, shake for at least 5 seconds, mix well, and let stand at room temperature for 3 minutes.
[0064] (4) Add 3.5ul miReasy Serum / Plasma Spike-In Control and mix well.
[0065] (5) Add 20ul Buffer RPP, shake for at least 20 seconds, mix well, and let stand at room temperature for 3 minutes.
[0066] (6) Centrifuge at 12000g for 3 minutes at room temperature.
[0067] (7) Transfer the supernatant to a new 1.5ml EP tube, add an equal volume of isopropanol, and mix well.
[0068] (8) Add the mixed liquid to the RNeasy UCP MinElute column, centrifuge for 15s, weigh not less than 8000g, and discard the lower liquid.
[0069] (9) Add 700ul Buffer RWT to the UCP column, centrifuge for 15 seconds, weigh no less than 8000g, and discard the lower liquid.
[0070] (10) Add 500ul Buffer RPE to the UCP column, centrifuge for 15 seconds, weigh no less than 8000g, and discard the lower liquid.
[0071] (11) Add 500ul of 80% ethanol to the UCP column, centrifuge for 2 minutes, and the volume should be no less than 8000g. Discard the lower liquid.
[0072] (12) Place the UCP column into a new 1.5ml EP tube, let it dry, add 20ul of double-distilled water without RNase, incubate at room temperature for 1 minute, centrifuge at 12000g for 1 minute to wash out RNA, and use it directly for the next step or store at -80℃.
[0073] Comparing the serum levels of miR-541 in cirrhotic patients and healthy individuals, the results indicated that serum miR-541 expression was lower in patients with compensated cirrhosis than in healthy individuals, but the difference was not statistically significant. In patients with decompensated cirrhosis, miR-541 expression was significantly lower than in healthy individuals, and this difference was statistically significant. Serum miR-541 levels in decompensated cirrhosis patients were significantly lower than those in compensated cirrhosis. Figure 4 According to the Child-Pugh staging system, the level of miR-541 in stage C was significantly lower than that in stage B, and both were lower than those in stage A. Figure 4 Furthermore, miR-541 was negatively correlated with MELD scores. Figure 4 The results suggest that the expression of miR-541 in the serum of patients with cirrhosis is correlated with the severity of cirrhosis.
[0074] Comparing the differences in the incidence of complications such as ascites and hepatic encephalopathy among patients in the compensated stage, the results suggest that the miR-541 high expression group is less likely to develop ascites and hepatic encephalopathy-related complications, while the low expression group is more likely to develop these complications. Figure 5 ).
[0075] Plot the overall survival curve ( Figure 6 ) and complication-free survival curves ( Figure 7 The results showed that patients with high miR-541 expression in cirrhosis had significantly longer complication-free survival and overall survival than those with low expression.
[0076] The above experimental results show that detecting the expression level of miR-541 in the serum of patients with cirrhosis using RT-PCR can predict the severity of cirrhosis, the occurrence of complications, and the patient's survival or death. When miR-541 is below the median, compensated cirrhosis is prone to decompensation-related complications, and patients with cirrhosis are more likely to die. Clearly, miR-541 is correlated with the severity of cirrhosis; therefore, using miR-541 as a molecular marker to detect its expression level can predict events such as decompensation in cirrhosis and determine prognosis. Accordingly, serum miRNA extraction kits and RT-PCR can be used to prepare agents or kits for determining the prognosis of cirrhosis, which is obvious to those skilled in the art.
[0077] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application.
Claims
1. Application of miR-541 as a diagnostic marker in the preparation of a prognostic assessment kit for liver cirrhosis.
2. The application of miR-541 as a diagnostic marker in the preparation of a prognostic assessment kit for liver cirrhosis according to claim 1, characterized in that, The kit contains reagents for detecting the expression level of miR-541 in the serum of patients with cirrhosis using miRNA reverse transcription and RT-PCR methods.
3. The application of miR-541 as a diagnostic marker in the preparation of a prognostic assessment kit for liver cirrhosis according to claim 1, characterized in that, The kit described is a non-invasive prognostic assessment kit.
4. The application of miR-541 as a diagnostic marker in the preparation of a prognostic assessment kit for liver cirrhosis according to claim 1, characterized in that, The application refers to using miR-541 as a molecular marker and analyzing the expression level of miR-541 in the serum of patients with cirrhosis by extracting serum miRNA, reverse transcription, and RT-PCR.
5. Application of reagents for detecting serum miR-541 expression levels in the preparation of prognostic assessment kits for liver cirrhosis.
6. The application of the reagent for detecting serum miR-541 expression according to claim 5 in the preparation of a prognostic assessment kit for liver cirrhosis, characterized in that, The reagent for detecting serum miR-541 expression is a reagent that uses miRNA reverse transcription and RT-PCR to detect the expression level of miR-541 in the serum of patients with cirrhosis.
7. A non-invasive prognostic assessment kit for liver cirrhosis, characterized in that, The kit contains reagents for detecting the expression level of miR-541 in the serum of patients with cirrhosis using miRNA reverse transcription and RT-PCR methods.